* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download No Slide Title
Cell-free fetal DNA wikipedia , lookup
Epigenomics wikipedia , lookup
DNA supercoil wikipedia , lookup
Biology and consumer behaviour wikipedia , lookup
Molecular cloning wikipedia , lookup
Public health genomics wikipedia , lookup
Whole genome sequencing wikipedia , lookup
Ridge (biology) wikipedia , lookup
Metagenomics wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Cancer epigenetics wikipedia , lookup
DNA vaccination wikipedia , lookup
X-inactivation wikipedia , lookup
Oncogenomics wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Primary transcript wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Transposable element wikipedia , lookup
Genomic imprinting wikipedia , lookup
Pathogenomics wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Gene expression profiling wikipedia , lookup
Point mutation wikipedia , lookup
Human Genome Project wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Genetic engineering wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Human genome wikipedia , lookup
Genome (book) wikipedia , lookup
Designer baby wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Non-coding DNA wikipedia , lookup
Microevolution wikipedia , lookup
Genomic library wikipedia , lookup
Minimal genome wikipedia , lookup
Genome editing wikipedia , lookup
Helitron (biology) wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Genomes Definition Complete set of instructions for making an organism • master blueprints for all enzymes, cellular structures & activities An organism‘s complete set of DNA All the DNA contained in the cell of an organism The collection of DNA that comprises an organism. Total genetic information carried by a single set of chromosomes in a haploid nucleus Genome sequencing chronology Genome size (bp) Number of genes Year Organism Significance Bacteriophage 1977 fX174 First genome 5,386 11 Human mitochondria First organelle 16,500 37 Haemophilus influenzae Rd First freeliving organism 1,830,137 ~3,500 Saccharomyces 1996 cerevisiae First eukaryote 12,086,000 ~6,000 1981 1995 Genome sequencing chronology Significance Genome size (bp) Number of genes First multiCaenorhab-ditis 1998 cellular elegans organism 97,000,000 ~19,000 Human 1999 chromosome 22 49,000,000 673 Year Organism First human chromosome Drosophila melanogaster First insect 150,000,000 ~14,000 Arabidopsis 2000 thaliana First plant genome 150,000,000 ~25,000 2000 Genome size Virus A subcellular parasite with genes of DNA or RNA and which replicates inside the host cell upon which it relies for energy and protein synthesis. In addition, it has an extracellular form in which the virus genes are contained inside a protective coat The Baltimore classification system Based on genetic contents and replication strategies of viruses. According to the Baltimore classification, viruses are divided into the following seven classes: 1. dsDNA viruses 2. ssDNA viruses 3. dsRNA viruses 4. (+) sense ssRNA viruses (codes directly for protein) 5. (-) sense ssRNA viruses 6. RNA reverse transcribing viruses 7. DNA reverse transcribing viruses "ds" represents "double strand" and "ss" denotes "single strand". Plant Viruses Plant DNA viruses are rare Cauliflower mosaic virus Spherical, kills Cauliflower and Brussel Sprouts  Most plant viruses are small and comprised of ssRNA Rod shaped, attacks tomato, pepper, beets, turnips, tobacco 2,130 identical proteins surround the ssRNA ~10,000bp, ~10 genes  Plant Viroids Plant Viroids Highly complementary circular ssRNA No protein coat Smaller than viruses (few hundreds of bases) Smallest known virus is 3.2 kbp in size RNA does not code for any known protein Some even lack the AUG initiation codon  Replication mechanism is unknown  Viroids cannot recognize and infect host cell Relies on cells being weak or injured  Proposed that viroids are "escaped introns"  Viroids are usually transmitted by seed or pollen  Infected plants can show distorted growth  The first viroid to be identified was the Potato spindle tuber viroid (PSTVd)  Some 33 species have been identified Procaryotic genomes Generally 1 circular chromosome (dsDNA) Usually without introns Relatively high gene density (~2500 genes per mm of E. coli DNA) Often indigenous plasmids are present 1. Eschericia coli 2. Agrobacterium tumefaciens Eschericia coli       It is a free living, gram negative bacterium It is a normal resident of the large intestine in healthy people It grows best with incubation at 37°C in a culture medium that approximates the nutrient available in the human digestive tract It is a type of probiotic organism because it crowds out disease causing bacteria. It also makes vitamin K which humans require to be healthy. Some strains make people sick. The toxic strains are responsible for about half of all cases of traveler's diarrhea. Eschericia coli    It replicates once every 22 minutes, giving rise to 30 generations and more than 1 billion cells in 11 hours Its growth falls into several distinct phases (lag, logaritmic, stationary and death) The individual cells are invisible to the naked eye, after plating onto solid medium, each cell divides to form a visible colony of identical daughter cells in 12-24 hours Eschericia coli     It provides a relatively simple and well understood genetic improvement in which to isolate foreign DNA Its primary genetic complement is contained on a single chromosome which locations and sequences of a large number of its genes are known The genetic code is nearly universal Under the best circumstances, the uptake of a specific foreign gene is a relatively rare occurrence and is thus most easily accomplished in a large populations that are reproducing rapidly Eschericia Coli genome      Single chromosome of approximately 5 million base pairs (5 Mbp) 4288 protein coding genes: • Average ORF 317 amino acids • Average gene size 1000 bp • Very compact: average distance between genes 118bp Contour length of genome: 1.7 mm It can accept foreign DNA derived from any organism Some genes are arranged in the plasmid Agrobacterium tumefaciens Agrobacterium tumefaciens    Agrobacterium tumefaciens is a gramnegative soil phytopathogennonsporing, motile, rod-shaped bacterium, closely related to Rhizobium which forms nitrogen-fixing nodules on clover and other leguminous plants. Agrobacterium affect most dicotyledonous plants in nature, resulting in crown gall tumors at the soil-air junction upon tissue wounding Agrobacterium has the broadest host range of any plant pathogenic bacterium Agrobacterium tumefaciens   Most of the genes involved in crown gall disease are not borne on the chromosome of A. tumefaciens but on a large plasmid, termed the Ti (tumourinducing) plasmid. It is important to note that only a small part of the plasmid (the T-DNA) enters the plant; the rest of the plasmid remains in the bacterium to serve further roles. When integrated into the plant genome, the genes on the T-DNA code for: production of cytokinins production of indoleacetic acid synthesis and release of novel plant metabolites - the opines and agrocinopines. Agrobacteria that causes neoplastic diseases in plants     Agrobacterium rhizogenes (hairy root disease). Agrobacterium rubi (cane gall disease) Agrobacterium tumefaciens (crown gall disease) Agrobacterium vitis (crown gall of grape) What will Agrobacterium tumefaciens affect in plants?   Crown gall disease is not generally fatal, but it will reduce plant vigor and crop yield, and crown galls will attract other phytopathogens or pests. In some cases, necrosis or apoptosis is observed after Agrobacterium infection. The discovery of Agrobacterium   In 1897, Fridiano Cavara identified a flagellate, bacilloid bacterium as a casual agent of crown gall of grape. This organism is Agrobacterium vitis, causing the growth of neoplastic tumors on the stem and crown of grapevines and inducing necrotic lesions on grape roots. Historical discoveries about agrobacterium     Turn of 20th century – found causes crown gall disease 1940’s – crown gall tissue cultured due to hormone autotrophy 1970’s – pathogenicity transferred between bacteria via conjugation – evidence of plasmid involvement 1980’s T-DNA was first engineered to carry useful genes into plants using methods that ‘hijacked’ the natural process Evidence for plasmid involvement in the virulence of agrobacterium 1. 2. 3. 4. 5. 6. 7. Relationship between virulence and specific plasmids in different agrobacterium strains Loss of virulence with loss of plasmids when grown at high temp (plus restoration of virulence when same plasmids replaced) Virulence transferred when plasmids transferred between virulent and non-virulent strains Stable nature of hormone autotrophy in infected host plant tissues indicated that this was genetically determined and could result from genetic transfers between agrobacterium and its host Fragments of agrobacterium plasmids (T-DNA) were found in the DNA of diseased tissues Plants regenerated from diseased tissues were bred to produce offspring which inherited the T-DNA in a Mendelian manner. This indicated that the T-DNA was integrated into nuclear DNA Autoradiogram of a Southern blot of DNA extracted from cured crown gall cells probed with T-DNA showing the presence of T-DNA within the plant genome. Lanes 1 & 2: T-DNA extracted from agrobacterium Ti plasmid Lanes 3, 5 & 6: DNA extracted from gall cells Lane 4: DNA from non-infected plant tissue Agrobacterium lives in intercellular spaces of the plant Steps of Agrobacterium-plant cell interaction 1. Cell-cell recognition 2. Signal transduction and transcriptional activation of vir genes 3. Conjugal DNA metabolism 4. Intercellular transport 5. Nuclear import 6. T-DNA integration Agrobacterium tumefaciens genome • • • • Genome size (chromosome) is about 6 Mb A large (~250kbp) plasmid called Tumor-inducing (Ti) plasmid) Plasmid contains genes responsible for the disease Portion of the Ti plasmid is transferred between bacterial cells and plant cells  T-DNA (Transfer DNA) • T-DNA integrates stably into plant genome • Single stranded T-DNA fragment is converted to dsDNA fragment by plant cell   Then integrated into plant genome 2 x 23bp direct repeats play an important role in the excision and integration process Agrobacterium tumefaciens  What is naturally encoded in T-DNA? • Enzymes for auxin and cytokinin synthesis   Causing hormone imbalance  tumor formation/undifferentiated callus Mutants in enzymes have been characterized • Opine synthesis genes (e.g. octopine or nopaline)   Carbon and nitrogen source for A. tumefaciens growth Insertion genes • Virulence (vir) genes • Allow excision and integration into plant genome Plasmids Naturally Extra chromosomal circular DNAs     They exist separate from the main chromosome They replicate within the host cells Their size vary form ~ 1,000 to 250,000 base pairs They can be divided into two broad groups according to how tightly their replication in regulated: 1. stringent plasmids (low copy number plasmids: 1-2 plasmids/cell) only replicate along with the main bacterial chromosome and so exist as single copy, or at most several copies within the cell 2. Relaxed plasmid (multi copy number plasmids) replicate autonomously of the main chromosome and have copy numbers of 10 - 500 per cells pBR322 The plasmid pBR322 is one of the most commonly used E.coli cloning vectors. pBR322 is 4361 bp in length and contains: (1) the replicon rep responsible for the replication of plasmid (source – plasmid pMB1); (2) rop gene coding for the Rop protein, which promotes conversion of the unstable RNA I – RNA II complex to a stable complex and serves to decrease copy number (source – plasmid pMB1); (3) bla gene, coding for beta-lactamase that confers resistance to ampicillin (source – transposon Tn3); (4) tet gene, encoding tetracycline resistance protein (source – plasmid pSC101). Genetic structure of the Ti plasmid Oncogenes TL Aux Cyt Opines TR Left Border and Right Border transfer (Tumor-inducing) Ti plasmid of A. tumefaciens 1. Auxin, cytokinin, opine synthetic genes transferred to plant 2. Plant makes all 3 compounds 3. Auxins and cytokines cause gall formation 4. Opines provide unique carbon/nitrogen source only A. tumefaciens can use! Saccharomyces cerevisiae        Nonpathogenic Rapid growth (generation time ca. 80 min) Dispersed cells Ease of replica plating and mutant isolation Can be grown on defined media giving the investigator complete control over environmental parameters Well-defined genetic system Highly versatile DNA transformation system Saccharomyces cerevisiae     Strains have both a stable haploid and diploid state Viable with a large number of markers Recessive mutations are conveniently manifested in haploid strains and complementation tests can be carried out with diploid strains The ease of gene disruptions and single step gene replacements offers an outstanding advantage for experimentation Saccharomyces cerevisiae    Yeast genes can functionally be expressed when fused to the green fluorescent protein (GFP) thus allowing to localize gene products in the living cell by fluorescence microscopy The yeast system has also proven an invaluable tool to clone and to maintain large segments of foreign DNA in yeast artificial chromosomes (YACs) being extremely useful for other genome projects and to search for protein-protein interactions using the twohybrid approach Transformation can be carried out directly with short single-stranded synthetic oligonucleotides, permitting the convenient productions of numerous altered forms of proteins Yeast genome Genome of diploid Saccharomyce cerevisiae cell Characteristic Relative amount (%) Number of copies Size (kbp) Chromosomes 85 2 x 16 14.000 Plasmid 5 60-100 6,318 Mitochondiral 10 ~50 (8-130) 70-76 Yeast plasmid The yeast genome  S. cerevisiae contains a haploid set of 16 well-characterized chromosomes, ranging in size from 200 to 2,200 kb  Total sequence of chromosomal DNA is 12,8 Mb  6,183 ORFs over 100 amino acids long  First completely sequenced eukaryote genome  Very compact genome: • Short intergenic regions • Scarcity of introns • Lack of repetitive sequences  Strong evidence of duplication: • Chromosome segments • Single genes  Redundancy: non-essential genes provide selective advantage Eucaryotic genomes Located on several chromosomes Relatively low gene density (50 genes per mm of DNA in humans) Carry organellar genome Plant genomes  Plant contains three genomes  Genetic information is divided in the chromosome.  The size of genomes is species dependent  The difference in the size of genome is mainly due to a different number of identical sequence of various size arranged in sequence  The gene for ribosomal RNAs occur as repetitive sequence and together with the genes for some transfer RNAs in several thousand of copies  Structural genes are present in only a few copies, sometimes just single copy. Structural genes encoding for structurally and functionally related proteins often form a gene family  The DNA in the genome is replicated during the interphase of mitosis Arabidopsis thaliana  A weed growing at the roadside of central Europe  It has only 2 x 5 chromosomes  It is just 70 Mbp  It has a life cycle of only 6 weeks  It contains 25,498 structural genes from 11,000 families  The structural genes are present in only few copies sometimes just one protein  Structural genes encoding for structurally and functionally related proteins often form a gene family Peculiarities of plant genomes  Huge genomes reaching tens of billions of base pairs  Numerous polyploid forms  Abundant (up to 99%) non coding DNA which seriously hinders sequencing, gene mapping and design of gene  Poor morphological, genetics, and physical mapping of chromosomes  A large number of “small-chromosome” in which the chromosome length does not exceed 3 μm  The number of chromosomes and DNA content in many species is still unknown Size of the genome in plants and human Genome Zea mays Vicia faba Human Nucleus Arabidopsis thaliana 70 Millions 3900 Millions 14500 Millions 2800 Millions Plastid 0.156 Millions 0.136 Millions 0.120 Millions Mitochondrion 0.370 Millions .570 Millions .290 Millions .017 Millions Organisation of the genome into chromosome  The nuclear genome is organized into chromosome  Chromosomes consist of essentially one long DNA helix wound around nucleosome  At metaphase, when the genome is relatively inactive, the chromosome are most condensed and therefore most easily observed cytologically, counted or separated  Chromosomes provide the means by which the plant genome constituents are replicated and segregated regularly in mitosis and meiosis  Large genome segments are defined by their conserved order of constituent genes Genome composition 1. Heterochromatin   Darkly staining portions of chromosomes, believed due to high degree of coiling Non-genic DNA a. Centromere  ~ “middle” of Chromosomes  spindle attachment sites b. Telomeres 1. ends of chromosome 2. important for the stability of chromosomes tips. 2. Euchromatin    Lightly staining portion of chromosomes It represents most of the genomes It contains most of genes. Ploidy and chromosome number Organism Ploidy Chromosome number Corn Diploid (2X) 20 Tomato Diploid (2X) 24 Arabidopsis Diploid (2X) 10 Potato Tetraploid (4X) 48 Wheat Hexaploid (6X) 42 Organization of Plant Genome Protein coding gene Portion of genome which encodes for most of the transcribed genes (Protein coding genes) Non coding gene 1. Intron 2. Regulatory elements of genes 3. Multiple copies of genes, including pseudogenes 4. Intergenic sequences 5. Interspersed repeats Organization of Plant Genome Most plants contain quantities of DNA that greatly exceed their needs for coding and regulatory functions Very small percentage of the genome may encode for genes involved in protein production Based on kinetics:  Low-copy-number DNA DNA sequences encodes for most of the transcribed genes (Protein coding genes)  Medium-copy-number DNA DNA sequences that encode ribosomal RNA (Tandemly repeated expressed DNA)  High-copy-number DNA It is composed of highly repetitive sequences (Repetitious DNA) Gene classification Chromosome (simplified) coding genes Messenger RNA intergenic region non-coding genes Structural RNA Proteins transfer RNA Structural proteins Enzymes ribosomal RNA other RNA Protein Coding Genes Segment of DNA which can be transcribed and translated to amino acid Protein Coding Genes  Transcribed region ≈ Open Reading Frame (ORF) • long (usually >100 aa) • “known” proteins  likely  Basal signals • Transcription, translation  Regulatory signals Protein Coding Genes  Plant contains about 10 000 – 30 000 structural genes  They are present in only a few copies, sometimes just one (single copy gene)  They often form a gene family  The transcription of most structural genes is subject to very complex and specific regulation  The gene for enzymes of metabolism or protein biosynthesis which proceed in all cells are transcribed more often  Most of the genes are switched off and are activated only in certain organ and then often only in certain cells  Many genes are only switched on at specific times House keeping gene: The genes which every cell needs for such basic functions independent of its specialization What do the genes encode? Microbes highly specialized Basic functions + Yeast – simplest eukaryote Fly – complex development Genes for basic cellular functions such as translation, transcription, replication and repair share similarity among all organisms Worm – programmed development Arabidopsis – plant life cycle Gene families expand to meet biological needs. Pseudogenes  Nonfunctional copies of genes  Formed by duplication of ancestral gene, or reverse transcription (and integration)  Not expressed due to mutations that produce a stop codon (nonsense or frame-shift) or prevent mRNA processing, or due to lack of regulatory sequences Tandemly Repeated DNA  A large number of identical repeated DNA sequences  It spread over the entirely chromosome  There is variation within species for the number of copies in allelic arrays  Variations in the lengths of tandemly repeat units have been used as a sources of molecular marker  It is divided into: 1. Tandemly repeated expressed DNA 2. Tandemly repeated non expressed DNA (Repetitious DNA) Tandemly Repeated Expressed Genes Genes which are duplicated and clustered at many location of the genome Ribosomal 18S, 58S, 25S and 5S RNA genes are highly reiterated in clusters and form at sites called nucleolus organizers (NOR) They are also observed for tDNA and histones Tandemly Repeat non expressed DNA Repetitive sequences which are unable to be expressed but found in huge amount in the genome Simple-sequence DNA Moderately repeated DNA (mobile DNA) Simple Sequence DNA  Very sort sequences repeated many times in tandem in large clusters  It is also called as satellite DNA  It often lies in heterochromatin especially in centromeres and telomeres  It is divided into 2 groups: Mini satellite : Variable number tandem repeat (VNTR) Micro satellite : Simple sequence repeat (SSR)  It is used in DNA fingerprinting to identify individuals Tandemly repeated DNA Microsatellite (SSR: Simple sequence repeat) • Unit size: at most 5 bp • ATATATATATATATATATATATAT Minisatellite • Unit size: up to 25 bp • ATTGCTGTATTGCTGTATTGCTGT Mobile DNA (Jumping gene) Units of DNA which are predisposed to move to another location, sometimes involving replication of the unit, with the help of products of genes on the elements or on related element  Move within genomes  Most of moderately repeated DNA sequences found throughout higher eukaryotic genomes  Some encode enzymes that catalyze movement  2 types: a. Transposon b. Retrotransposon Transposon DNA Involves copying of mobile DNA element and insertion into new site in genome  Molecular parasite: “selfish DNA”  They probably have significant effect on evolution by facilitating gene duplication, which provides the fuel for evolution, and exon shuffling Retrotransposon (retroelement)  Transposon like segment of DNA  Retroviruses lacking the sequence encoding the structural envelope protein  Major component of plant genome  Size ranges from 1 to 13 kb in length  Widely distributed over the chromosomes of many plant species gene Retrovirus A virus of higher organism whose genome is RNA, but which can insert a DNA copy its genome into host chromosome Mobile elements  50-80% of plant genomes are Transposable Element Plant genome sizes Predicted Gene numbers Small difference in gene number, although rice genome is 3x the size Eukaryotic cells Peter J. Russell, iGenetics: Copyright © Pearson Education, Inc., publishing as Benjamin Cummings. Mitochondrial genome (mtDNA)  Number of mitochondria in plants can be between 50-2000  One mitochondria consists of 1 – 100 genomes (multiple identical circular chromosomes).  They are one large and several smaller  Size ~ 200 kb to 2,500 kb in plants  Mt DNA is replicated before or during mitosis  Transcription of mtDNA yielded an mRNA which did not contain the correct information for the protein to be synthesized.  RNA editing is existed in plant mitochondria  Over 95% of mitochondrial proteins are encoded in the nuclear genome.  Often A+T rich genomes Chloroplast genome (ctDNA)  Multiple circular molecules, similar to procaryotic cyanobacteria, although much smaller (0.001-0.1%of the size of nuclear genomes)  Cells contain many copies of plastids and each plastid contains many genome copies  Size ranges from 120 kb to 160 kb  Plastid genome has changed very little during evolution. Though two plants are very distantly related, their genomes are rather similar in gene composition and arrangement  Some of plastid genomes contain introns  Many chloroplast proteins are encoded in the nucleus (separate signal sequence) DNA for chloroplast proteins can be come from the nucleus or chloroplast genome Buchannan et al. Fig. 4.4