Mitochondrial translation factors of Trypanosoma brucei: elongation
... cytosolic tRNAs and with highly derived ribosomes having ultra-short rRNAs (Niemann et al., 2011). Of all the translation factors mentioned above, EF-Tu is therefore of special interest since it must directly interact with both imported, eukaryotic-type tRNAs and the uniquely structured ribosome. EF ...
... cytosolic tRNAs and with highly derived ribosomes having ultra-short rRNAs (Niemann et al., 2011). Of all the translation factors mentioned above, EF-Tu is therefore of special interest since it must directly interact with both imported, eukaryotic-type tRNAs and the uniquely structured ribosome. EF ...
Control of Appetite and Food Preference by NMDA Receptor and Its
... Abstract: Obesity causes a significant negative impact on health of human beings world-wide. The main reason for weight gain, which eventually leads to obesity, is excessive ingestion of energy above the body’s homeostatic needs. Therefore, the elucidation of detailed mechanisms for appetite control ...
... Abstract: Obesity causes a significant negative impact on health of human beings world-wide. The main reason for weight gain, which eventually leads to obesity, is excessive ingestion of energy above the body’s homeostatic needs. Therefore, the elucidation of detailed mechanisms for appetite control ...
Coordination of Hox identity between germ layers along the anterior
... considering the apparent complexity of the phenomenon. Studies conducted mainly in vitro by modification of the substratum, drew attention to the interaction between the involuted mesoderm and the blastocoel as a main driving force for gastrulation (Winklbauer, 1990). Moreover, identification of fi ...
... considering the apparent complexity of the phenomenon. Studies conducted mainly in vitro by modification of the substratum, drew attention to the interaction between the involuted mesoderm and the blastocoel as a main driving force for gastrulation (Winklbauer, 1990). Moreover, identification of fi ...
Bacillus subtilis serine/threonine protein kinase YabT is involved in
... 2002) exhibits a structure that is typical for proteins of its family (Pereira et al., 2011) (Fig. 1A). Its catalytic kinase domain is at the N-terminus, it is followed by a transmembrane helix, connecting to an extracellular domain responsible for ligand binding and activation (Shah et al., 2008). ...
... 2002) exhibits a structure that is typical for proteins of its family (Pereira et al., 2011) (Fig. 1A). Its catalytic kinase domain is at the N-terminus, it is followed by a transmembrane helix, connecting to an extracellular domain responsible for ligand binding and activation (Shah et al., 2008). ...
Glycolysis and Gluconeogenesis
... What is the function of HIF-1? hypoxia-inducible transcription factor stimulates synthesis of many glycolytic enzymes and GLUT-1 and 3 also stimulates vascular endothelial growth factor ...
... What is the function of HIF-1? hypoxia-inducible transcription factor stimulates synthesis of many glycolytic enzymes and GLUT-1 and 3 also stimulates vascular endothelial growth factor ...
1 Expression of Ion Channels in Xenopus Oocytes
... for high resolution electrophysiological recording from oocytes and it is particularly well-suited for analyzing fast ionic and gating currents [10, 11]. There are a number of disadvantages to using oocytes for expression of ion channels. First, as pointed out above, oocytes do express some endogeno ...
... for high resolution electrophysiological recording from oocytes and it is particularly well-suited for analyzing fast ionic and gating currents [10, 11]. There are a number of disadvantages to using oocytes for expression of ion channels. First, as pointed out above, oocytes do express some endogeno ...
Many ways to telomere dysfunction: in vivo studies using
... (Boulton and Jackson, 1996, 1998; Laroche et al., 1998; Gravel et al., 1998; Nugent et al., 1998b). The analysis of Ku86 de®cient mice, however, depicts a very dierent scenario. Although Ku86 de®ciency in the mouse results in telomeric fusions (Bailey et al., 1999; Hsu et al., 2000; Samper et al., ...
... (Boulton and Jackson, 1996, 1998; Laroche et al., 1998; Gravel et al., 1998; Nugent et al., 1998b). The analysis of Ku86 de®cient mice, however, depicts a very dierent scenario. Although Ku86 de®ciency in the mouse results in telomeric fusions (Bailey et al., 1999; Hsu et al., 2000; Samper et al., ...
Chlamydia Exploit the Mammalian Tryptophan-Depletion
... distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academ ...
... distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academ ...
Cloning, Expression and Interaction Studies of the Potential
... Halothiobacillus neapolitanus chromosomal DNA, 10 µM of the forward primer (5’GGATCCATGACACAAAATGCAGATCAATATCG3’Tm= 59.4 ºC), 10 µM of the reverse primer (5’AAGCTTTTAAAAGAACGTTTTGACGACGG3’ Tm= 58.4 ºC), 10 µL of the 5x Reaction Buffer, 1 µL of Deep Vent DNA polymerase (NEB), 2.5 mM dNTPs, and steril ...
... Halothiobacillus neapolitanus chromosomal DNA, 10 µM of the forward primer (5’GGATCCATGACACAAAATGCAGATCAATATCG3’Tm= 59.4 ºC), 10 µM of the reverse primer (5’AAGCTTTTAAAAGAACGTTTTGACGACGG3’ Tm= 58.4 ºC), 10 µL of the 5x Reaction Buffer, 1 µL of Deep Vent DNA polymerase (NEB), 2.5 mM dNTPs, and steril ...
A motif of eleven amino acids is a structural adaptation that
... ‘voltage sensors’ across the membrane (Ashmore, 1989; SantosSacchi, 1991). We first measured NLC from gerbil prestinexpressing human embryonic kidney (HEK) cells and an example is shown in Fig. 2B. Gerbil prestin produced a bell-shaped response with a peak capacitance of approximately 1.2 pF at 273 ...
... ‘voltage sensors’ across the membrane (Ashmore, 1989; SantosSacchi, 1991). We first measured NLC from gerbil prestinexpressing human embryonic kidney (HEK) cells and an example is shown in Fig. 2B. Gerbil prestin produced a bell-shaped response with a peak capacitance of approximately 1.2 pF at 273 ...
Striatal Plasticity and Basal Ganglia Circuit Function
... for some of the reported actions of dopamine on synaptic vesicle cycling (Bamford et al., 2004; Bamford et al., 2008). LTD at Excitatory Synapses on MSNs High-frequency stimulation (HFS) of excitatory striatal afferents in vitro leads to a long-lasting reduction in synaptic strength at MSN synapses ...
... for some of the reported actions of dopamine on synaptic vesicle cycling (Bamford et al., 2004; Bamford et al., 2008). LTD at Excitatory Synapses on MSNs High-frequency stimulation (HFS) of excitatory striatal afferents in vitro leads to a long-lasting reduction in synaptic strength at MSN synapses ...
Article Full Text PDF
... goldfish (Carassius auratus). The zebrafish M-cell has an axon cap, a high resistivity structure which surrounds the initial segment of the M-axon, and accounts for an unusual amplification of the fields generated within and around it. Second, extra- and intracellular recordings were performed with ...
... goldfish (Carassius auratus). The zebrafish M-cell has an axon cap, a high resistivity structure which surrounds the initial segment of the M-axon, and accounts for an unusual amplification of the fields generated within and around it. Second, extra- and intracellular recordings were performed with ...
Some Structural and Kinetic Aspects of L
... domains, closer to domain A. This active site binds PK substrate phosphoenolpyruvate and also positively charged ions: bivalent and monovalent cations (usually Mg2+ and K+), that are required for PK reaction (Muirhead et al., 1986). This site contains three positively charged residues: lysine and tw ...
... domains, closer to domain A. This active site binds PK substrate phosphoenolpyruvate and also positively charged ions: bivalent and monovalent cations (usually Mg2+ and K+), that are required for PK reaction (Muirhead et al., 1986). This site contains three positively charged residues: lysine and tw ...
Mitochondrial Antiviral Signaling Protein Innate Immunity by
... B, HepG2 cells were infected with HBV-positive serum containing 107 copies/ml HBV. Cells were washed eight times to remove excess viral inputs 2 h postinfection and were then transfected with poly(dAT:dAT) together with IFN-b–Luc, NF-kB–Luc, or IRF-3–Luc. Serum from uninfected individuals was used a ...
... B, HepG2 cells were infected with HBV-positive serum containing 107 copies/ml HBV. Cells were washed eight times to remove excess viral inputs 2 h postinfection and were then transfected with poly(dAT:dAT) together with IFN-b–Luc, NF-kB–Luc, or IRF-3–Luc. Serum from uninfected individuals was used a ...
Nerve growth factor and nociception: from
... embryonic sensory neurons begin to respond to capsaicin at embryonic stages coinciding with the innervation of NGF-rich target tissues (Hjerling-Leffler et al., 2007) (Figure 1B). The vast majority of nociceptors are primarily sensitive to mechanical stimuli and many possess fast activated mechanose ...
... embryonic sensory neurons begin to respond to capsaicin at embryonic stages coinciding with the innervation of NGF-rich target tissues (Hjerling-Leffler et al., 2007) (Figure 1B). The vast majority of nociceptors are primarily sensitive to mechanical stimuli and many possess fast activated mechanose ...
Development and evaluation of a reporter system for
... phosphatases function as scavengers of organic phosphoesters (Beacham, 1979), while some of them participate in an assortment of essential biological functions, including the regulation of metabolism, energy conversion and signal transduction (Stock et al ., 1995; Klumpp and Krieglstein, 2002). Inde ...
... phosphatases function as scavengers of organic phosphoesters (Beacham, 1979), while some of them participate in an assortment of essential biological functions, including the regulation of metabolism, energy conversion and signal transduction (Stock et al ., 1995; Klumpp and Krieglstein, 2002). Inde ...
Investigating The Metal Binding Sites In Znta, A Zinc Transporting
... Sensitivity to metal salts. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .60 ...
... Sensitivity to metal salts. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .60 ...
THE INFLUENCE OF NUTRITIONAL PHOSPHATE DEPRIVATION ARABIDOPSIS THALIANA
... cultures by 2-dimensional gel electrophoresis. Mass spectrometry identified 18 different secreted proteins that were upregulated by at least 2-fold by –Pi Arabidopsis. They were predicted to function in Pi scavenging, cell wall and ROS metabolism, proteolysis, and pathogen responses. The relationshi ...
... cultures by 2-dimensional gel electrophoresis. Mass spectrometry identified 18 different secreted proteins that were upregulated by at least 2-fold by –Pi Arabidopsis. They were predicted to function in Pi scavenging, cell wall and ROS metabolism, proteolysis, and pathogen responses. The relationshi ...
Independent and Convergent Signals From the Pontomedullary
... that serve to stabilize the body or body segment during the execution of the movement itself. These postural responses are also anticipatory in nature because they occur before there is any possibility of feedback from the movement itself influencing the response (Massion 1992). They are referred to ...
... that serve to stabilize the body or body segment during the execution of the movement itself. These postural responses are also anticipatory in nature because they occur before there is any possibility of feedback from the movement itself influencing the response (Massion 1992). They are referred to ...
The Membrane Steps of Bacterial Cell Wall Synthesis as Antibiotic
... milliliters of the cell-free reaction volumes [33,37,38]. However, EcMraY was found to form aggregates in the presence of a range of detergents, and any purified material was inactive [38]. The cell-free expression system was useful for investigating the role of lipid composition on EcMraY function. ...
... milliliters of the cell-free reaction volumes [33,37,38]. However, EcMraY was found to form aggregates in the presence of a range of detergents, and any purified material was inactive [38]. The cell-free expression system was useful for investigating the role of lipid composition on EcMraY function. ...
Defining the complementarities between antibodies and haptens to
... by palindromic and nontemplated nucleotides addition through the activity of V(D)J recombinase [3]. Additionally, the primary repertoire diversity is enhanced by combinatorial linkage of heavy and light chains. This second phase of diversification is antigen dependent, occurs in the activated B-cell ...
... by palindromic and nontemplated nucleotides addition through the activity of V(D)J recombinase [3]. Additionally, the primary repertoire diversity is enhanced by combinatorial linkage of heavy and light chains. This second phase of diversification is antigen dependent, occurs in the activated B-cell ...
Endoplasmic reticulum localization of the low density lipoprotein
... growth factor homology domain, transmembrane domain, and cytoplasmic tail would be unnecessary for such a protein to mediate apoB degradation. To create this ER-localized LDLR, we used a truncated form of the human LDLR that binds to LDL in a Ca2⫹-dependent manner (10), analogous to the full-length ...
... growth factor homology domain, transmembrane domain, and cytoplasmic tail would be unnecessary for such a protein to mediate apoB degradation. To create this ER-localized LDLR, we used a truncated form of the human LDLR that binds to LDL in a Ca2⫹-dependent manner (10), analogous to the full-length ...
PROTEIN SUBCELLULAR LOCALIZATION
... entries is dual localization to the nucleus and cytosol. This is an important category of proteins, for example some transcription factors are regulated by conditional localization to the nucleus8 . The prediction results seen in the confusion matrix (Table 6) are mixed. Unfortunately most of the 91 ...
... entries is dual localization to the nucleus and cytosol. This is an important category of proteins, for example some transcription factors are regulated by conditional localization to the nucleus8 . The prediction results seen in the confusion matrix (Table 6) are mixed. Unfortunately most of the 91 ...
View Full Page PDF
... mutations of PP1 in fungi could be (partially) complemented by expression of mammalian PP1 (113, 311), indicating that PP1 is also functionally conserved. Eukaryotic genomes contain one (Saccharomyces cerevisiae) to eight genes (Arabidopsis thaliana) encoding PP1 isoforms. More than 70% of the resid ...
... mutations of PP1 in fungi could be (partially) complemented by expression of mammalian PP1 (113, 311), indicating that PP1 is also functionally conserved. Eukaryotic genomes contain one (Saccharomyces cerevisiae) to eight genes (Arabidopsis thaliana) encoding PP1 isoforms. More than 70% of the resid ...
How to define flow cytometry ? Méthodes d’étude de la cellule
... °PE/CY5 fixed monocytes and B lymphocytes of mice SJL, AKR, NOD Rappel PE-CY5 excited at 488 nm by the emit energy transferred from PE but also by the laser 633 nm via CY5, compensations could be elevated or difficult to realize so try to replace PE-CY5 by PECY5.5 or PE-CY7 in a combination with APC ...
... °PE/CY5 fixed monocytes and B lymphocytes of mice SJL, AKR, NOD Rappel PE-CY5 excited at 488 nm by the emit energy transferred from PE but also by the laser 633 nm via CY5, compensations could be elevated or difficult to realize so try to replace PE-CY5 by PECY5.5 or PE-CY7 in a combination with APC ...
Signal transduction
Signal transduction occurs when an extracellular signaling molecule activates a specific receptor located on the cell surface or inside the cell. In turn, this receptor triggers a biochemical chain of events inside the cell, creating a response. Depending on the cell, the response alters the cell's metabolism, shape, gene expression, or ability to divide. The signal can be amplified at any step. Thus, one signaling molecule can cause many responses.