Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
pCOLD Vectors and Other Alternative Expression Systems for Structural Genomics Cold- shock adaptation of E. coli 37ºC < 20 °C Optimal Growth Acclimation Phase Steady Low Temp Growth Adapted Cells CSPs Non-CSPs Non-CSPs CSPs Stationary Phase Maps of pCold vectors cspA 3’UTR multiple cloning site factor Xa site His TEE 6 cspA 5’UTR lac operator cspA 3’UTR multiple cloning site His 6 TEE cspA 5’UTR lac operator cspA promoter cspA promoter pCold I pCold II (4.4 kb) (4.4 kb) cspA 3’UTR multiple cloning site cspA 3’UTR multiple cloning site cspA 5’UTR TEE cspA 5’UTR lac operator lac operator cspA promoter cspA promoter pCold III pCold IV (4.4 kb) (4.4 kb) TEE (translation enhancing element): ATGAATCACAAAGTG (MNHKV) His6: CATCATCATCATCATCAT Factor Xa site: ATCGAAGGTAGG (IEGR) Multiple cloning site: NdeI SacI KpnI XhoI BamHI EcoRI HindIII SalI PstI XbaI CATATGGAGCTCGGTACCCTCGAGGGATCCGAATTCAAGCTTGTCGACCTGCAGTCTAGA SDS-PAGE of whole cell lysates - E.coli EnvZ ATP-binding domain (EnvZ-B), Xenopus calmodulin (CaM) and E.coli trigger factor expressed using pCold vectors 1 2 3 4 5 0 12 24 36 48 hr 1 T 2 S EnvZ-B 1 2 3 4 EnvZ-B 5 6 7 EnvZ-B 1 T 2 S 1 T 2 S trigger factor calmodulin Expression level and solubility of different proteins - pColdI and pET14 systems E.coli genes gene Human genes pET14 pColdI gene expression solubility expression solubility ER6 ER7 ER15 ER19 ER64 ER85 ER115 ER130 ER135 + +++ + +++ NE + ++ +++ ++ NS NS NS +++ NA NS +++ + + +++ ++ +++ +++ NE + ++ ++ ++ NS + NS +++ NA NS ++ NS +++ Drosophila genes gene HR8 HR31 HR520 HR521 HR522 HR524 HR529 HR535 HR540 pColdI gene ++ + NE ++ +++ +++ ++ + NE ++ ++ NE NE +++ NE +++ NS NA NS NS NA NA NS NA ++ ++ NE +++ NE NE ++ +++ NE +++ +++ NA NS NA NA NS NS NA C.elegans genes pET14 ++ NE ++ NE pColdI expression solubility expression solubility expression solubility expression solubility FR2 FR4 FR5 FR6 FR14 FR37 FR48 FR59 FR70 FR78 pET14 + NA + NA NS ++ NA ++ ++ ++ ++ NE +++ NE ++ +++ ++ +++ +++ +++ ++ NA ++ NA NS ++ +++ ++ ++ ++ pET14 pColdI expression solubility expression solubility WR13 WR24 WR26 WR27 WR33 WR35 WR41 WR44 WR49 WR53 +++ NE +++ +++ +++ +++ +++ NE +++ +++ NS NA NS NS +++ NS ++ NA NS +++ +++ NE ++ +++ +++ +++ ++ + +++ +++ NS NA NS NS +++ NS +++ NS NS +++ In total, 38 genes as shown above were chosen and cloned in pColdI and pET14 vectors, respectively. Samples with better expression level and/or solubility in pET14 were labeled with blue color, and red color for those with better expression and/or solubility in pColdI. NS: not soluble; NE: no expression; NA: not available. [1H-15N]-HSQC spectra of 15N-enriched Xenopus calmodulin produced with pCold vector Cell lysate NMR Purified protein NMR Sequential connectivity map summarizing the results of tripleresonance NMR experiments with calmodulin in whole cell lysates ~ 80% of the peaks are assigned Target Selection, Cloning and Protein Production Identify Target ORF Human, C. elegans, Drosophila, Arabidopsis, yeast and others Validate/ cDNA Clone into Expression Vectors N/C-Terminal His-Tags, pCold, No tag, MBP, SUMO, Pichia, cell-free Insoluble or not expressed Small Scale Expression Soluble Large Scale Fermentation/Protein Purification Multiplex Expression System Classical Restriction Endonuclease/Ligasedependent cloning E. coli Expression Vectors Eukaryotic Expression systems Expanded multiplex system Attempt to use fusion protein expression systems in place of our standard T7 Multiplex Expression System (Acton et al, submitted) for a set of 50 eukaryotic target proteins 1) Gateway MBP-fusion expression system (Kapust & Waugh 1999) (collaboration with D. Waugh, NCI) 2) SUMO system (Lifesensors, Inc. Malvern, PA) (collaboration with T. Butt, Lifesensors, Inc.) MBP fusion coupled with cleavage by TEV MBP is cleaved from its fusion partner by Tobacco Etch Virus (TEV) Proteinase TEV recognizes the consensus sequence: Glu-X-X-Tyr-X-Gln-Ser (Dougherty et al., 1989) (Routzahn & Waugh 2002) Both in vivo and in vitro cleavage conditions are being investigated Interesting note: Recombinant TEV does not fold properly in vivo and it must be generated as an MBP fusion as well Summary of MBP screening Target pET MBPfusion MBPfusion in vivo cleavage uncleaved MBP-fusion in vitro cleavage Target pET MBPfusion in vivo cleavage MBPfusion uncleaved MBP-fusion in vitro cleavage WR2 E/NS NE E/S low WR16 NE NE NE N/A WR3 E/NS E/S E/S Y WR18 PE PE E/S low WR4 E/S E/S E/S Y WR26 E/NS NE E/S N/A WR5 NE NE NE N/A WR27 E/NS E/NS E/S low WR6 NE NE E/S Y WR28 NE NE NE N/A WR8 E/S NE E/S Y WR39 E/S E/S E/S low WR9 NE NE NE N/A WR41 E/S E/S E/S Y WR10 NE NE E/S low WR43 E/S E/S E/S N/A WR11 E/S E/S E/S Y WR44 NE NE NE N/A WR13 E/NS E/NS E/S N/A WR49 E/NS E/S E/S low WR14 E/S E/S E/S Y WR53 E/S E/S E/S Y WR15 NE NE NE N/A WR54 E/NS NE NE N/A Not expressed Expressed/soluble Expressed/insoluble SUMO system 6хHis SUMO Protein of interest SUMP protease (Ulp1) • SUMO is a Ubiquitin-like (UBL) protein • UBLs are small, highly soluble, globular proteins • SUMO has been reported to exhibit chaperone-like activity • Ulp1 is used to cleave the protein target from the fusion by recognizing the entire SUMO protein • SUMO system utilizes Ni-affinity chromatography • Cleavage must occur in vitro (Figure courtesy of www.lifesensors.com) Summary of SUMO fusion screening pET (N-terminal His-tag) SUMO fusion AR5 NE NE AR22 E/S E/S FR10 E/NS E/S HR894 E/NS E/NS HR1553 E/NS E/S HR1686 E/NS E/NS HR1697 NE E/S E/NS E/NS Target ID WR26 Not expressed Expressed/soluble Expressed/insoluble A stable cell-free protein synthesis system prepared from wheat germ CK DHFR Improvement in preparing cell extracts: removing endosperm contaminants, including tritin, thionin, ribonucleases, deoxy ribonucleases, and proteases, by thorough washing and sonication. (Proc. Natl. Acad. Sci. USA 99, 14652-57) (collaboration with Y. Endo, Ehime University) Protein synthesis in the dialysis system. (A and B) Coomassie blue-stained SDS polyacrylamide gels showing DHFR synthesis with (A) or without (B) addition of new mRNA. Arrows and asterisks mark DHFR and creatine kinase, respectively. (C) Amounts of DHFR synthesized as determined from densitometric scans of the gels in A (closed circles) and B (open circles). A cell-free expression vector and its performance GFP mRNA supplement (92 mg in 500 ml reaction each time) (a) Schematic illustration of pEU. (b) SDS/PAGE analysis of GFP produced during 14 days of reaction. mRNA produced by transcription of circular pEU was used for the translation reaction in the dialysis membrane system and was added every 48 h. A 0.1-µl aliquot of the mixture was run on the gel, and protein bands were stained with CBB. The arrow shows GFP; "st" designates an authentic GFP band (0.5 µg). Protein synthesis of human targets by wheat-germ system * * * * * * * * * Summary of screening by cell-free system from wheat germ pET(N-terminal tag) Target ID Not expressed Expressed/soluble Expressed/insoluble AR15 AR16 AR21 AR22 FR10 HR812 HR894 HR919 HR945 HR969 HR1553 HR1576 HR1686 HR1697 HR1719 HR1722 HR1738 WR13 WR19 WR20 WR21 WR23 WR24 WR26 WR27 WR35 WR38 WR41 WR43 WR44 WR50 WR53 WR54 Protein synthesis by wheatgerm system Expression Solubility Expression Solubility +++ NE NE + +++ NE +++ +++ +++ +++ +++ 0.5 +++ NE +++ +++ +++ +++ +++ NE +++ +++ NE +++ +++ +++ ++ +++ + NE + +++ +++ + NA NA +++ NS NA NS NS NS ++ NS NS NS NA NS NS NS NS NS NA + NS NA NS NS NS NS +++ ++ NA NS +++ NS ++ ++ + +++ + +++ NE ++ NE ++ NE NE ++ NE + + NE +++ +++ +++ 0.5 +++ NE +++ +++ +++ +++ +++ + +++ ++ ++ ++ ++ ++ +++ 0.5 +++ ++ NA +++ NA +++ NA NA ++ NA +++ + NA 0.5 0.5 NS NS NS NA NS 0.5 +++ 0.5 +++ + NS ++ +++ +++ Panel of 50 eukaryotic targets in eight expression systems Eukaryotic Core 50E. coli pET (Nter-H6) Number Target ID 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 AR5 AR15 AR16 AR21 AR22 FR4 FR10 FR59 HR79 HR91 HR547 HR812 HR894 HR919 HR945 HR969 HR1553 HR1576 HR1686 HR1697 HR1719 HR1722 HR1738 HR1854 HR1869 HR1889 HR1913 HR1953 WR12 WR13 WR19 WR20 WR21 WR23 WR24 WR26 WR27 WR28 WR35 WR38 WR40 WR41 WR42 WR43 WR44 WR49 WR50 WR51 WR53 WR54 H E S E. coli pET (Cter-H6) H E NA H E S NA NA NA NA NA NA NA E. coli MBP + TEV H E S E. coli MBP (uncut) H E S E. coli SUMO fusions H E S Wheat germ extract H E S NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA LEGEND: = = = = = = = = = S E. coli pCOLD vector not attempted yet hook up complete H = hooked up expressed E = expression tested not expressed S = solubility insoluble soluble not applicable in progress expressed & soluble in at least one system P. pastoris pPIC3.5 H E S Acknowledgements Guoliang Qing Li-Chung Ma Ahmad Khorchid G. V. T. Swapna Tapas K. Mal Masanori Mitta Takayama Bing Xia Sangita Phadtare Haiping Ke Gaetano T. Montelione Mitsuhiko Ikura Masayori Inouye Thomas Acton Rong Xiao Ritu Shastry Chi Kent Ho Natalia Denissova Bonnie Cooper Kellie Cunningham Liang-yu (Lydia) Shih Yi-Wen Chiang Shin-Geon Choi Tatsuya Sawasaki Yaeta Endo Kate Drahos Tauseef R. Butt David S. Waugh What if…? PCR & cloning of ORFs Unexpressed or Insoluble Proteins Construct validation Small-scale expression & solubility screens Protein Production Pipeline PCR & cloning of ORFs Analysis & passing of targets to fermentation Large-scale production & purification of 15N/13C, or selenomethionine-labeled proteins Structure determination by X-ray crystallography Construct validation Small-scale expression & solubility screens using T7 system Structure determination by NMR