* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Gene Expression
Cre-Lox recombination wikipedia , lookup
Community fingerprinting wikipedia , lookup
Gene expression profiling wikipedia , lookup
Bottromycin wikipedia , lookup
RNA interference wikipedia , lookup
Biochemistry wikipedia , lookup
Non-coding DNA wikipedia , lookup
Gene regulatory network wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Molecular evolution wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
List of types of proteins wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Point mutation wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Polyadenylation wikipedia , lookup
RNA silencing wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Expanded genetic code wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Messenger RNA wikipedia , lookup
Transfer RNA wikipedia , lookup
Genetic code wikipedia , lookup
Non-coding RNA wikipedia , lookup
What you should know about gene expression • Phenotype is determined by the proteins produced as the result of gene expression. • Only a fraction of the genes in a cell are expressed. • Gene expression is influenced by intraand extra-cellular environmental factors. • Gene expression is controlled by the regulation of both transcription and translation. Phenotype/Genotype • A cell’s genotype is determined by the sequence of DNA bases in its genes • Phenotype is determined by the proteins produced as the result of gene expression Selective Gene Expression • Although a specialised cell has a complete set of the organism's genes, only those needed for its specialised functions are switched on. All other genes are switched off. • So only a fraction of genes in a cell are expressed • The process of differentiation proceeds in a stepwise fashion and involves changes in gene expression. • Gene expression is the activation of a gene that results in the formation of a protein. • Gene expression is influenced by intraand extra-cellular environmental factors. Gene activity in different specialised cells Cell type Activity of genes coding for production of: antibodies lysosome enzymes enzymes for synthesis of urea pepsin phagocyte off on off off liver off off on off stomach lining off off off on lymphocyte on off off off Gene expression is controlled by the regulation of the processes of TRANSCRIPTION and TRANSLATION (protein synthesis). DNA Base -> Amino Acid -> Protein • 4 different organic bases, which make up the genetic code (DNA) • Bases are taken in groups of 3, gives rise to 64 different combinations (4³) • Amino acids are produced according to the sequence of every 3 bases on DNA • Each individuals’ base triplets are arranged in a specific order for coding for the particular proteins needed by that individual Gene expression- Do you know ? • Phenotype is determined by the proteins produced as the result of gene expression. • Only a fraction of the genes in a cell are expressed. • Gene expression is influenced by intraand extra-cellular environmental factors. • Gene expression is controlled by the regulation of both transcription and translation. RNA, Transcription and Translation What you should know about RNA • RNA is single stranded • RNA contains uracil instead of thymine RNA contains ribose instead of deoxyribose sugar. • mRNA carries a copy of the DNA code from the nucleus to the ribosome. • Ribosomal RNA (rRNA) and proteins form the ribosome. • Each transfer RNA (tRNA) carries a specific amino acid. Structure of RNA • Differences between DNA and RNA RNA: • Single Stranded • Bases: Adenine, Uracil, Guanine and Cytosine • Ribose Sugar Types of RNA • Messenger RNA (mRNA) – carries the genetic information (in base triplets called codons) from the nucleus to the cytoplasm for protein synthesis • Transfer RNA (tRNA) – Carries amino acids on the anti-codon to the appropriate codon to form a polypeptide RIBONUCLEIC ACID • DNA carries the code (“recipe”) for making proteins • The “equipment” for protein synthesis is in the cytoplasm • mRNA acts as a go-between molecule, carrying the “recipe” to the “equipment”. Transcription Transcription- what you should know • Describe the transcription of DNA into primary and mature RNA transcripts and include the role of RNA polymerase and complementary base pairing. • The introns of the primary transcript of mRNA are noncoding and are removed in RNA splicing. • The exons are coding regions and are joined together to form mature transcript. This process is called RNA splicing. TRANSCRIPTION • The process of making mRNA from the template provided on DNA • DNA to act as template • Free RNA nucleotides • Enzymes including RNA polymerase • ATP for energy • When mRNA is formed, it has triplets of bases along it. These are called codons: CODON • AGCUUACGGAUG TRANSCRIPTION • Transcription - copies the information in DNA into an RNA molecule - occurs in the nucleus. 1) RNA polymerase enzyme binds to the promoter region of the DNA, it moves along the DNA, unwinding the double helix & breaking hydrogen bonds holding the base pairs together 2) Free RNA nucleotides join onto the 3’ end of the growing mRNA & bond with their complementary base pairs on the DNA (Remember- A-U, G-C) 3) The RNA that has been produced at this stage is known as the primary transcript • The primary transcript now undergoes splicing • Hydrogen bonds between DNA bases re-form • DNA coils up into double helix SPLICING Introns and exons • The primary transcript of RNA is composed of introns and exons. • The introns are non-coding regions of genes and so do not appear in the mRNA in eukaryotic cells. The exons are coding regions of genes and so do appear in the mRNA. • The introns of the primary transcript of mRNA are removed in RNA splicing. RNA splicing • In RNA splicing, the primary transcript is cut at the boundaries between the introns and exons. • The introns are removed and the exons are joined together, to leave a continuous sequence of nucleotides. • The mRNA can then leave the nucleus via a nuclear pore and enter the cytoplasm to move onto the next stage of protein synthesisTRANSLATION. DNA to Protein Transcription- Do you know ? • How to describe the transcription of DNA into primary and mature RNA transcripts and include the role of RNA polymerase and complementary base pairing. • That the introns of the primary transcript of mRNA are non-coding and are removed in RNA splicing. • The exons are coding regions and are joined together to form mature transcript. This process is called RNA splicing. Translation Translation –what you should know • Describe the translation of mRNA into a polypeptide by tRNA at the ribosome. • tRNA folds due to base pairing to form a triplet anticodon site and an attachment site for a specific amino acid. • Triplet codons on mRNA and anticodons translate the genetic code into a sequence of amino acids. • Start and stop codons exist. • Codon recognition of incoming tRNA, peptide bond formation and exit of tRNA from the ribosome as a polypeptide is formed. TRANSLATION • Changing the code on mRNA into a sequence of amino acids. • Occurs in the cytoplasm • Involves ribosomes The ribosome • found in the cytoplasm either floating freely or attached to the rough endoplasmic reticulum. • Ribosomes floating freely are used to synthesise proteins for use within the cell; those attached to the endoplasmic reticulum synthesise proteins for export or inclusion in the membrane. • Ribosomes are formed from proteins and a third type of RNA known as ribosomal RNA (rRNA). David S. Goodsell RCSB PDB • During translation they allow the mRNA and tRNA to come together. Amino acid attachment site tRNA • Complementary base pairing occurs between nucleotides within the strand of tRNA, producing tRNA’s distinctive structure. This structure exposes a triplet anticodon site and attachment site for a specific amino acid. • The triplet anticodon site is complementary to the triplet codon site on the mRNA. Triplet anticodon TRANSLATION 1) During translation the mRNA passes through the ribosome. AMINO ACID tRNA 2) The ribosome binds to the mRNA so that the start codon is in position RIBOSOME U C G CODON A G C A U U A G C C C U A G A G G mRNA ANTICODON TRANSLATION 3) The codons are recognised by tRNA, each carrying a particular amino acid. U A A U C G A G C A U U A G C C C U A G A G G TRANSLATION 4) The appropriate tRNA brings its amino acid to the ribosome as it moves along the mRNA. U C G U A A A G C A U U A G C C C U A G A G G TRANSLATION U C G U A A U C G A G C A U U A G C C C U A G A G G TRANSLATION 5) Adjacent amino acids then join with a peptide bond. PEPTIDE BOND U C G G G A U C G A G C A U U A G C C C U A G A G G U A A TRANSLATION U A A U C U G G A A G C A U U A G C C C U A G A G G U C G TRANSLATION 6) The tRNA then leaves the ribosome. U C G U C U A G C A U U A G C C C U A G A G G G A A TRANSLATION 7) This process continues until a stop codon is reached and the polypeptide is released. POLYPEPTIDE CHAIN G G A A G C A U U A G C C C U A G A G G U C U DNA – mRNA – tRNA - Protein Complete the sequences of mRNA and tRNA then using Torrance pg 39 find out the names of the amino acids. DNA - TTACGGCAATGCGGTACCGTTGGGGGCAG mRNA Codons (set of 3 bases) tRNA Anti-codons (set of 3 matching bases) Protein - DNA – mRNA – tRNA - Protein DNA - TTACGGCAATGCGGTACCGTTGGGGGCAG mRNA - AAUGCCGUUACGCCAUGGCAACCCCCGUC Codons (set of 3 bases) tRNA - UUACGGCAAUGCGGUACCGUUGGGGGCAG Anti-codons (set of 3 matching bases) Protein - aspn– ala – val – thr – pro – try – glu – pro - pro Overview Fate of Protein • The protein is carried in a vesicle from the RER to the Golgi where it is processed and packaged into a vesicle which fuses with the cell membrane. Translation –You should know • The process of translation of mRNA into a polypeptide by tRNA at the ribosome. • tRNA folds due to base pairing to form a triplet anticodon site and an attachment site for a specific amino acid. • Triplet codons on mRNA and anticodons translate the genetic code into a sequence of amino acids. • Start and stop codons exist. • Codon recognition of incoming tRNA, peptide bond formation and exit of tRNA from the ribosome as a polypeptide is formed. Protein synthesis storyboard • You are going to produce a storyboard showing the process of protein synthesis in a number of steps. • For each step you should draw a diagram and give a short description of what is happening. • Use as many boxes as you require to describe the full process. • The steps should be displayed in the correct order, with all the main molecules mentioned. Protein synthesis storyboard
 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                            