• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
DNA, RNA and Protein Synthesis 1. Define: Nucleotide
DNA, RNA and Protein Synthesis 1. Define: Nucleotide

... 29. The m-RNA base sequence = AGAUGUCAAACCCGUAUGGAAUGGUUG The amino acid sequence = arginine, cysteine, glutamine, threonine, arginine, methionine, glutamic acid, tryptophan, leucine In this case, yes, because there are no stop or terminator codons. The AUG at the middle of the sequence would encod ...
• Life`s diversity results from the variety of molecules in cells • A
• Life`s diversity results from the variety of molecules in cells • A

... 3.12 Proteins are made from just 20 types of amino acids • Proteins are the most structurally and functionally diverse of life’s molecules – Their diversity is based on different arrangements of amino acids ...
File - Thomas Tallis School
File - Thomas Tallis School

... The great number of jobs carried out by proteins means that they have to vary a lot in structure. Some proteins are insoluble strings, such as keratin and collagen. Others are soluble and round in shape such as enzymes and haemoglobin. The exact shapes of proteins can be very important in how they w ...
IOSR Journal of Applied Chemistry (IOSR-JAC)
IOSR Journal of Applied Chemistry (IOSR-JAC)

... products. Specifically, piperidine based chemical entities with aryl substituent atC-2 and C-6 of the piperidine ring has been documented as potent microbial agents [6]. The phenyl or para substituted phenyl substituent at C2 and C-6 positions have a wide range of antimicrobial activity. Further, bl ...
KFUPM
KFUPM

... Like other amino acids, it provides 4 calories per gram. Since it is about 180 times as sweet as sugar, the amount of aspartame needed to achieve a given level of sweetness is less than 1% of the amount of sugar required. Thus 99.4% of the calories can be replaced. ...
The dark side of ribosome biogenesis
The dark side of ribosome biogenesis

... course of this project, several other genetic diseases have been associated with such defects, leading to the definition of a new class of diseases (ribosomopathies) for which DBA is a central model. We are currently trying to define simple protocols to detect anomalies in ribosome production and to ...
An Organic Compound: Glucose
An Organic Compound: Glucose

... because of that patch, forming rod shaped clumps that distort normally rounded red blood cells into sickle shapes. (A sickle is a farm tool that has a crescent-shaped blade.) ...
A Convenient Synthesis of Amino Acid Methyl Esters
A Convenient Synthesis of Amino Acid Methyl Esters

... Compared with other methods, the yields obtained with the TMSCl/MeOH system were in most cases comparable to or even higher than those obtained with the thionyl chloride/MeOH and HCl(SO4H2)/MeOH systems and the method is certainly more convenient from an operational point of view. For example, for b ...
Protein synthesis - Aurora City Schools
Protein synthesis - Aurora City Schools

... 12. The second step is called _______________________________ and links _____________________________________ together to form a chain, which folds into a 3D structure to form a ______________________. Be sure to click through Transcription and Translation, too, not just the overview. What three reg ...
Mechanism of ribonuclease
Mechanism of ribonuclease

... Mechanism of ribonuclease ...
Genes
Genes

... 3. RNA leaves the nucleus & carries the message into the cytoplasm 4. RNA attaches to a ribosome 5. Code is “read” & “translated” into amino acids 6. The correct order of amino acids are brought to ribosome. 7. Amino acids join up = PROTEIN ...
Nucleic acid chemistry lecture 3
Nucleic acid chemistry lecture 3

... by a tRNA anticodon that can specifically base pair with it, then tRNA discharges it’s a.a for incorporation into growing polypeptide chain 5. There are at least 31 tRNA and 20 a.a. 6. The a.a is carried on 3' terminus ...
RNA, Protein Synthesis, Transcription, and Translation
RNA, Protein Synthesis, Transcription, and Translation

... • Amino acids join together to make polypeptides. • Each one contains part or all of the 20 amino acids. • Different proteins determined by which amino acids are joined. ...
DNA, RNA, Protein Graphic Organizer
DNA, RNA, Protein Graphic Organizer

... Sickle Cell DNA/RNA Mutation Worksheet Sickle cell anemia is a disease that is passed down through families. Normal red blood cells are shaped like a disc, while sickle blood cells are shaped in a crescent shape. Sickle cell anemia is caused by an abnormal type of hemoglobin. Hemoglobin helps carry ...
Biochemistry Test Review
Biochemistry Test Review

... 20. Explain the structure and function of an enzyme and state which biomolecule it is. 21. What are 3 factors that affect the reactivity of enzymes? 22. What does denature mean? What happens to proteins when they are denatured? 23. What three letters do most enzymes end in? If I had the sugar lactos ...
Chapter 11: DNA and Genes
Chapter 11: DNA and Genes

Protein?
Protein?

... catalyzing chemical reactions to building the structures of all living things. Despite this wide range of functions all proteins are made out of the same twenty amino acids, but combined in different ways. The way these twenty amino acids are arranged dictates the folding of the protein into its uni ...
CHEM 642-09 Powerpoint
CHEM 642-09 Powerpoint

... The anticodon is the sequence of three nucleotides that base-pairs with a codon in mRNA. The amino acid matching the codon/anticodon pair is attached at the 3' end of the tRNA. tRNAs contain some unusual bases, which are produced by chemical modification after the tRNA has been synthesized. For exam ...
Below is the structure of cortisone, part of
Below is the structure of cortisone, part of

... maturation of white blood cells; the retention of salt and water in the body; the activity of the nervous system; and the regulation of blood pressure. It acts a muscle lubricant, but when injected or applied topically, it reduces inflammation. Figure 2 represents the structure of cholesterol. Chole ...
No Slide Title
No Slide Title

IL-3 - CellGenix
IL-3 - CellGenix

... Handling Instructions Reconstitution ...
Chapter 13 RNA and Protein Synthesis
Chapter 13 RNA and Protein Synthesis

...  The role of a ribosome in the process called translation is to _________ the mRNA message into a sequence of amino acids to form a polypeptide and eventually a ____________.  The first step in translation is when the ribosome binds to the strand of ___________.  As each codon on the mRNA strand ...
Amino Acids, Peptides and Proteins
Amino Acids, Peptides and Proteins

... • To know the structure and naming of all 20 protein amino acids • To know the structure and properties of peptides and the particularly the structure of the peptide bond. • Ionization behavior of amino acids and peptides at different pH’s. • To know the general pKa’s of amino acids: their carboxyls ...
Chapter Three: The Chemistry of Organic Molecules
Chapter Three: The Chemistry of Organic Molecules

... • Phospholipids- similar to fats except one fatty acid is replaced by a phosphate group or a group with both phosphate and nitrogen. • Phosphate group= polar head. • Hydrocarbon chains = nonpolar tails. • Phospholipids can arrange themselves in a double layer, the phospholipid bilayer, which makes u ...
DNA Synthesis (Replication)
DNA Synthesis (Replication)

... to bridge the genetic code (AUCG) in mRNA with the twenty amino-acids code in proteins. Details of tRNA:  The role of tRNA is to specify which sequence from the genetic code corresponds to which amino acid  One end of the tRNA complements the genetic code in a threenucleotide sequence called the a ...
< 1 ... 120 121 122 123 124 125 126 127 128 ... 152 >

Bottromycin



Bottromycin is a macrocyclic peptide with antibiotic activity. It was first discovered in 1957 as a natural product isolated from Streptomyces bottropensis. It has been shown to inhibit methicillin-resistant Staphylococcus aureus (MRSA) and vancomycin-resistant Enterococci (VRE) among other Gram-positive bacteria and mycoplasma. Bottromycin is structurally distinct from both vancomycin, a glycopeptide antibiotic, and methicillin, a beta-lactam antibiotic.Bottromycin binds to the A site of the ribosome and blocks the binding of aminoacyl-tRNA, therefore inhibiting bacterial protein synthesis. Although bottromycin exhibits antibacterial activity in vitro, it has not yet been developed as a clinical antibiotic, potentially due to its poor stability in blood plasma. To increase its stability in vivo, some bottromycin derivatives have been explored.The structure of bottromycin contains a macrocyclic amidine as well as a thiazole ring. The absolute stereochemistry at several chiral centers has been determined as of 2009. In 2012, a three-dimensional solution structure of bottromycin was published. The solution structure revealed that several methyl groups are on the same face of the structure.Bottromycin falls within the ribosomally synthesized and post-translationally modified peptide class of natural product.
  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report