* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download lecture - Berkeley MCB
Genetic engineering wikipedia , lookup
Neocentromere wikipedia , lookup
Human genome wikipedia , lookup
Gene desert wikipedia , lookup
Non-coding DNA wikipedia , lookup
Pathogenomics wikipedia , lookup
X-inactivation wikipedia , lookup
Epigenetics wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Epigenetics in stem-cell differentiation wikipedia , lookup
Long non-coding RNA wikipedia , lookup
Point mutation wikipedia , lookup
Histone acetyltransferase wikipedia , lookup
Biology and consumer behaviour wikipedia , lookup
Ridge (biology) wikipedia , lookup
History of genetic engineering wikipedia , lookup
Epigenetics of diabetes Type 2 wikipedia , lookup
Public health genomics wikipedia , lookup
Genomic imprinting wikipedia , lookup
Gene expression programming wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Epigenetics in learning and memory wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Minimal genome wikipedia , lookup
Genome evolution wikipedia , lookup
Designer baby wikipedia , lookup
Microevolution wikipedia , lookup
Gene expression profiling wikipedia , lookup
Oncogenomics wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Genome (book) wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Nutriepigenomics wikipedia , lookup
The genetics of heterochromatin in metazoa MCB 140 11/29/06 1 MCB 140 11/29/06 3 Hermann Joseph Muller 1946 Nobel Prize in Medicine: "for the discovery of the production of mutations by means of X-ray irradiation" MCB 140 11/29/06 4 The true meaning of "red eye reduction": White wild-type White mutant MCB 140 11/29/06 5 12.14 MCB 140 11/29/06 6 12.14 MCB 140 11/29/06 7 Gene behavior can change depending on where on the chromosome the gene lies. = “position effect” (bar is the most commonly used example) “Position effect variegation” (PEV): cell-to-cell variability of expression of a gene that has been relocated to a new position in the genome. Epigenetic phenomenon: Stable change in expression without change in sequence! MCB 140 11/29/06 8 Enhancer of PEV Suppressor of PEV MCB 140 11/29/06 9 2 genes: Su(var)2-5 Su(var)3-9 MCB 140 11/29/06 10 MCB 140 11/29/06 11 MCB 140 11/29/06 12 HP1 (Sarah Elgin) (heterochromatin protein 1) Identified in a BIOCHEMICAL scheme to discover proteins that are associated with heterochromatin. MCB 140 11/29/06 13 MCB 140 11/29/06 14 biochemistry genetics HP1 = Su(var)2-5 Conserved in humans and in mice (both in terms of sequence and intranuclear location!). Why does HP1 go to places that HP1 goes to? MCB 140 11/29/06 15 “Biochemical epistasis” (T. Jenuwein) Overexpression of mouse Su(var)3-9 leads to a MASSIVE redistribution of HP1 in the nucleus of mouse cells. MCB 140 11/29/06 16 Who would have thunk it? NCBI: Su(var)3-9 contains a domain (the SET domain) that is somewhat similar to, ahem, RUBISCO methyltransferase. Su(var)3-9 is a HISTONE methyltransferase. MCB 140 11/29/06 17 Histone methylation MCB 140 11/29/06 18 Calling David Duchovny and Gillian Anderson • Su(var)3-9 was given this name because it was the 9th gene isolated on the 3rd chromosome in a screen for Su(var)s. • It methylates lysine 9 in histone H3. This was discovered 18 years after it was named. MCB 140 11/29/06 19 And finally • HP1 preferentially BINDS histone H3 methylated on lysine 9. • That’s why Su(var)3-9 determines localization of HP1 to heterochromatin (it methylates histones in heterochromatin). • At least in fission yeast, and perhaps in worms, this has to do with RNAi. MCB 140 11/29/06 20 MCB 140 11/29/06 21 MCB 140 11/29/06 22 HP1 HP1 MCB 140 11/29/06 23 HP1 HP1=HP1 HP1=HP1 HP1=HP1 HP1 MCB 140 11/29/06 24 Remembrance of things past: chromatin as an epigenetic vehicle MCB 140 11/29/06 25 Homology (orthologs of heterochomatin proteins in fission yeast, insects, and humans) MCB 140 11/29/06 26 Analogy Fission yeast, flies, mammals. Budding yeast. MCB 140 11/29/06 27 Nature, October 10, 2002 The polycomb group protein EZH2 is involved in progression of prostate cancer Varambally et al. Prostate cancer is a leading cause of cancer-related death in males and is second only to lung cancer. Although effective surgical and radiation treatments exist for clinically localized prostate cancer, metastatic prostate cancer remains essentially incurable. Here we show, through gene expression profiling, that the polycomb group protein enhancer of zeste homolog 2 (EZH2) is overexpressed in hormone-refractory, metastatic prostate cancer. … Dysregulated expression of EZH2 may be involved in the progression of prostate cancer, as well as being a marker that distinguishes indolent prostate cancer from those at risk of lethal progression. MCB 140 11/29/06 28 From egg to embryo ? 29 30 Homeotic mutations (W. Bateson) Genetics Allele Heterozygous Homozygous “… Not that there has merely been a change, but that something has been changed into the likeness of something else.” MCB 140 11/29/06 31 wt antennapedia MCB 140 11/29/06 32 MCB 140 11/29/06 33 The segmentation hierarchy 34 “Do you have any idea who I think I am?!!” 1. Segment identity is determined by transcription factors. 2. They act on target genes only transiently. Then they go away, and the activity of their targets is maintained by large complexes: Polycomb represses genes, and Trithorax activates them. 3. Nobody knew how Polycomb and Trithorax do this. MCB 140 11/29/06 35 How Polycomb and Trithorax work MCB 140 11/29/06 36 extra sex combs enhancer of zeste MCB 140 11/29/06 37 E(z) does it Posted September 13, 2002 – CELL immediate early publication Czermin, B., Melfi, R., McCabe, D., Seitz, V., Imhof, A., and Pirrotta, V. Drosophila Enhancer of Zeste/ESC complexes have a histone H3 methyltransferase activity that marks chromosomal Polycomb sites. Cell. Published online September 13, 2002. 10.1016/S0092867402009753 Müller, J., Hart, C.M., Francis, N.J., Vargas, M.L., Sengupta, A., Wild, B., Miller, E.L., O'Connor, M.B., Kingston, R.E., and Simon, J.A. Histone methyltransferase activity of a Drosophila Polycomb group repressor complex. Cell. Published online September 13, 2002. 10.1016/S0092867402009765 MCB 140 11/29/06 38 MCB 140 11/29/06 39 “Influential ideas are always simple. Since natural phenomena need not be simple, we master them, if at all, by formulating simple ideas and exploring their limitations.” Al Hershey MCB 140 11/29/06 40 stimulus + + Regulation of genes occurs via the interaction of transacting factors (proteins) with cis-acting sequences near the genes themselves. MCB 140 11/29/06 41 MCB 140 11/29/06 42 43 Bicoid is the anterior morphogen 44 MCB 140 11/29/06 45 What democracy, I mean, gene regulation, is really like • Trans-acting factors do not distribute in the nucleus based on the primary sequence of the genome: some factors fail to bind most genes that have sequences waiting for them, and other factors bind a large number of genes that do NOT have sequences for them • Even when a factor binds next to a gene, many times, nothing happens; the same factor bound to two different genes can exert diametrically opposite effects • Most genes in the human genome are under considerable regulatory influence from entities other than “simple” trans-acting factors; these entities include noncoding RNA and modified histones MCB 140 11/29/06 46 Boyer and Young Cell Sept. 23, 2005 MCB 140 11/29/06 47 David Allis: “the histone code” Fischle, Wang, Allis COCB 2003 1963-2000 2000 - … Henry et al. (11/1/2003) Genes Dev. 17: 2648. MCB 140 11/29/06 51 Genetic information Lac operator gaattgtgagcggataacaattt Genetic information - Genetic information + ?