* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Slide 1
Peptide synthesis wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Molecular cloning wikipedia , lookup
RNA interference wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
DNA supercoil wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Metalloprotein wikipedia , lookup
Non-coding DNA wikipedia , lookup
Proteolysis wikipedia , lookup
RNA silencing wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Protein structure prediction wikipedia , lookup
Polyadenylation wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Point mutation wikipedia , lookup
Biochemistry wikipedia , lookup
Messenger RNA wikipedia , lookup
Gene expression wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Genetic code wikipedia , lookup
Transcription, Translation & Protein Synthesis Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message contained within its DNA. However: DNA is only found in the nucleus Proteins are only made outside the nucleus – in the cytoplasm. Protein Synthesis How do the many different messages within the DNA molecule get to the many ribosomes outside the nucleus? A molecular cousin of DNA – RNA – is used to carry these messages. Ribonucleic Acids (RNA) The job of RNA (ribonucleic acid) is to carry messages from the DNA (in the nucleus) to the ribosomes (in the cytoplasm). There are three types of RNA: 1. 2. 3. mRNA – carries a message from the DNA to the ribosome tRNA – transports amino acids to the mRNA to make a protein rRNA – make up ribosomes, which make protein. Ribonucleic Acids (RNA) RNA is almost exactly like DNA, except: Contains a ribose sugar, instead of a deoxyribose sugar (hence the name…) Contains uracil instead of thymine. RNA is single-stranded, not doublestranded Ribonucleic Acids (RNA) Protein Synthesis Occurs in TWO steps: Transcription – the genetic information from a strand of DNA is copied into a strand of mRNA 2. Translation – the mRNA, with the help of the ribosome, forms a chain of amino acids (eventually forming a protein) based on the information contained on the mRNA. 1. The Central Dogma This order of events is called the central dogma of molecular biology: DNA RNA P R O T E I N Step One: Transcription 1. 2. 3. DNA unzips: enzymes split apart base pairs and unwind the DNA double helix. Bases pair up: Free nucleotides in the cell find their complementary bases along the new strands. What will be different?? New backbone formed: The sugarphosphate backbone is assembled to complete the RNA strand, and separates from the DNA strand. Step One: Transcription Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT Step One: Transcription Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT AUGCGUACUGAUCGUUCAGAUUGA Step 1½: RNA Editing An mRNA molecule has to be “edited” in order to be useful. There’s a lot of unnecessary information that needs to be removed. An mRNA sequence that does NOT code for protein is called an interon. A sequence that is useful in making a protein is called an exon. Step 1½: RNA Editing DNA transcription pre-RNA (in nucleus) exon 1 interon RNA editing exon 2 interon interon interon RNA (in cytoplasm) exon 1 exon 2 exon 3 exon 3 Step Two: Translation Now that our mRNA molecule has been made, it’s time for its message to be made into a protein sequence. How does the mRNA sequence translate into an amino acid sequence? Step Two: Translation Problem: There are 20 different amino acids. There are 4 RNA bases. A T C G phe ile leu val met pro ser ala thr his tyr asn gln asp lys cys glu arg trp gly Step Two: Translation 1. 2. So how do you exactly go about determining what protein your cells are going to make? FIRST, Divide the mRNA sequence into codons. As you just saw and heard, codons are three-base sections of mRNA: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA Step Two: Translation Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: 2. AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA ? The Genetic Code Step Two: Translation 2. Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA met ? The Genetic Code Step Two: Translation 2. Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA met arg thr asp arg ser asp ??? The Genetic Code Step Two: Translation 2. Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA met met thr asp arg ser asp STOP RECAP: 1. 2. 3. DNA is transcribed into mRNA in the nucleus. The mRNA leaves the nucleus and enters the cytoplasm. The protein is translated from the mRNA sequence using tRNA and amino acids.