* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download DNA REVIEW SHEET
Holliday junction wikipedia , lookup
Nutriepigenomics wikipedia , lookup
DNA sequencing wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Epitranscriptome wikipedia , lookup
Genomic library wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Expanded genetic code wikipedia , lookup
DNA profiling wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
Non-coding RNA wikipedia , lookup
Microevolution wikipedia , lookup
SNP genotyping wikipedia , lookup
History of RNA biology wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Genetic code wikipedia , lookup
DNA vaccination wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
DNA replication wikipedia , lookup
Genealogical DNA test wikipedia , lookup
DNA polymerase wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Point mutation wikipedia , lookup
Molecular cloning wikipedia , lookup
Epigenomics wikipedia , lookup
History of genetic engineering wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Non-coding DNA wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
DNA supercoil wikipedia , lookup
Primary transcript wikipedia , lookup
Helitron (biology) wikipedia , lookup
DNA REVIEW SHEET 1. Who discovered the structure of DNA? 2. Who did much of the research? 3. What is the shape of DNA? 4. What does DNA stand for? 5. What does RNA stand for? 6. Name the DNA nitrogen bases. 7. Name the RNA nitrogen bases. 8. What is the name of the process where RNA is made from DNA? 9. List 6 amino acids. 10. How many nitrogen bases make up a codon? 11. What does ligase do in DNA replication? 12. How many nitrogen bases bond to make the DNA sides connect? 13. How many amino acids exist? 14. What are the three kinds of RNA? 15. Where is an anticodon located? 16. A codon that has no anticodon match would be called a ___________________. 17. What does DNA polymerase do? 18. Anything ending in –ase would be classified as an ____________________> 19. What 3 things make up DNA? 20. DNA is compared in structure to what? 21. What does DNA stand for? 22. How many codons exist? 23. How many do not code for an amino acid? 24. What does helicase do? 25. Name 2 differences between DNA & RNA. 26. Which molecule is single-stranded? 27. What is the end result in DNA replication? 28. Explain the fact that there are 3 times more codons than amino acids. 29. Name the 3 stop codons. Which RNA are they located on? Where did they get the name “stop” codon? 30. What is the name of the sugar in RNA? 31. What is the name of the sugar in DNA? 32. What is a nucleotide? 33. What is the energy source in DNA replication? 34. Since DNA keeps the original copy of DNA, it is considered to be what type of replication? 35. What is a template? What acts as the template in DNA replication? 36. What is translation? 37. What 3 things make up RNA? 38. What are 2 differences between tRNA & mRNA? 39. What thing is tRNA compared to in shape? 40. Where does translation occur? Transcription? Where is DNA located? 41. Draw & explain the steps of replication….label ALL parts. AGTCTGTACTGACTCAGTGTACAAGACGTGAGCGA 42. Replicate the above DNA strand. 43. Show the steps of transcription for the original strand. 44. Give the protein fragment for the original strand. 45. Change the 5th nucleotide to “A” and give the protein fragment. 46. Delete the 8th nucleotide & give the protein fragment. 47. Label the following:
 
									 
									 
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                            