* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download ppt
Molecular cloning wikipedia , lookup
X-inactivation wikipedia , lookup
Gene expression wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Non-coding DNA wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Silencer (genetics) wikipedia , lookup
List of types of proteins wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Molecular evolution wikipedia , lookup
Cryobiology wikipedia , lookup
Lipid Bilayer Phospholipids make up the outer layer of all cells Fluid Mosaic Model Fluid: all components move around freely Mosaic: many different types of proteins on the surface make a mosaic pattern Membrane Proteins Cell Proteins serve many different purposes Diffusion Diffusion Facilitative Diffusion Active Transport Osmosis Osmosis Endocytosis Exocytosis Pinocytosis Animal Cell DNA (deoxyribonucleic acid) Bases/Base Pairs Nucleotides 1. 2. 3. Nitrogenous Base Base Pairs: A–T C–G DNA Organization •Chromatin organized: •DNA •Histones One Duplicated Chromosome Human Chromosomes A Pair of Duplicated Chromosomes Autosomes Sex Chromosomes 46 individual chromosomes / 23 pairs of chromosomes •they are the same - code for same type of trait •they are different - code for different version of trait Understanding the Numbers •1 chromosome is 1 large DNA molecule •a gene is a specific sequence of nucleotides ATTCCGTAGCTGATCGTAAAGGG •1000-5000 genes per chromosome •30,000-100,000 genes per human genome DNA Functions •Pass on Genetic Material •Replication •Mitosis •Meiosis •Protein Synthesis •Transcription •Translation Replication •Making an exact copy of DNA •Occurs just prior to cell division •Double helix unwinds •DNA polymerase adds bases •Two exact copies are made Protein Synthesis •Transcription •DNA to mRNA •Translation •mRNA to Protein From Gene to Protein DNA RNA Protein Genetic Code Codons three base code Code for specific amino acids Point Mutation Spontaneous Mutation Environmental Insult •Mutagenesis •Carcinogenesis Mutation is corrected Point Mutation Mutation is not corrected Mutation is corrected Two-Hit Hypothesis Born with 2 genes or alleles for any given disease: •one from mom •one from dad If one is bad, this increases your chance of getting the disease Animal Tissues •Epithelial Tissue •Connective Tissue •Muscular Tissue •Nervous Tissue Epithelial Tissue •Function •filtration •lubrication •secretion •Classification •simple •stratified •squamous •cuboidal •columnar Simple Epithelial Tissue •Squamous •Cuboidal •Columnar Stratified Squamous Epithelium Connective Tissue •Function •binds together tissues and organs •supports tissues and organs •strengthens other tissues and organs •protects other tissues and organs •insulates other tissues and organs •Composed of •cells •matrix •ground substance •fibers (collagen, elastic, reticular) Connective Tissue •Loose Connective Tissue •Dense, Irregular Connective Tissue •Dense, Regular Connective Tissue Connective Tissue •Cartilage •Bone •Adipose Tissue Muscle Tissue •Function •provides organismic or organ movement •organismic posture •thermogenic •Classification •skeletal •smooth •cardiac Muscle Tissue •Skeletal Muscle Tissue •Smooth Muscle Tissue •Cardiac Muscle Tissue Nervous Tissue •Function •converts environmental and internal stimuli into nerve impulses •stimulates or inhibits cells or glands •Classification •neurons •neuroglia (glia) Neuron Organ Systems