
A. Work Accomplished by You and/or Others Cellular biology of
... and higher eukaryotes. A number of these proteins play dependency on the chaperone for both stability and roles in human cancer. activity even under non-stress conditions, and consequently high levels of Hsp90 are found in all eukaryotic cells. A hallmark of Hsp90-client protein interactions is that ...
... and higher eukaryotes. A number of these proteins play dependency on the chaperone for both stability and roles in human cancer. activity even under non-stress conditions, and consequently high levels of Hsp90 are found in all eukaryotic cells. A hallmark of Hsp90-client protein interactions is that ...
T-cell Acute Lymphoblastic Leukemia-The
... Prokaryoticexpression of SCL /tal andpolyclonal antisemmproduction. DNA containing the coding sequences for the 131 carboxy terminal amino acids of SCL/tal was amplified by polymerase chain reaction (PCR)18 using the following primers: 5'mer of 5' GCTCTAGAGCCATGCAGCAGAATGTGAACGGGGCCTTT3'and a 3'mer ...
... Prokaryoticexpression of SCL /tal andpolyclonal antisemmproduction. DNA containing the coding sequences for the 131 carboxy terminal amino acids of SCL/tal was amplified by polymerase chain reaction (PCR)18 using the following primers: 5'mer of 5' GCTCTAGAGCCATGCAGCAGAATGTGAACGGGGCCTTT3'and a 3'mer ...
implementation of medicinal leech preparation to investigate the
... perspective of mitigating a threat. Development of a portable device that is fast and efficient would be useful for emergency situations where organophosphate neurotoxins may be present. To do so, more research needs to be conducted on the effects of such organophosphates on the nervous system. Shar ...
... perspective of mitigating a threat. Development of a portable device that is fast and efficient would be useful for emergency situations where organophosphate neurotoxins may be present. To do so, more research needs to be conducted on the effects of such organophosphates on the nervous system. Shar ...
Sample pages 1 PDF
... Before one can assess which channel types are relevant for Na+ uptake, it is important to understand the basic properties of ion channel proteins. Ion channels are generally characterised by three features: (a) their conductance, which determines the amount of current that flows through an open chan ...
... Before one can assess which channel types are relevant for Na+ uptake, it is important to understand the basic properties of ion channel proteins. Ion channels are generally characterised by three features: (a) their conductance, which determines the amount of current that flows through an open chan ...
role of potassium in human and animal nutrition 2
... carrying an electrical current. The electrical charge acts as a “spark” that stimulates nerves and causes muscles to contract. ...
... carrying an electrical current. The electrical charge acts as a “spark” that stimulates nerves and causes muscles to contract. ...
Protein structure
... when exposed to a beam of X-rays. This experiment showed unequivocally that proteins possess an ordered, well-defined arrangement of atoms, and the field of structural biology was born. Proteins are a diverse class of biological polymers that play an extraordinary variety of functional roles. In the ...
... when exposed to a beam of X-rays. This experiment showed unequivocally that proteins possess an ordered, well-defined arrangement of atoms, and the field of structural biology was born. Proteins are a diverse class of biological polymers that play an extraordinary variety of functional roles. In the ...
The Roles of Germin Gene Products in Plants Under
... metabolic rates seen. Moreover, there are probably a number of genes that code for proteins involved in the more complex developmental aspects of germination and seedling establishment. Seedling establishment needs the mobilization of stored reserves, involving such supporting tissues as the cotyled ...
... metabolic rates seen. Moreover, there are probably a number of genes that code for proteins involved in the more complex developmental aspects of germination and seedling establishment. Seedling establishment needs the mobilization of stored reserves, involving such supporting tissues as the cotyled ...
The Vps13p–Cdc31p complex is directly required for TGN late
... endosome/prevacuolar compartment (PVC) and for TGN homotypic fusion. Vps13p must be in complex with the small calcium-binding protein Cdc31p to be active. Single-particle electron microscopic analysis of negatively stained Vps13p indicates that this 358-kD protein is folded into a compact rod-shaped ...
... endosome/prevacuolar compartment (PVC) and for TGN homotypic fusion. Vps13p must be in complex with the small calcium-binding protein Cdc31p to be active. Single-particle electron microscopic analysis of negatively stained Vps13p indicates that this 358-kD protein is folded into a compact rod-shaped ...
Treadmilling by FtsZ filaments drives peptidoglycan
... the position and activity of the cell wall synthases to FtsAZ treadmilling guides the progressive insertion of new cell wall, synthesizing increasingly small concentric rings to divide the cell. Main Text: Cells from all domains of life must divide in order to proliferate. In bacteria, cell division ...
... the position and activity of the cell wall synthases to FtsAZ treadmilling guides the progressive insertion of new cell wall, synthesizing increasingly small concentric rings to divide the cell. Main Text: Cells from all domains of life must divide in order to proliferate. In bacteria, cell division ...
Predicting protein folding rates from geometric contact and amino
... strongly correlated, with a correlation coefficient of 0.86 (Fig. 5A, see below). Predicting protein folding rates from sequences As proteins are generally tightly packed, one may assume, to first approximation, that each residue of a specific type has the same probability of a geometric contact as ...
... strongly correlated, with a correlation coefficient of 0.86 (Fig. 5A, see below). Predicting protein folding rates from sequences As proteins are generally tightly packed, one may assume, to first approximation, that each residue of a specific type has the same probability of a geometric contact as ...
The Lyn kinase C-lobe mediates Golgi export of Lyn through
... intramolecular binding of the SH2 domain to the tyrosinephosphorylated tail catalyzed by CSK-family kinases and the SH3 domain to the SH2-kinase linker (Brown and Cooper, 1996; Sicheri et al., 1997; Xu et al., 1997). Src-family tyrosine kinases can interact with a large number of upstream regulators ...
... intramolecular binding of the SH2 domain to the tyrosinephosphorylated tail catalyzed by CSK-family kinases and the SH3 domain to the SH2-kinase linker (Brown and Cooper, 1996; Sicheri et al., 1997; Xu et al., 1997). Src-family tyrosine kinases can interact with a large number of upstream regulators ...
From the regulation of peptidoglycan synthesis to bacterial growth
... chains are inserted into the sacculus. Peptidoglycan synthesis and insertion are guided by distinct elements of the bacterial cytoskeleton at different phases in the cell cycle. With the cooperation of actin-like rod-shapedetermining protein MreB, newly divided cells elongate by inserting peptidogly ...
... chains are inserted into the sacculus. Peptidoglycan synthesis and insertion are guided by distinct elements of the bacterial cytoskeleton at different phases in the cell cycle. With the cooperation of actin-like rod-shapedetermining protein MreB, newly divided cells elongate by inserting peptidogly ...
HGF and TGFβ1 differently influenced Wwox regulatory function on
... from breast cancer depended on Twist and Snail, we evaluated their expression and intracellular localization in response to HGF and TGFβ1, two typical stimuli of bone microenvironment [1, 2, 4, 25]. As shown in Fig. 1a, HGF rapidly and persistently enhanced Twist-protein level in nuclear extracts of ...
... from breast cancer depended on Twist and Snail, we evaluated their expression and intracellular localization in response to HGF and TGFβ1, two typical stimuli of bone microenvironment [1, 2, 4, 25]. As shown in Fig. 1a, HGF rapidly and persistently enhanced Twist-protein level in nuclear extracts of ...
Muscarinic Activation of a Cation Current and Associated Current
... associated with composite effects on membrane resistance Current-clamp experiments on the voltage responses induced by muscarinic stimulation in EC principal neurons were first carried out. In these recordings, tetrodotoxin (TTX; 1 M) and Cs⫹ (2– 4 mM) were added to the extracellular solution to bl ...
... associated with composite effects on membrane resistance Current-clamp experiments on the voltage responses induced by muscarinic stimulation in EC principal neurons were first carried out. In these recordings, tetrodotoxin (TTX; 1 M) and Cs⫹ (2– 4 mM) were added to the extracellular solution to bl ...
The novel mouse mutant, chuzhoi, has disruption of Ptk7
... Background: The planar cell polarity (PCP) signalling pathway is fundamental to a number of key developmental events, including initiation of neural tube closure. Disruption of the PCP pathway causes the severe neural tube defect of craniorachischisis, in which almost the entire brain and spinal cor ...
... Background: The planar cell polarity (PCP) signalling pathway is fundamental to a number of key developmental events, including initiation of neural tube closure. Disruption of the PCP pathway causes the severe neural tube defect of craniorachischisis, in which almost the entire brain and spinal cor ...
extracellular and intracellular signaling for neuronal polarity
... neurons form multiple minor processes. Stage 3 neurons possess one long neurite (immature axon) and several minor processes. The longest neurite ultimately develops into a mature axon. Therefore, the initial event of neuronal polarization in cultured neurons is axon initiation. Then, within 7 days, ...
... neurons form multiple minor processes. Stage 3 neurons possess one long neurite (immature axon) and several minor processes. The longest neurite ultimately develops into a mature axon. Therefore, the initial event of neuronal polarization in cultured neurons is axon initiation. Then, within 7 days, ...
Phytochemistry
... was studied with different carbohydrate and glycoprotein solutions in PBS as follows: 25 pl of a lectin soln of four hemagglutinating units were added to 25 pl of two-fold serially diluted carbohydrate (0.1 M) or glycoprotein (1.0% w/v) solns and after standing for 30 min, mixed with the erythrocyte ...
... was studied with different carbohydrate and glycoprotein solutions in PBS as follows: 25 pl of a lectin soln of four hemagglutinating units were added to 25 pl of two-fold serially diluted carbohydrate (0.1 M) or glycoprotein (1.0% w/v) solns and after standing for 30 min, mixed with the erythrocyte ...
Synapse formation in developing neural circuits.
... content to the intersynaptic space, called the synaptic cleft. The postsynaptic region is an area of the postsynaptic cell with a high concentration of neurotransmitter receptors, channels, and downstream signaling molecules. The neurotransmitters released by the presynaptic specializations are sens ...
... content to the intersynaptic space, called the synaptic cleft. The postsynaptic region is an area of the postsynaptic cell with a high concentration of neurotransmitter receptors, channels, and downstream signaling molecules. The neurotransmitters released by the presynaptic specializations are sens ...
Figure 7. N-terminus sequence of the predicted
... The intensive respiratory and metabolic activity observed during both seed development and germination requires an efficient exchange of metabolites between the mitochondrial matrix and the cytoplasm. This exchange involves transport of solutes through the mitochondrial outer and inner membranes (MO ...
... The intensive respiratory and metabolic activity observed during both seed development and germination requires an efficient exchange of metabolites between the mitochondrial matrix and the cytoplasm. This exchange involves transport of solutes through the mitochondrial outer and inner membranes (MO ...
(pdf-file 1,2 Mb)
... and the structure of the beak region of the 40S subunit are reorganized. Our data indicate that the beak RNA remains flexible while Rps3 is not tightly integrated into the 40S subunit. Hrr25-dependent phosphorylation and subsequent dephosphorylation are required for Rps3 to achieve its final associa ...
... and the structure of the beak region of the 40S subunit are reorganized. Our data indicate that the beak RNA remains flexible while Rps3 is not tightly integrated into the 40S subunit. Hrr25-dependent phosphorylation and subsequent dephosphorylation are required for Rps3 to achieve its final associa ...
Topographic Organization of Sensory Projection to the Olfactory Bulb
... information? Odorant stimuli are received from the environment by receptors on olfactory sensory neurons in the olfactory epithelium (Figure 1). Each olfactory neuron projects a single unbranched axon. As the collection of axons emerge from ihe olfactory mucosa, they fasciculate to form the olfactor ...
... information? Odorant stimuli are received from the environment by receptors on olfactory sensory neurons in the olfactory epithelium (Figure 1). Each olfactory neuron projects a single unbranched axon. As the collection of axons emerge from ihe olfactory mucosa, they fasciculate to form the olfactor ...
MAIT Cells Precursor Derivatives Activating Mouse Derived Riboflavin
... It was suggested that human MAIT cells display different patterns of reactivity toward different microbes that all harbor a functional riboflavin biosynthesis pathway (Mycobacterium smegmatis, Salmonella typhimurium, and Candida albicans) (11). TCR repertoire analysis of polyclonal human Va7.2+ (TRA ...
... It was suggested that human MAIT cells display different patterns of reactivity toward different microbes that all harbor a functional riboflavin biosynthesis pathway (Mycobacterium smegmatis, Salmonella typhimurium, and Candida albicans) (11). TCR repertoire analysis of polyclonal human Va7.2+ (TRA ...
Exine dehiscing induces rape microspore polarity
... zygotic division (Haecker et al., 2004), suggesting that the two daughter cells may possess different transcripts from the zygote. After zygote division, WOX8 is expressed in the basal cell lineage (Minako et al., 2011), and WOX8 can be used as a marker for the basal cell lineage (Haecker et al., ...
... zygotic division (Haecker et al., 2004), suggesting that the two daughter cells may possess different transcripts from the zygote. After zygote division, WOX8 is expressed in the basal cell lineage (Minako et al., 2011), and WOX8 can be used as a marker for the basal cell lineage (Haecker et al., ...
Signal transduction
Signal transduction occurs when an extracellular signaling molecule activates a specific receptor located on the cell surface or inside the cell. In turn, this receptor triggers a biochemical chain of events inside the cell, creating a response. Depending on the cell, the response alters the cell's metabolism, shape, gene expression, or ability to divide. The signal can be amplified at any step. Thus, one signaling molecule can cause many responses.