Download DNA REVIEW SHEET

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Holliday junction wikipedia , lookup

Nutriepigenomics wikipedia , lookup

DNA sequencing wikipedia , lookup

RNA world wikipedia , lookup

RNA-Seq wikipedia , lookup

Mitochondrial DNA wikipedia , lookup

Comparative genomic hybridization wikipedia , lookup

Epitranscriptome wikipedia , lookup

DNA repair wikipedia , lookup

RNA wikipedia , lookup

Genomic library wikipedia , lookup

No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup

Mutagen wikipedia , lookup

DNA wikipedia , lookup

Expanded genetic code wikipedia , lookup

DNA profiling wikipedia , lookup

Cancer epigenetics wikipedia , lookup

Nucleic acid tertiary structure wikipedia , lookup

Non-coding RNA wikipedia , lookup

Microevolution wikipedia , lookup

Gene wikipedia , lookup

SNP genotyping wikipedia , lookup

History of RNA biology wikipedia , lookup

Genomics wikipedia , lookup

Nucleosome wikipedia , lookup

Bisulfite sequencing wikipedia , lookup

DNA damage theory of aging wikipedia , lookup

Genetic code wikipedia , lookup

DNA vaccination wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

DNA replication wikipedia , lookup

Genealogical DNA test wikipedia , lookup

DNA polymerase wikipedia , lookup

United Kingdom National DNA Database wikipedia , lookup

Gel electrophoresis of nucleic acids wikipedia , lookup

Point mutation wikipedia , lookup

Molecular cloning wikipedia , lookup

Epigenomics wikipedia , lookup

History of genetic engineering wikipedia , lookup

Cell-free fetal DNA wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Non-coding DNA wikipedia , lookup

Therapeutic gene modulation wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Extrachromosomal DNA wikipedia , lookup

Nucleic acid double helix wikipedia , lookup

DNA supercoil wikipedia , lookup

Replisome wikipedia , lookup

Primary transcript wikipedia , lookup

Helitron (biology) wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

Deoxyribozyme wikipedia , lookup

Transcript
DNA REVIEW SHEET
1. Who discovered the structure of DNA?
2. Who did much of the research?
3. What is the shape of DNA?
4. What does DNA stand for?
5. What does RNA stand for?
6. Name the DNA nitrogen bases.
7. Name the RNA nitrogen bases.
8. What is the name of the process where RNA is made from DNA?
9. List 6 amino acids.
10. How many nitrogen bases make up a codon?
11. What does ligase do in DNA replication?
12. How many nitrogen bases bond to make the DNA sides connect?
13. How many amino acids exist?
14. What are the three kinds of RNA?
15. Where is an anticodon located?
16. A codon that has no anticodon match would be called a ___________________.
17. What does DNA polymerase do?
18. Anything ending in –ase would be classified as an ____________________>
19. What 3 things make up DNA?
20. DNA is compared in structure to what?
21. What does DNA stand for?
22. How many codons exist?
23. How many do not code for an amino acid?
24. What does helicase do?
25. Name 2 differences between DNA & RNA.
26. Which molecule is single-stranded?
27. What is the end result in DNA replication?
28. Explain the fact that there are 3 times more codons than amino acids.
29. Name the 3 stop codons. Which RNA are they located on? Where did they get
the name “stop” codon?
30. What is the name of the sugar in RNA?
31. What is the name of the sugar in DNA?
32. What is a nucleotide?
33. What is the energy source in DNA replication?
34. Since DNA keeps the original copy of DNA, it is considered to be what type of
replication?
35. What is a template? What acts as the template in DNA replication?
36. What is translation?
37. What 3 things make up RNA?
38. What are 2 differences between tRNA & mRNA?
39. What thing is tRNA compared to in shape?
40. Where does translation occur? Transcription? Where is DNA located?
41. Draw & explain the steps of replication….label ALL parts.
AGTCTGTACTGACTCAGTGTACAAGACGTGAGCGA
42. Replicate the above DNA strand.
43. Show the steps of transcription for the original strand.
44. Give the protein fragment for the original strand.
45. Change the 5th nucleotide to “A” and give the protein fragment.
46. Delete the 8th nucleotide & give the protein fragment.
47. Label the following: