* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download 2421 _Ch8.ppt
Mitochondrial DNA wikipedia , lookup
Genomic library wikipedia , lookup
Human genome wikipedia , lookup
Gene expression profiling wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Genome (book) wikipedia , lookup
Messenger RNA wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Genome evolution wikipedia , lookup
History of RNA biology wikipedia , lookup
Genetic engineering wikipedia , lookup
DNA vaccination wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Epigenetics of human development wikipedia , lookup
DNA polymerase wikipedia , lookup
Epigenomics wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Molecular cloning wikipedia , lookup
Non-coding RNA wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Transfer RNA wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
DNA supercoil wikipedia , lookup
Frameshift mutation wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Non-coding DNA wikipedia , lookup
Designer baby wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Epitranscriptome wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Expanded genetic code wikipedia , lookup
Primary transcript wikipedia , lookup
History of genetic engineering wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Microevolution wikipedia , lookup
Genetic code wikipedia , lookup
Helitron (biology) wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Point mutation wikipedia , lookup
Microbiology
Chapter 8
Microbial
Genetics
1
Genetic Material
Genetics - the science of heredity, including the study of genes,
how information is carried, and how this information is replicated
and passed on to subsequent generations
Genes - segments of DNA which code for functional products
Chromosomes - the physical structures which carry the
hereditary information in the cell
2
Physical Structure of DNA
Four bases found in DNA:
Two purine bases:
Adenine (A)
Guanine (G)
Two pyrimidine bases:
Cytosine (C)
Thymine (T) [equivalent base in RNA is Uracil (U)
3
Base Pairing
Bases associate in DNA by complementary base pairing
A always base pairs with T (or U in RNA)
G always base pairs with C
4
Information Transfer
The DNA (gene) stores the hereditary information, to be used the
information must first be transcribed (transcription) into mRNA
and then the mRNA is translated into protein
5
Genetic Terminology
KEEP IT STRAIGHT – are we talking about the gene or about the protein
made from the gene? Naming conventions help…
Genotype - the genetic makeup of an organism, the genes which
encode particular characteristics of the organism (collection of
genes).
Determined by actual DNA sequence (gene) written pyrBPhenotype - the actual, expressed properties (observed) of the
gene. The result of phenotype is a protein (or collection of
proteins)
written Pyr- or PyrB- (note use of capitalization when referring to protein)
One phenotype can possibly be the result of different genotypes
6
Bacterial Chromosome
Bacteria generally have a single, circular chromosome e.g.
E. coli chromosome consists of 4 million base pairs (4 x 106 bp)
this is a medium sized bacterial chromosome
if the average gene is 1000 bp in size, then this chromosome
would contain an estimated 4,000 genes
7
DNA Replication
(2 major points on this slide)
DNA is double-stranded. Replication is the faithful copying of
each strand.
Since base pairing is specific, each strand can serve as the
template for the opposite
One parent molecule of double-stranded DNA gives two daughter
molecules
each daughter molecule contains one "original" strand and one
newly synthesized strand
9
this is called semiconservative replication
10
G C
G C
G C
T A
T A
T A
A T
A T
A T
CG
C G
C G
G C
G C
G C
T A
T A
T A
Directionality of DNA Strands
Direction is determined by the sugar/phosphate backbone
OH end is the 3’ (pronounced three-prime) end
P end is the 5’ (five-prime) end.
DNA strands are antiparallel
One occurs in the ‘opposite direction’ of the other.
11
Replication Fork
Replication occurs at a replication fork
in most bacteria, there are two forks which are moving in
opposite directions (bidirectional replication)
13
notice twin
replication forks
Activity at Replication fork
Synthesis occurs in a specific direction on the DNA.
Synthesis ALWAYS occurs 5’ 3’
One strand is the leading strand. This strand runs into the
unzipping fork in the 5’-3’ direction, so open space is always in
front of the newly forming strand.
15
DNA Polymerase
Leading strand
DNA Helicase
Lagging strand
DNA Ligase
Replication Fork continued
the other is called the lagging strand because it cannot synthesize
continuously due to direction of DNA
The short pieces on the lagging strand are called Okazaki
fragments
Lagging strand synthesis requires RNA primers to begin each
segment. DNA Polymerase requires a free end to start from. It
can’t start at an empty space.
DNA Polymerase can’t fit against ends of earlier segments so it
leaves a small gap. These gaps are closed by DNA Ligase
17
RNA
Three types of RNA are made in the cell, all are involved in
protein synthesis
Ribosomal (rRNA) is a required part of ribosomes - the
machinery of protein synthesis
Transfer (tRNA) brings the amino acids to the ribosomes in a
specific manner
Messenger (mRNA) carries the coded information for the
synthesis of specific proteins
All RNA is transcribed from DNA by RNA polymerase
20
RNA Transcription
RNA polymerase transcribes mRNA using the DNA template (the
"coding" strand of the double-stranded DNA)
the new RNA strand has ribonucleotides instead of
deoxyribonucleotides & uracil (U) is used in place of thymine
(T) to base pair with adenine (A)
RNA polymerase binds to a promoter (special start site on DNA),
then polymerizes the new chain using complementary bases
polymerization stops upon reaching a terminator (stop site) where
it releases from the DNA
21
Translation of Proteins
Series of three (triplets) bases in mRNA form codons
each condon corresponds to a specific amino acid
23
Genetic Code
61 different codons (mRNA)
code for 20 different amino acids
(obviously some repeat)
ONE codon AUG signals START and
occurs at the beginning of every mRNA
It codes for the amino acid methionine, so
every proteins starts with this amino acid
Three codons signals STOP and one of these
will be found at the end of each mRNA
UAA, UAG or UGA
Notice: where different codons code for
the same amino acid, the first two bases
are often the same and the last differs.
Because of this, the third base is often
called the ‘wobble base’. It may help to
protect against mutations in some cases
Let’s Translate A Protein
If our mRNA reads like this…
AAAAGUAUGCGUUGGUGUGGUGGCGAUGCAGUAUGUUACUCAUAACCUAA
Find the START codon (AUG) and break the sequence into codons (3 base sections) from
that point… continue until you reach a STOP codon (UAA, UAG or UGA)
Then read the codons to determine the appropriate amino acid to use next)
AAAAGU AUG CGU UGG UGU GGU GGC GAU GCA GUA UGU UAC UCA UAA CCUAA
Met- Arg- Trp- Cys- Gly- Gly- Asp- Ala- Val- Cys- Tyr- Ser- STOP
tRNA
Met
This end holds the amino acid
and is specific – it only holds ONE
PARTICULAR amino acid type
(MET in this case). When carrying
it’s amino acid a tRNA is said
to be charged
A
This end, called the anticodon, is complimentary
to the codon on the mRNA. (following base pair rules)
G
26
C
A
U
G
A
G
C
A
C
G
C
Translation begins when the two subunits of a ribosome to mRNA and find a start
codon (usually AUG, which codes methionine)
first tRNA, carrying an amino, binds in the ribosome to the mRNA by the anticodon
The next codon position if filled by the appropriate charged tRNA
The peptide bond forms between the two amino acids
After forming the peptide bond, the ribosome releases the first (now empty) tRNA
The amino acid it once carried is now attached to the amino acid on the next tRNA
PA
The ribosome moves up the mRNA so that the remaining tRNA is in the first site and
another codon is positioned in the second site
A new charged tRNA binds in the open position.
The growing polypeptide is added to the new amino acid by forming a peptide bond
The process repeats so that one amino acid is added at a time to the growing
polypeptide (which is always anchored to a tRNA bound within the ribosome)
The polypeptide continues to grow until the ribosome reaches a stop codon
At the stop codon, the polypeptide chain is released from the last tRNA and is complete
The two subunits of the ribosome detach from each other and the mRNA
Regulation of Gene Expression
A gene may be constitutive: gene which is always turned on
If NOT ALWAYS ON a gene must be regulated in some
fashion…
Promoter: region at beginning of gene which binds RNA
Polymerase (sometimes thought of as a ‘switch’ zone)
31
Regulation of Gene Expression
Repression: gene expression is lowered.
mediated by repressor proteins which block binding of RNA
polymerase at the operator site (on the DNA) near the promoter
Induction: process of turning a gene on
often an inducer molecule removes a repressor from the DNA
33
Regulating Groups of Genes
operons: a group of genes located together in the DNA and
which are regulated together.
When an operon is activated all genes in the region tend to be
made.
34
INDUCIBLE OPERON
Gene typically closed and transcribed only when inducer is present – (eg. - lactose becomes allolactose)
REPRESSIBLE OPERON
Typically open and transcribed until they are repressed (turned off) two-part ‘off switch’
Mutations
Mutation: a change in the base sequence of DNA
May be considered "silent" if it doesn’t cause a change in amino
acids (often in the third position of a codon)
37
Types of Mutations
point mutation: single base substitution
Substituting a single base pair is the most common form of
mutation.
This can result in several problems…
(see next slides)
38
Types of Mutations
if mutation changes the
amino acid as in this
example (Gly to Ser)…
Then it is a
missense mutation
Nonsense Mutation
If causes a stop codon
Frameshift mutation:
adding or deleting bases
(usually cause a string of
incorrect amino acids and/or
a premature stop codon)
Sources for Mutation
can be spontaneous (natural errors of replication)
can be induced by a mutagen (any agent that causes mutation)
chemical
radiation (UV or ionizing)
41
Identifying Mutagens
Ames Test: identifies potential human carcinogens by measuring
mutagenesis in bacteria
uses an auxotroph: a mutant strain of bacteria having a
nutritional requirement not found in the parent bacterial strain
Normal parent bacteria = prototroph, doesn’t have this nutritional
restriction
expose the auxotroph to the mutagen, if it regains prototrophy,
then it has been mutated
42
I changed the order of this slide…
It is the next slide in your notes
but seems to make more sense here
Now let’s use that mutant (auxotroph) organism
We’ll see whether we can cause it to mutate
again in what’s know as a ‘back mutation’
or ‘reversion’.
If our suspected mutagen has a mutagenic effect
we will see more than a ‘normal’
number of reversions to the prototrophic state
Gene Transfer & Recombination
Transformation: the uptake and incorporation of genes from naked DNA.
first described & demonstrated by Frederick Griffith (1928 – England)
DNA identified as ‘transforming principle’ by Avery, MacLeod,
and McCarty (1944)
Recombination: the insertion of new genes into a genome
45
Transformation: the uptake and incorporation of genes from naked DNA.
in this case “dangerous” genes from dead bacteria taken in by previously benign bacteria
Introducing DNA Into Cells
Conjugation: (fig. 8.26, p. 237) transmission of genetic material
via cell-cell contact.
requires a conjugative plasmid (small circular DNA) using a sex
pilus
48
Bacterial Conjugation as a method for inserting new DNA
F-factor = fertility factor, genes with information to make
a sex pilus
Introducing DNA Into Cells
Transduction: viral mediated transfer of DNA (fig. 8.28, p. 239).
Two kinds:
generalized (any gene)
specialized (always a specific gene)
50
Plasmids and Transposons
Plasmid: smaller, extrachromosomal, closed-circular DNA
molecules which are self-replicating.
do not contain essential genes
can carry genes which give a special advantage to the cell
examples: special catabolic pathways, antibiotic resistance
Transposons: small segments of DNA that can move from one
region of DNA to another ("jumping genes") (700 – 40,000bp)
discovered in corn by Barbara McClintock (won Nobel Prize)
simplest forms are called insertion sequences
52