* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Sir Alec Jeffreys minisatellites
DNA barcoding wikipedia , lookup
DNA sequencing wikipedia , lookup
Epigenetics in learning and memory wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Oncogenomics wikipedia , lookup
Genetic engineering wikipedia , lookup
Transposable element wikipedia , lookup
SNP genotyping wikipedia , lookup
DNA polymerase wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
DNA profiling wikipedia , lookup
Minimal genome wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Metagenomics wikipedia , lookup
Primary transcript wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Point mutation wikipedia , lookup
Designer baby wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Cancer epigenetics wikipedia , lookup
DNA vaccination wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Human genome wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Genome evolution wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Molecular cloning wikipedia , lookup
Genomic library wikipedia , lookup
Microevolution wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Epigenomics wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Genome editing wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
DNA supercoil wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Non-coding DNA wikipedia , lookup
Microsatellite wikipedia , lookup
CODIS Sir Alec Jeffreys minisatellites CODIS - Repetitive DNA Repetitive DNA I Satellite DNA I Minisatellite DNA I Microsatellite DNA I Transposable elements I LINES, SINES and other retrosequences I High copy number genes (e.g. ribosomal genes, histone genes) I Multifamily member genes (e.g. hemoglobin, immunoglobulin) CODIS - Repetitive DNA Satellite DNA Unit Repeat Location Examples - 5-300 bp depending on species. 105 - 106 times. Generally heterochromatic. Centromeric DNA, telomeric DNA. There are at least 10 distinct human types of satellite DNA. A single type may be more than 1% of the genome (equivalent to 3 entire E. coli genomes). CODIS - Repetitive DNA Human satellite DNA is prone to be multimeric or hierarchical in structure. Human α satellite DNA (centromeric) is typically 171 bp long present as dimers (342 bp) or up to 16’mers (2736 bp) as the repeating units. Generally less length variation than minisatellites or microsatellites. CODIS - Repetitive DNA Human β satellite DNA is present as 30,000 - 60,000 copies of a 68 bp monomer (2,040,000 - 4,080,000 bp) on the metacentric chromosome 9 and the acrocentric chromosomes 13, 14, 15, 21, and 22. It is a pericentromeric repeat in humans. CODIS - Repetitive DNA Examples of Satellites from Drosophila virilus. Satellite I II III Primary Copies per Percent of Sequence genome genome ACAAACT ATAAACT ACAAATT 1.1 × 107 3.6 × 106 3.6 × 106 25% 8% 8% 41% CODIS - Repetitive DNA Minisatellite DNA Unit - 15-400 bp (average about 20). Repeat - Generally 20-50 times (1000-5000 bp long). Location - Generally euchromatic. Examples - DNA fingerprints. Tandemly repeated but often in dispersed clusters. Also called VNTR’s (variable number tandem repeats). Human λ33.1 minisatellite (62 bp) AAGGGTGGGCAGGAAGTGGAGTGTGTGCCTG CTTCCCTTCCCTGTCTTGTCCTGGAAACTCA Human λ33.5 minisatellite (17 bp) YGGGCAGGAGGGGGAGG CODIS - Repetitive DNA Microsatellite DNA Unit Repeat Location Examples - 2-4 bp (most 2). on the order of 10-100 times. Generally euchromatic. Most useful marker for population level studies. This example is from a water snake . . . ...TCCAGACAAGGTGGTGTGTGTGTGTGTGTG TGTGTGTGTGTGTTTCTCCAGTGAGATTTA... CODIS - Repetitive DNA Other repetitive elements include Transposable elements - Sequences that have the ability to move around within and between genomes. Most eukaryotes have them while prokaryotes have a different class of mobile elements. LINES, SINES and other retrosequences - Mobile sequences that copy themselves within genomes via an RNA intermediate. High copy number genes - Examples include ribosomal genes and histone genes. Multifamily member genes - Examples include hemoglobin and immunoglobulin genes. CODIS - the database I In 1990 the FBI established a pilot project. I In 1994 CODIS (Combined DNA Index System) was established. I In 1998 it was fully operational. I In 2007 it contained more than 4.5 × 106 records. I Records contain specimen numbers and DNA profiles but nothing else. CODIS - the markers From wikipedia (28/11/08). DNA databases go too far CODIS and probabilities Juries get confused by numbers. CODIS and LCN In the U.S., to my knowledge, LCN is used only for intelligence and not for evidence. what are your relatives up to? CSI hasn’t picked up on this theme yet. AFIS and CODIS are Biometrics Both AFIS and CODIS are examples of biometrics. In today’s environment, such methods are becoming increasingly used. Other biometric methods include, I Ear shape-structure I Facial recognition I Hand thermograms I Digital voice signatures I Gait I Hand geometry I Iris scans I Retinal scans NCBI I Science is based on the production and the exchange of knowledge NCBI I I Science is based on the production and the exchange of knowledge Strong need for places were data could be freely available I I to verify results to facilitate the progress of research NCBI I I Science is based on the production and the exchange of knowledge Strong need for places were data could be freely available I I I to verify results to facilitate the progress of research Submission to databases is mandatory prior to article publication I I sequences (GenBank, EMBL, DDBJ, SWISSPROT) gene expression (Gene Expression Omnibus, Array Express) NCBI I Welcome-Trust Sanger Institute I The Institute of Genome Research (TIGR) I Celera I The Craig Venter Institute I Genome sequencing center of Washington University at Saint Louis I The Broad Institute in Cambridge Mass. I Riken Institute in Japan
 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
									 
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                             
                                            