Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Human Body Organization Levels 1. Chemical 2. Cellular 3. Tissue 4. Organ 5. Organ System 6. Organismic Chemical Level •Elements •H •C •O •Compounds •NaCl •KCl •Ions •Na+ •K+ •Cl•Ca++ •Mg++ •Molecules •O2 •CO2 •C6H12O6 •Macromolecules •Proteins •amino acids •Lipids •fatty Acids •Carbohydrates •monosaccharides •Nucleic Acids •nucleotides Cellular Level Chromatin Tissue Level •Epithelial Tissue •Connective Tissue •Muscular Tissue •Nervous Tissue Organ Level Gastrointestinal Tract 1. Mouth 2. Pharynx 3. Esophagus 4. Stomach 5. Small Intestine 6. Large Intestine Accessory Structures 1. Teeth 2. Tongue 3. Salivary Glands 4. Liver 5. Gallbladder 6. Pancreas Organ System Level Organismic Level Darwin sails around the world and in South America is puzzled by the absence of rabbits. Instead he finds these rabbit-like Patagonian Hares or Mara (Dolichotis patagonum) that are not rabbits but have similar characteristics as rabbits. He postulates that they must have evolved just like rabbits because of their similar environments Animal Cell Chromatin DNA (deoxyribonucleic acid) Bases/Base Pairs Nucleotides 1. 2. 3. Nitrogenous Base Base Pairs: A–T C–G DNA Organization •Chromatin organized: •DNA •Histones One Duplicated Chromosome Human Chromosomes A Pair of Duplicated Chromosomes Autosomes Sex Chromosomes 46 individual chromosomes / 23 pairs of chromosomes •they are the same - code for same type of trait •they are different - code for different version of trait Understanding the Numbers •1 chromosome is 1 large DNA molecule •a gene is a specific sequence of nucleotides ATTCCGTAGCTGATCGTAAAGGG •1000-2000 genes per chromosome •~25,000 - 30,000 genes per human genome DNA Functions •Pass on Genetic Material •Replication •Mitosis •Meiosis •Protein Synthesis •Transcription •Translation Mitosis Replication •Making an exact copy of DNA •Occurs just prior to cell division •Double helix unwinds •DNA polymerase adds bases •Two exact copies are made Embryongenesis - Week 1 Blastocyst Inner Cell Mass (Embryonic Stem Cells) Pluripotent Stem Cells Embryogenesis Week 2 Embryonic Germ Cell Layers: •Endoderm •Mesoderm •Ectoderm Multipotent Stem Cells Cell Migration Growth Cone Radial Glia •Act like scaffolding to assist movement of neurons during development Differentiation Schizophrenia Abnormality Hippocampal Pyramidal Cell Disorganization Neurobehavioral Hypothesis •Maternal/Fetal Evidence: •extensive maternal bleeding •prolonged labor •delivery complications •low birth weight •low head circumference •body length:body weight •multiparity •Anectodal Evidence •Dutch births during WWII •Season of birth effect •higher for winter pregnancies •parallel with virus exposure Protein Synthesis •Transcription •DNA to mRNA •Translation •mRNA to Protein From Gene to Protein DNA RNA Protein Genetic Code Codons three base code Code for specific amino acids Point Mutation Spontaneous Mutation Environmental Insult •Mutagenesis •Carcinogenesis Mutation is corrected Point Mutation Mutation is not corrected Mutation is corrected Sickle-Cell Anemia Mutation Sickle-Cell Anemia Mutation Two-Hit Hypothesis Born with 2 genes or alleles for any given disease: •one from mom •one from dad If one is bad, this increases your chance of getting the disease Cancer in Women Lung Cancer