* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Cloning, Expression, and Functional Characterization of TL1A-Ig
		                    
		                    
								Survey							
                            
		                
		                
                            
                            
								Document related concepts							
                        
                        
                    
						
						
							Transcript						
					
					University of Miami Scholarly Repository Open Access Dissertations Electronic Theses and Dissertations 2013-02-06 Cloning, Expression, and Functional Characterization of TL1A-Ig Samia Q. Khan University of Miami, samia_qk@hotmail.com Follow this and additional works at: http://scholarlyrepository.miami.edu/oa_dissertations Recommended Citation Khan, Samia Q., "Cloning, Expression, and Functional Characterization of TL1A-Ig" (2013). Open Access Dissertations. 969. http://scholarlyrepository.miami.edu/oa_dissertations/969 This Open access is brought to you for free and open access by the Electronic Theses and Dissertations at Scholarly Repository. It has been accepted for inclusion in Open Access Dissertations by an authorized administrator of Scholarly Repository. For more information, please contact repository.library@miami.edu. UNIVERSITY OF MIAMI CLONING, EXPRESSION, AND FUNCTIONAL CHARACTERIZATION OF TL1A-IG By Samia Q. Khan A DISSERTATION Submitted to the Faculty of the University of Miami in partial fulfillment of the requirements for the degree of Doctor of Philosophy Coral Gables, Florida May 2013 ©2013 Samia Q. Khan All Rights Reserved UNIVERSITY OF MIAMI A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy CLONING, EXPRESSION, AND FUNCTIONAL CHARACTERIZATION OF TL1A-IG Samia Q. Khan Approved: ________________ Eckhard R. Podack, M.D., Ph.D. Professor of Immunology and Microbiology _________________ M. Brian Blake, Ph.D. Dean of the Graduate School ________________ Kerry L. Burnstein, Ph.D. Professor of Molecular & Cell Pharmacology _________________ Wasif N. Khan, Ph.D. Professor of Immunology and Microbiology _________________ Robert Levy, Ph.D. Professor of Immunology and Microbiology _________________ Dao Nguyen, M.D. Associate Professor of Surgery KHAN, SAMIA Q. (Ph.D., Cancer Biology) Cloning, Expression, and Functional Characterization (May 2013) of TL1A-Ig Abstract of a dissertation at the University of Miami Dissertation supervised by Professor Eckhard R. Podack No. of pages in text. (124) TNFRSF25, a member of the TNF receptor superfamily, is a type I transmembrane protein that has a cytoplasmic death domain. TNFRSF25 is expressed primarily by T lymphocytes, including CD4+, CD8+, and NKT cells and is efficiently upregulated after T cell stimulation. The natural ligand for TNFRSF25, TL1A, is a type II transmembrane protein can be subsequently cleaved as a soluble trimeric protein by a member of metalloproteases. Our lab previously reported that TNFRSF25 stimulation using an agonist antibody, 4C12, expands pre-existing CD4+FoxP3+ Tregs in vivo. To determine how the physiological ligand differs from the antibody, we generated the soluble mouse TL1A-Ig fusion protein (TL1A-Ig) that forms a dimer of TL1A-trimers in solution with an apparent m.w. of 528 kDa. In vitro, TL1A-Ig mediated rapid proliferation of Foxp3+Treg and a population of CD4+FoxP3- conventional T cells (Tconv). TL1A-Ig also blocked de novo biogenesis of inducible Tregs (iTregs) and it attenuated the suppressive function of Treg. Treatment with TL1A-Ig in vivo induced the proliferation and activation of memory Tconvs, as well as, the expansion of Tregs such that they became 30-35% of all CD4+ T cells in the peripheral blood within 5 days of treatment. Treg proliferation was dependent upon TCR engagement with MHC class II. Elevated Tregs were maintained for at least 20 days with daily injections of TL1A-Ig. TL1A-Ig-expanded Treg cells expressed high levels of activation/memory markers KLRG1 and CD103 and were highly suppressive ex vivo. TL1A-Ig mediated Treg expansion in vivo was protective against allergic lung inflammation, a mouse model for asthma, by reversing the ratio of Tconv cells to Tregs in the lung and blocking eosinophil exudation into the bronchoaveolar fluid. The potential of TNFRSF25 agonists was also tested in transplant tolerance. TNFRSF25 mediated Treg cell expansion in vivo significantly prolonged allogeneic skin graft survival. Our findings shed light on the role of TNFRSF25 signaling in CD4+ T cell subsets and the role of TL1A/TNFRSF25 in mediating inflammatory responses and resolving inflammation in tissue. Thus, TL1A-Ig fusion proteins are highly active and tightly controllable agents to stimulate Treg proliferation in vivo, and are uniquely able to maintain high-levels of expanded Treg for long periods of time by repeated administration. This dissertation is dedicated to my parents and my husband. My accomplishments are a result of their unconditional love, support and unwavering faith in me. iii Acknowledgements I am thankful to my mom and dad, Imtiaz and Qamar, who taught me the importance of education, hard work and persistence. As I come to the end of my five and a half year journey of graduate school, I realize how important the emotional support, patience and encouragement of my parents, and very recently my husband, was to make this accomplishment possible. I am proud to be a woman who left her home at a young age to pursue her dream of higher education. Imran, my husband and my best friend, thank you for being patient with me and for being by my side through the toughest time of my graduate career. This accomplishment would have been impossible without my family. To the Podack Lab: Thank you everyone for your help and critical analysis of my experimental data, for sharing your wisdom and technical skills and making the lab a wonderful place to work. And finally, to my mentor, Dr. Eckhard Podack, MD, PhD, and the person who ignited my passion for science: Thank you for teaching me classical scientific and correct techniques, for your guidance and support, for pushing me harder, for sharing your love for science and giving me the freedom to ask questions about the unknown. No words can describe my gratitude for your priceless gift of knowledge. Thank you all! iv Table of Contents LIST OF FIGURES viii LIST OF TABLES xi CHAPTER 1: INTRODUCTION 1 1.1 The immune system: innate and adaptive responses 1 1.2 Subsets of T lymphocytes 3 1.3 TNF superfamily members 12 1.3.1 Expression, structure, and signaling of TNFSF members 13 1.3.2 Multiple functions of TNF superfamily members 20 1.3.2.1 Development & maintenance of lymphoid structure 20 1.3.2.2 Defense against microbial infections 21 1.3.2.3 Mediators of cell death 22 1.3.2.4 TNF superfamily members in cellular responses 22 1.3.3 1.3.2.4.1 CD4+ and CD8+ T effector cells 23 1.3.2.4.2 Other immune cells 24 1.3.2.4.3 Regulatory T cells 26 TNF superfamily members in disease and immunotherapy 27 1.3.3.1 TNF superfamily members in autoimmune and inflammatory diseases and cancer 28 1.3.3.2 Protein therapeutics targeting TNF super family members 1.4 TNF-like ligand 1A (TL1A)/TNF receptor superfamily 25 (TNFRSF25) 30 33 1.4.1 TL1A 33 1.4.2 TNFRSF25 35 1.4.3 TL1A/TNFRSF25 in immunological responses 36 1.5 Aims of the dissertation 38 CHAPTER 2. RESULTS 40 2.1 Construction and characterization of TL1A-Ig 40 2.1.1 Genetic engineering and preliminary studies of four TL1A-Ig constructs v 40 2.1.2 GS selection system for the generation of high TL1A-Ig expressing clone 43 2.1.3 Biochemical and gel filtration analysis of TL1A-Ig 45 2.2 In vitro functional activity of TL1A-Ig 50 2.2.1 TL1A-Ig binds and stimulates TNFRSF25 overexpressed on tumor cells 50 2.2.2 TL1A-Ig binds and co-stimulates TNFRSF25 expressed on T cells 52 2.3 In vivo functional activity of TL1A-Ig 55 2.3.1 Half-lives of TL1A-Ig and 4C12 55 2.3.2 TL1A-Ig induces rapid proliferation of CD4+FoxP3+ Treg cells in vivo 56 2.3.3 Long-term administration of TL1A-Ig maintains elevated Treg levels 58 2.3.4 Characterization of T cell subsets in TL1A-Ig treated mice. 60 2.3.5 FoxP3+ Tregs from TL1A-Ig treated mice are highly suppressive ex vivo 64 2.3.6 Depletion of gut commensal bacteria by antibiotics treatment 66 2.3.7 TNFRSF25 costimulation and induction of ovalbumin specific Tregs in vivo 68 2.3.8 Suppression of allergic lung inflammation by TL1A-Ig expanded Tregs 70 2.3.9 Prolongation of allogeneic skin transplant by TL1A-Ig expanded Tregs 73 CHAPTER 3: DISCUSSION 76 CHAPTER 4: MATERIAL AND METHOD 88 4.1 Mice 88 4.2 Antibodies and reagents 88 4.3 Plasmid Construction 89 4.4 Cells and Culture Conditions 90 4.5 Transfection and selection 90 4.6 Production and Purification Conditions 91 4.7 ELISA quantification assays 92 4.8 Coomassie Blue stain and Western blot analysis 93 4.9 Gel filtration and dot blot analysis 93 4.10 In vitro binding assays to mouse TNFRSF25 expressing cells 94 4.11 In vitro caspase assays 95 vi 4.12 In vitro T cell culture 95 4.13 In vitro suppression assays 96 4.14 Antibiotics 97 4.15 Induction of allergic lung inflammation 97 4.16 Skin transplantation 98 4.17 Tumor inoculation and immunization 98 4.18 Flow cytometry analysis and FACs sorting 98 4.19 Cell adoptive transfer 99 4.20 Histology 99 4.21 Statistics 100 Appendix 1: Combination therapy of gp96-Ig vaccine and TNFRSF25 agonists to enhance anti-tumor immunity 101 REFERENCES 105 vii List of Figures Figure 1. T cell lineage and subsets 3 Figure 2. APCs deliver 3 kinds of signals 3 Figure 3. Summary of the 4 CD4 T helper cell fates 5 Figure 4. Suppressive mechanisms of regulatory T cells 8 Figure 5: The TNF/TNFR superfamily 12 Figure 6: Structural organization of the TNF/TNFR family members 15 Figure 7: Primary FADD-dependent DD signaling complexes 18 Figure 8: TRADD-dependent DD signaling complex 18 Figure 9: Present and future therapeutics based on members of the TNF superfamily and their receptors 28 Figure 10: Diagram of TL1A 34 Figure 11: Schematic diagram of TL1A-Ig-pBMGSneo cloning strategy 40 Figure 12: Construction and expression of TL1A-Ig fusion proteins 41 Figure 13: Selection of the highest TL1A-Ig producing cell clone 42 Figure 14: TL1A-Ig exists as a higher molecular weight protein in supernatant 43 Figure 15: Construction of the TL1A-Ig-pVitro plasmid 44 Figure 16: Characterization of purified TL1A-Ig by SDS-PAGE and western blot analysis 46 Figure 17: Characterization of purified TL1A-Ig Prep 1 by gel filtration and SDS-PAGE analysis Figure 18: 47 Characterization of purified TL1A-Ig Prep 2 by gel filtration and SDS-PAGE analysis Figure 19: 47 Characterization of purified TL1A-Ig Prep 3 by gel filtration and SDS-PAGE analysis Figure 20: 48 Characterization of purified TL1A-Ig Prep 4 by gel filtration and SDS-PAGE analysis Figure 21: 49 Characterization of purified TL1A-Ig Prep 5 by gel filtration and SDS-PAGE analysis 49 viii Figure 22: TL1A-Ig and 4C12 bind to their receptor, TNFRSF25, expressed on P815 cells 50 Figure 23: TL1A-Ig induces apoptosis in TNFRSF25 expressing P815 cells 51 Figure 24: TL1A-Ig binds to and stimulates endogenous TNFRSF25 on activated T cells 52 Figure 25: TL1A-Ig induces proliferation and induction of iTregs 53 Figure 26: MHCII antibody does not abrogate TL1A-Ig mediated Treg proliferation 54 Figure 27: Treg cells maintain residual TCR signaling from self-peptide recognition in vivo 55 Figure 28: Half-lives of 4C12 and TL1A-Ig are 13.5 hrs and 4 days 55 Figure 29: TL1A-Ig mediates rapid proliferation of CD4+FoxP3+ Treg cells in vivo 56 Figure 30: TNFRSF25 mediated Treg expansion is dependent on MHC Class II 57 Figure 31: Daily injections of TL1A-Ig lead to sustained Treg expansion in vivo for over 20 days 58 Figure 32: H&E staining of tissue sections from mice injected daily with TL1A-Ig 59 Figure 33. Characterization of T cell subsets in TL1A-Ig treated mice 60 Figure 34. TL1A-Ig treatment increases expression of memory markers on Tconvs 61 Figure 35. TL1A-Ig treatment leads to Treg expansion in vivo by inducing proliferation of CD25hi and CD25int Tregs 63 Figure 36. TL1A-Ig treatment enhanced activation and memory formation of Treg cells 64 Figure 37. Suppressive activity of in vivo expanded Treg 65 Figure 38. Antibiotics treatment results in ceca dilation 66 Figure 39. Antibiotics treatment does not abrogate TL1A-Ig mediated proliferation and activation of memory T cells Figure 40. 67 Antibiotics treatment does not abrogate TL1A-Ig mediated Treg activation and formation of memory Tregs 68 Figure 41. TL1A-Ig does not abrogate the induction of Tregs in vivo 69 Figure 42. Therapeutic protocol for the acute model of allergic lung inflammation 70 Figure 43. TL1A-Ig mediated Treg expansion in the peripheral blood, lungs and spleens 71 Figure 44. TL1A-Ig treatment reduces eosinophils in the BALF 72 ix Figure 45. TL1A-Ig treatment reduces lymphocyte infiltration and airway mucus secretion in the lungs 73 Figure 46. TNFRSF25 agonists prolong allogeneic skin grafts 74 Figure 47. Protocol for TL1A-Ig and gp96-Ig vaccine treatment for OTI cell expansion Figure 48. TL1A-Ig boosts clonal expansion of CD8+ T cells and Tregs when combined with gp96-Ig vaccine Figure 49. 102 TNFRSF25 agonist TL1A-Ig does not enhance gp96-Ig mediated rejection of established tumors 101 103 x List of Tables Table 1. Cellular expression of some TNF ligands and receptors Table 2. Leukocyte subsets with similar frequencies in IgG-treated 13 and TL1A-Ig-treated mice 61 Table 3. TL1A-Ig decreases Tconv:Treg ratio and (TCM +TEM):Treg ratio 62 Table 4. Summary of comparative studies of 4C12 and TL1A-Ig 78 xi CHAPTER 1: Introduction 1.1 The immune system: innate and adaptive arms The immune system consists of molecules and cells that work together to protect the individual from microbial infection and maintain homeostasis. The immune system is comprised of the innate and adaptive immune responses. Together these responses fulfill four crucial tasks: immunological recognition (the detection of an infection), containment and elimination of infection, immune regulation (keeping the immune response under control so that there is no damage to the body leading to conditions of allergy and autoimmune disease), and generation of immunological memory that protects the individual from recurring disease due to the same pathogen. The earlier evolved innate immune system, found in all plants and animals, provides a non-specific immediate defense response to infection that develops in hours---faster than adaptive responses. Microbes that overcome physical and chemical barriers first encounter toxic chemicals and powerful degradative enzymes produced by phagocytic innate cells such as macrophages, neutrophils, eosinophils, basophils, and natural killer (NK) cells. Innate dendritic cells engulf pathogens, process and present pathogen antigen to T lymphocytes leading to the initial activation of the adaptive immune response. The adaptive immune system, although overlapping with the innate immune response, requires days to develop since this depends on the formation and proliferation of antigen specific clones of B and T lymphocytes that recognize and respond to individual antigens by means of highly specialized antigen receptors. The activated lymphocytes produced in the initial adaptive response provide the vertebrate immune system with the ability to “remember” specific pathogens (immunological memory) and 1 2 subsequently mount an immune response that is faster and greater in magnitude. Adaptive immunity includes antibodies that provide humoral immunity and T cells that provide cellular immunity, both of which complement each other. All cellular components of the innate and adaptive immune system derive from the hematopoietic stem cells of the bone marrow. B cells mature in the bone marrow, while T cell progenitors migrate to the thymus and mature there. Lymphocytes circulate in the blood and lymphatic system and are found in primary lymphoid organs, the bone marrow and thymus, and peripheral secondary lymphoid organs including spleen, lymph nodes, and the mucosal lymphoid tissues found in the gut, nasal, respiratory and urogenital tracts and other mucosa. Ligation to antigen causes B cells to proliferate and differentiate into effector plasma cells that produce antibodies, while T cells recognize antigen presented by APCs activate and differentiate into one of the effector cell subsets involved in killing (cytotoxic T cells), activation (helper T cells that activate B cells to produce antibody and to undergo class switching and affinity maturation, and regulate other lymphocytes), or regulation (regulatory T cells that suppress other lymphocyte activity and help control immune responses). Some of the antigen-activated B and T cells formed during an immune response also differentiate into memory cells that are responsible for the “adaptive” long-lasting immunity (1). 3 1.2 Subsets of T lymphocytes Figure 1: T cell lineages and subsets (adapted from (2)) Figure 2: APCs deliver 3 kinds of signals (adapted from (1)) After maturation, naïve T lymphocytes emerge out of the thymus and are composed of two main classes that are distinguished by the mutually exclusive expression of cell-surface co-receptor proteins CD4 or CD8 (Figure 1) (2). Thymic T cells are also defined by the expression of a T cell receptor (TCR), αβ or γδ (depending on the TCR chains present), which is responsible for recognizing antigens presented by the products of major histocompatibility gene complex (MHC) family. αβ T cells are classically divided either into CD4+ T helper (Th) cells or CD8+ cytotoxic lymphocytes (CTL) that recognize peptides presented by MHC class II or MHC class I on antigen presenting cells (APCs), respectively. APCs deliver 3 kinds of signals for clonal expansion and differentiation of naïve T cells (Figure 2) (1). Signal 1 enables T cell 4 activation and includes antigen specific signals derived from the ligation of a specific antigen-MHC molecule. The clonal expansion of antigen-specific T cells is provided by costimulatory signals (signal 2) that are primarily involved in promoting or inhibiting the survival and expansion of the T cells and belong to the B7 family (i.e CD28). CD28dependent costimulation of activated T cells induces expression and production of IL-2 and the higher affinity IL-2 surface receptor CD25. Other signal 2 molecules belong to the tumor necrosis factor (TNF) receptor superfamily. Finally, cytokines, including members of the TNF superfamily, provide signal 3 that is one determining factor for the subtype of effector T cell generated. The milieu of cytokines in the microenvironment and the subsequent activation of specific transcription factors are the two main factors determining the final effector T cell fate (3). Some of the T-cell populations emerging out of the thymus are distinct lineages of cells such as “natural” regulatory T cells (nTreg), natural killer T cells (NKT cells), and γδ T cells (Figure 1). More “innate-like” T cells subsets, NKT and γδ T cells can be activated by cytokines or TCR stimulation. NKT cells have an αβ TCR and recognize antigen in the context of a CD1d, a non-classical MHC I molecule, while γδ T cells are not MHC restricted although they are capable of generating more unique antigen receptors than αβ T cells and B cells combined (4). The latter’s ability to recognize soluble protein and non-protein antigens of endogenous and exogenous origins also distinguishes them from αβ T cells (4). Naive CD4+ αβ T cells can differentiate into four different lineage of effector T cells after their initial activation by antigen: Th1, Th2, Th17 or induced regulatory T cell (iTreg) (Figure 3) (5). The heterogeneity of CD4+ T cells enables an optimized immune response according to the nature of the infection. 5 Figure 3: Summary of the 4 CD4 T helper cell fates: their functions, their unique products, their characteristic transcription factors, and cytokines critical for their fate determination. (adapted from (5)). Th1 cells provide immunity against intracellular pathogens including mycobacteria and can induce some autoimmune and inflammatory diseases. The principle cytokines produced by Th1 cells are IFN-γ, lymphotoxin α (LTα), and IL-2. High levels of IFN-γ production by Th1 cells is important in enhancing the microbicidal activity of phagocytes that mediate pathogenic clearance. In addition, Th1 cells also facilitate the production of opsonizing and complement fixing antibodies including IgG2a antibodies in mice, and IgM, IgA, IgG1 and IgG3 antibodies in humans (3). Although generally overlooked, the humoral response promoted by Th1 cells plays an important role in protection against intracellular pathogens. Collaboration between interferons and IL-12, produced by Toll-like receptor (TLR) activated dendritic cells that recently encountered microbes, are potent inducers of Th1 polarization. IFN-γ and IL-12 activate the signal transducer and activator of transcription (STAT-1), resulting in the upregulation of T-box expressed in T cells (T-bet), which is the master regulator of Th1 cells. T-bet in turn induces early T-cell IFN-γ production and upregulates IL-12Rβ2 6 expression, which renders Th1 cells more hyperresponsive to IL-12, resulting in a positive feedback production of IFN-γ through STAT-4 activation. STAT-4 causes upregulation of IL-18Rα. IL-18 and IL-12 synergize in inducing more IFN-γ, showing that IL-18 is crucial in Th1 responses but not required for Th1 differentiation. Together IFN-γ and IL-12 fully differentiate Th1 cells (3, 5). Interestingly, to block differentiation toward alternative effector pathways, T-bet also interacts with several other T helper cell lineage-defining transcription factors (6-9). Th2 cells help B cells mediate host defense against extracellular parasitic infections such as helminthes and extracellular bacteria and this population is implicated in the induction and persistence of asthma and allergic diseases. Cytokines produced by Th2 cells are involved in IgE class switching in B cells (IL-4 and IL-13), recruitment of eosinophils (IL-5), activation of mast cells and lymphocytes and production of mucus by epithelial cells (IL-9), suppression of Th1 cell proliferation and dendritic cell function (IL-10), and expulsion of helminthes and induction of airway hypersensitivity (IL-13) (3, 5). Th2 cells induce IgG1 and IgE antibodies in mice and IgM, IgG4 and IgE in humans. IgE antibody binds and crosslinks FcεRI receptors of basophils and mast cells resulting in the secretion of active molecules including serotonin and histamine and the production of several cytokines and chemokines including IL-4, IL-13, TNF-α, RANTES and eotaxins (3, 5). Th2 cells also produce IL-25 that serves both as an activation and amplification factor for Th2 responses. IL-4, the positive feedback cytokine of Th2 cell differentiation, activates STAT-6, which is the major signal transducer in IL-4 mediated Th2 differentiation. STAT-6 activation in turn is necessary and sufficient for inducing high expression levels of the Th2 master regulator gene, GATA-3, which serves as a positive 7 feedback loop to produce more IL-4 in collaboration with IL-2 induced activation of STAT-5 (3, 5). Together, GATA-3 and STAT-5 have been shown to fully differentiate Th2 cells in vitro (10). A more recently characterized subset includes Th17 cells that mediate host immune responses against extracellular bacteria and fungi and are pathogenic in induction of organ-specific autoimmune diseases. Th17 cells produce several cytokines including IL-17a, IL-17f, IL-21 and IL-22. Studies show that many organ-specific diseases that were previously attributed to Th1 cells were indeed caused by Th17 cells that are responsive to IL-23, which shares a subunit (p40) and a chain of its receptor (IL12Rβ1) with IL-12 (3). IL-17a can induce several pro-inflammatory cytokines, including IL-6, and chemokines such as IL-8 to induce inflammatory responses. Transforming growth factor-β (TGF-β) is required for initiation, while IL-6 is a critical cofactor for Th17 differentiation. IL17a and IL17f recruit and activate neutrophils. IL-21 is a stimulatory factor for Th17 differentiation, a positive feedback amplifier, and can replace IL-6 in inducing transcription factor retinoic acid-related orphan receptor (RORγt), which in turns mediates IL-17 production. RORα, STAT-3 (a major inducer of IL-6, IL-21 and IL-23) and IRF4 have been found to contribute to Th17 cell differentiation (3, 5, 11). Regulatory T cells play a vital role in preventing the development of autoimmune diseases, maintaining self-tolerance, and regulating the development and intensity of immune responses to foreign antigens, including allergens (12). Tregs rely on several mechanisms including cytokine production, cytolysis, IL-2 consumption, and reduction of costimulation and antigen presentation, to suppress the functions of a full array of cell types including CD4+ Th cells, CD8+ cytotoxic T lymphocyte (CTL) granule release, B- 8 cell antibody production and affinity maturation, and APC function and maturation(13, 14) (Figure 4). Figure 4: Suppressive mechanisms of regulatory T cells (adapted from (13)) Tregs secrete suppressive cytokines including transforming growth factor-β (TGF-β), IL10 and IL-35. TGF-β is necessary for the survival of nTregs in the periphery and it also maintains peripheral tolerance by inhibiting proliferation and differentiation of selfreactive CD4 and CD8 T cells. Mechanistically, it appears that membrane bound TGF-β on Tregs, in combination with CTLA-4 and CD80, interacts with TGF-β receptor on effector T cells that causes a block in the upregulation of IL-2 receptor and therefore their inability to respond to IL-2 required for survival (15). In combination with IL-2 and retinoic acid (RA), TGF-β promotes the differentiation of naïve CD4+ T cells into iTregs in the periphery. IL-10 downregulates IL-12 production and co-stimulatory molecules in macrophages, thereby reducing the generation of Th1 type CD4+ T cells (16). IL-35 has been reported to suppress immune responses by expanding Treg cells, inhibiting proliferation of CD4+CD25- effector cells and differentiation of Th17 cells (17). The 9 expression of Galectin-1 by Treg cells also causes cell cycle arrest, apoptosis, and inhibition of production of proinflammatory cytokines by target cells. Treg cells can be lytic for activated CD4+ T cells, CD8+ T cells and NK cells by mechanisms that are dependent on perforin, granzyme A, granzyme B, or a combination of these factors (18). Since a large population of thymic derived Treg expresses CD25, the receptor for IL-2, studies have suggested that Tregs may compete with FoxP3- T cells for IL-2 and inhibit the differentiation and proliferation of FoxP3- T cells, resulting in apoptosis that is dependent on proapoptotic factor Bim. Tregs can condition dendritic cells to secrete immunosuppressive molecule indoleamin 2,3 dioxygenese (IDO) and downregulate costimulatory molecules, including CD80 and CD86, and MHC-II on the cell surface— factors that that suppress activation of effector T cells. Tregs also use the catalytic inactivation of ATP (an indicator of tissue destruction that upregulates CD86 on DCs) by expressing CD39 and/or CD73 to produce adenosine and to hinder upregulation of costimulatory molecules and maturation of DCs. A combination of these suppressive mechanisms, in combination with homeostatic proliferation of Tregs, leads to the regulation of effector T (Teff) cells during an immune response. Indeed, studies indicate that during a primary immune response to foreign antigen, the expansion and contraction of Treg cells was equal to that of Teff, while the relative accumulation of Treg at the peak of the response was greater than Teff, reflecting extensive proliferation of Treg in the cell pool (19). Although proliferating polyclonal nTregs may provide bystander suppression (19), studies also indicate accumulation of more potent antigen-specific iTregs that have the ability to attenuate effector responses in an antigen-dependent manner (20). 10 Both thymic nTreg and peripheral iTreg differentiation require TCR signaling that results in the upregulation of CD25 on the cell surface, making the precursor cells more receptive to IL-2 signaling in the microenvironment. IL-2 signaling leads to the activation of transcription factor STAT-5. Additionally, CD28 signaling, via ligation to CD80 and CD86, leads to the induction of the key Treg transcription factor, FoxP3 in the thymus. FoxP3, an invaluable marker for Treg, is required for their differentiation, maintenance and suppressive function (21, 22). These signaling pathways lead to the recruitment of several transcription factors including NFAT, cRel, Creb and STAT-5 to the FoxP3 promoter that induces its expression. Although TGF-β is important for the differentiation of iTreg, it is also important for nTreg development (23). In the absence of proinflammatory cytokines and presence of IL-6, TGF-β induces iTreg differentiation from CD4+ T conventional cells (Tconv) by activating Smad-3. Concurrent TCR signaling induces NFAT activation, and together Smad-3 and NFAT collaborate to promote FoxP3 expression. As is the case for nTregs, TGF-β and IL-2-mediated STAT-5 activation is also required for iTregs survival and function after differentiation (5). CD8+ T cells are a crucial part of the adaptive immune system since they have the intrinsic capability to respond to low levels of peptide-MHC I molecules and mediate direct killing of antigen-presenting and MHC I positive cells. They mediate host immune response against intracellular pathogens (viruses) and tumor cells. Like CD4+ T cells, naïve CD8+ T cells require detection of peptide-MHC I on APCs and costimulation signals provided by CD28-CD86 interaction in the presence of cytokines that leads to the activation, proliferation and differentiation of naïve CD8 cells into cytotoxic T lymphocytes (CTL) (24). The differentiation of CD8 cells parallels that of their CD4 T 11 cell counterparts. For example, IL-12 induces T-bet expression leading to Tc1 differentiation, while GATA-3 is induced by IL-4 for Tc2 differentiation (25). More recently it has been shown that the IL-17 producing subset of CD8 T cells displays a suppressed cytotoxic function along with low levels of the CTL markers and undergoes a similar differentiation program as Th17 cells (26). Differentiated effector CD8 T cells utilize different mechanisms, including cytotoxic and non-cytotoxic, to attack their target cells. These methods include the use of cytotoxic molecules such as perforin and granzyme mediated direct contact-dependent cytolysis (27), expression of TNF member Fas ligand (CD95L) that induces apoptosis in a Fas-FasL dependent manner (27) and immediate release of pro-inflammatory cytokines such as IFN-γ and TNF-α to sustain local inflammation that attracts other immune cells (28). Recent studies have assigned an additional duty to effector CD8 T cells which includes a regulatory role in preventing excessive tissue injury by secretion of IL-10, which is an immunosuppressive cytokine produced by multiple cell types including CD4+ Treg cells (29-31). Fully differentiated CD8 T cells produce high levels of IL-10 at infection sites in different viral infection models (29-31). At the peak of the viral immune response, IL-10 produced by CD8 cells is found mostly in peripheral sites, while CD4+ T cells derived IL-10 dominates in secondary lymphoid organs (29-31). IL-10+CD8+ T cells quickly diminish after the viral infection is cleared, while IL-10+CD4+ T cells remain, suggesting differences between the mechanisms that regulate IL-10 produced in CD8+ and CD4+ T cells (32). CD8+ T cells derived IL-10 prevents bystander tissue damage during viral immune response but does not interfere with viral clearance. erfamily. The in blue and h their recepTNFR superhe appropriate ns within the d as red cylinTRAF adaptors 12 1.3 TNF superfamily members More than a century ago, German physician P Burns reported tumor regression in patients after a bacterial infection. Later studies identified molecular factors released by lymphocytes and macrophages during infections that caused the cytolysis of several cell types, but more importantly tumor cells. Lymphotoxin (LT) and tumor necrosis factor (TNF) were identified as these products that were able to lyse several cell types, most importantly tumorThe cellsintriguing (33, 34). Identification of the the protein sequence revealed that LT biology of TNF/TNFR superfamily and TNF exhibited 50% OX40L aminoGITRL acid sequence and bound to the?same?receptor. CD30L CD40L 4-1BBL BAFF CD27L RANKL homology APRIL TWEAK Moreover, the cDNA cloning and sequence homology analysis revealed that these two cytokines are the prototypic members of a gene superfamily that regulates essential biological functions in mammals and most importantly immune responses at different CD27 CD30 CD40 4-1BB levels (35, 36). CD95L TL1A OX40 GITR OPG TRAIL RANK BAFFR TACI BCMA Fn14 EDA TNF LTα LTαβ TROY RELT LIGHT BTLA The intriguing biology of the TNF/TNFR superfamily CD95 DcR3 DR3 DR4 DR5 DcR1 DcR2 OPG CD27L CD30L CD40L 4-1BBL OX40L GITRL EDAR XEDAR TNFR1 TNFR2 LTβR HVEM DcR3 RANKL BAFF APRIL TWEAK ? ? Further mechanisms to control the induction of apopurn can associate with TNFRtosis mediated by TNFR family members is achieved by TRAF1 and receptor interacttargeting downstream caspases.32 Expression of inhibitors tivate the nuclear factor-jB of apoptosis (IAPs) like IAP-1, IAP-2 and X-linked X-IAP inal kinase (JNK) pathways, specifically inactivate effector caspases33,34 and are uppoptosis.22,23 Mice with a genunable to activate NF-jB in regulated in an NF-jB-dependant manner.35 TheOX40 second group of BAFFR receptors, including TNFRII, ation leading to TNF CD27 induced RELT CD30 CD40 4-1BB GITR OPG RANK TACI BCMA Fn14 TROY ncy in turn led to the inability CD27, CD 30, CD40, LTbR, OX40, 4-1BB, BAFFR, B-cell Figure 5: The TNF/TNFR superfamily. The (BCMA), TNF-related ligands are shown in blue arrows y in response to TNF.25 Therematuration antigen receptor activator ofand NF-jB CD95Linteractions TL1A TRAIL EDA TNF LIGHT BTLA LTα LTαβ are indicate with their receptors. The ectodomains of the TNFR superfamily shown in erfamily. The s to signalling complexes that (RANK), transmembrane activator and calcium-signal grey with the appropriate number of cysteine rich domains (CRDs). Death domains within the in blue and caspase cascade and cytoplasmic the NF- domain modulating cyclophilin ligandfrom (CAML) interactor (TACI), are indicated as red cylinders (adapted (37)). h pathways their recep-(Fig. 2a). This balFn14, herpes virus entry mediator (HVEM), activation TNFR superous levels including regulation induced TNF-receptor (AITR), X-linked EDA-A2 recephe appropriate ion, soluble decoy receptor tor (XEDAR) and the member of the TNFR family ns within the ic ligand induction.26 (TROY) contain TNF-receptor associated factor (TRAF)d as red cylinpendent activation of some interacting motifs (TIMs) in their cytoplasmic domain RAF adaptors TNFR family members the (Fig. 1). Activation of TIM TNFR CD95 DcR3 DR3 DR4 DR5 DcR1 DcR2 OPG EDAR XEDAR containing TNFR1 TNFR2 LTβR HVEMfamily DcR3 SODD) proteins associate conmembers leads to the recruitment of TRAF family DR3 but not to other death members and the subsequent activation of signal trans- 13 Today, a total of 19 ligands in TNF superfamily family have been identified along with 29 interacting receptors (37-39)(Figure 5). 1.3.1 Expression, structure, and signaling of TNFSF members The cell expression patterns of TNF ligands/receptors are well characterized (Table 1)(40). Cells of the immune system including B cells, T cells and dendritic cells primarily express both ligands and receptors. TNFRs are usually expressed by activated T cells while their ligands are induced or upregulated on APCs after immune activation. Receptor Cells Ligand Cells CD27 (TNFRSF7) CD4+ and CD8+ T cells B cells (subset) NK cells (subset) FOXP3+ Treg cells NKT cells Hematopoietic progenitors CD70 (TNFSF7) APCs (DCs and B cells) CD4+ and CD8+ T cells Mast cells NK cells Smooth muscle Thymic epithelium DR3 (TNFRSF25) CD4+ and CD8+ T cells NK cells NKT cells FOXP3+ Treg cells LTi cells TL1A (TNFSF15) APCs (DCs, B cells, macrophages) CD4+ and CD8+ T cells Endothelial cells OX40 (CD134 and TNFRSF4) CD4+ and CD8+ T cells NK cells NKT cells FOXP3+ Treg cells Neutrophils OX40L (CD252 and TNFSF4) APCs (DCs, B cells, macrophages) CD4+ and CD8+ T cells LTi cells NK cells Mast cells Endothelial cells Smooth muscle 4-1BB (CD137 and TNFRSF9) CD4+ and CD8+ T cells NK cells NKT cells Mast cells Neutrophils FOXP3+ Treg cells DCs Endothelial cells Eosinophils Osteoclast precursors 4-1BBL (TNFSF9) APCs (DCs, B cells, macrophages) CD4+ and CD8+ T cells Mast cells NK cells Smooth muscle Hematopoietic progenitors Osteoclast precursors CD30 (TNFRSF8) CD4+ and CD8+ T cells B cells NK cells Macrophages Eosinophils CD30L (CD153 and TNFSF8) T cells B cells Mast cells Monocytes Neutrophils Eosinophils CD40 (TNFRSF5) Basophils, APCs (DCs, B cells, Macrophages) Epithelial cells Endothelial cells Smooth muscle cells Fibroblasts CD40L (CD154 and TNFSF5) CD4+ and CD8+ T cells B cells Eosinophils Mast cells Monocytes Macrophages NK cells Endothelial cells Smooth muscle cells Epithelial cells Table 1: Cellular expression of some TNF ligands and receptors (adapted from ((40)) 14 This indicates that antigen recognition by the T cells results in the interaction and the bidirectional activity of the ligand/receptor pair, which in turn promotes the effector responses of T cells and other immune cells. These responses can be enhanced by TNF ligand molecules upregulated on non-immune cells, adding to the effector function and inflammatory response that may lead to tissue inflammation in the disease context (38). For example, CD27, OX40, 4-1BB, and TNFRSF25 expression is either induced or upregulated within 24 hours following the antigen mediated activation of naïve T cells, and more rapidly by memory T cells. Their respective ligands CD70, OX40L, 4-1BBL and TL1A are induced on APCs. Macrophages and dendritic cells display increased TL1A after stimulation with TLR ligands and Fc receptor cross-linking (41, 42). TL1A up-regulation is also reported on endothelial cells after stimulation with inflammatory cytokines such as IL-1 and TNF. Furthermore, both CD4+ and CD8+ T cells can also express both TNF receptors and ligands, which suggests that T-cell interaction amongst themselves can also influence T cell populations. The majority of the TNF ligands are type II transmembrane proteins (intracellular N-terminus and extracellular C-terminus) that are biologically active as non-covalently bound self-assembling homotrimers, whose individual chains fold as compact “jellyroll” β sandwiches and interact at hydrophobic interfaces (43-45) (Figure 6). Some of these ligands, like TL1A, are functional as a transmembrane protein and as a soluble form cleaved off from the cell membrane by proteolytic cleavage by metalloproteinases. Other ligands, such as LTα and APRIL, are secreted only as soluble molecules but can be recruited to the cell membrane to form surface anchored trimeric molecules that contribute to regulatory specificity and complexity (46). 15 Figure 6: Structural organization of the co-stimulatory TNF/TNFR family members. TNF ligands are shown as homotrimeric type II transmembrane proteins, while TNF receptors are depicted as type I transmembrane monomers that are thought to associate in trimers when interacting with their ligands. The total amino-acid length and number of intracellular amino acids (parentheses) are also indicated (adapted from (45)). TNF ligands are characterized by the presence of a 150 amino acid long conserved C-terminus TNF homology domain (THD) containing a framework of aromatic and hydrophobic residues (Figure 6). The THD is responsible for the trimerization and binding of the ligand to the receptor. Although 20-30% amino acid with sequence homology in their interacting protein interfaces account for the trimeric assembly of the ligands, very little similarity in the sequence of the external surfaces of the ligand trimers leads to individual receptor specificity (43, 47). Some of the ligands can bind more than one receptor with high affinity. Why nature chose these molecules to be trimeric is unclear. One explanation would be that trimers require more contact sites than dimers, allowing them to bind with higher avidity (combined strength of multiple 16 bonds) to receptors (48). Elongated receptor chains interact with all the three sides of the inverted bell shaped ligand, hence creating a 3:3 symmetric complex. When the ligand ligates to the receptor, the intracellular cytoplasmic tails forms a 3:3 internal complex with signaling proteins such as TRAF2 and FADD (explained in detail in this section), resulting in an overall protein complex with a 3-fold symmetry (48). The TNF receptors are primarily type I transmembrane proteins (intracellular Cterminus and extracellular N-terminus), while there are exceptions including BCMA, TACI, BAFFR and XEDAR that are type III transmembrane proteins and lack a signal peptide (49). Some TNFRs can be secreted as soluble proteins due to proteolytic processing (e.g. CD27, CD30, TNFR1, TNFRSF25), alternative splicing of the exon encoding the transmembrane domain (e.g. Fas and 4-1BB) or merely because they lack a membrane-interacting domain sequence in the encoding gene (e.g. Decoy-R3; Decoy TNFRSF25). The extracellular domains of TNF receptors are characterized by the presence of cysteine-rich domain (CRD) (Figure 6), which are 40 pseudorepeats typically containing 1-6 cysteine residues interacting to form disulfide bonds (50). TNFRs can have significantly varying numbers of CRD, from B-cell activating factor receptor (BAFFR) with only 1 partial CRD, to TNFR1 and TNFRII which contain the typical 3 CRD and up to 6 CRDs found in CD30 (37). The elongated chains of the receptor fit into the grooves between the monomers of the trimeric ligand, suggesting that the trimeric ligand cross-links the three receptor monomers into the 3:3 stoichiometry. This school of thought contradicts more recent studies that report TNFR pre-assembly without the requirement of binding to trimeric ligand and signaling requires the rearrangement of preassembled receptors (51, 52). Additionally, trimerization of some 17 members of the TNF receptor superfamily, such as Fas, TNFR II and TRAIL receptors is not sufficient to trigger a response hence higher oligomerization is required (53-55), while trimerization of TNFR1 and Tweak receptors is enough to mediate signaling (53, 55). Higher oligomeric complexes of CD40L form molecular clusters when interacting with the receptor, resulting in more effective signaling as compared to single trimeric unit (56). TNF ligand mediated TNF receptor activation can lead to the recruitment of several different intracellular adaptor proteins, which in turn activate several signal transduction pathways. TNFR family members are categorized into three groups based on the their intracellular sequences. The first group (e.g Fas TNFRI, TNFRSF25) contains an intracellular death domain (DD), a 45 amino acid long sequence. Activation of DD leads to the recruitment of intracellular adaptors including Fas-associated death domain (FADD) (57)(Figure 7) and TNFR-associated death domain (TRADD) (Figure 8) that can lead to caspase dependent apoptosis or nuclear factor (NF)κB dependent survival. Ligation of TNF receptors CD95, DR4, and DR5 on type 1 cells (Figure 7), including thymocytes, drives intracellular DD clustering and binding of the DD to FADD, which recruits caspase-8 and caspase-10, to form the death-inducing signaling complex (DISC). The DISC mediates the autocatalytic processing of the caspases and releases them in the cytoplasm to recruit effector caspases 3,6, and 7, which in turn cleave cellular substrates leading to apoptotic cell death (58, 59). Apoptosis in type II cells (B cells) requires caspase 8 to process Bid, which engages a cell- intrinsic mitochondrial pathway (60) (Figure 7). 18 FADD: CD95, DR4, DR5 TRADD: TNFR1 and TNFRSF25 Figure 8: TRADD-dependent DD signaling complex (adapted from (61)). Figure 7: Primary FADDdependent DD signaling complexes (adapted from (57)). Interestingly, some TNF receptor signaling, including TNFRSF25 and TNFR1, are capable of activating two pathways simultaneously which leads to induction of apoptosis and activation of NF-κB (Figure 8)(61). The DD binds to TRADD, which provides a scaffold for the binding of RIP1, TRAF2 (or TRAF5) and c-IAP 1 and 2 creating “complex 1” (62-64). This structure has the ability to activate the NFκB and jun N-terminal kinase (JNK) and p38 pathways. Activation and translocation of NFκB to the nucleus induces transcription of genes encoding proinflamatory cytokines and chemokines as well as anti-apoptotic proteins including c-FLIP and c-IAP (65). Activation of JNK and p38 pathways stimulates genes that regulate proliferation, differentiation, inflammation or apoptosis. TNFR1 ligation leads to receptor internalization and conformation changes of RIP1 and TRAF2 that allow TRADD to recruit FADD to make complex II (66, 67). RIP1 associates with FADD to activate 19 caspase-8 and trigger apoptosis downstream of TNFR1. Anti-apoptotic molecules like cFLIP and c-IAP that emanate from complex-1 signaling negatively regulate this pathway. The second group of TNF receptors (e.g TNFR2, CD40, CD30, CD27) lacks the DD and have one or more TRAF-interacting motifs (TIMS) in their cytoplasmic domain. CD40 and TNFR2 are the most well-characterized members of this group in terms of the their association and functional relationships with TRAFs. Ligation of CD40 by multimeric CD40L results in the redistribution of CD40 to membrane lipid rafts and conformational changes recruiting TRAFs to at least two binding sites on the cytoplasmic domain of CD40. TRAFs then recruit several other TRAF-interacting kinases and together activate several signal transduction pathways such as NF-κB, JNK, p38, extracellular signal-related kinase (ERK) and phoshoinositide 3-kinase (PI3K) (68, 69). For example, TRAF-2 interacts with germinal center kinase in B cells and contributes to CD40-induced c-Jun-NH2-kinase activation and cell proliferation. Moreover, some CD40-TRAF interactions also have been reported to be inhibitory (70). CD40 signaling targets several genes that regulate apoptosis, cell cycle progression, cytokine production, expression of cell surface immune modulators, and other TNF family members and other pathways. Extracellular secondary signals also cooperate with CD40 signaling introducing overlapping responses or triggering others. CD40 can also activate kinases, signal transducers, and activators of transcription pathway via TRAF-independent mechanisms. The third group of TNF receptors includes TRAIL-R3, TRAIL-R4, decoy-R3 (decoy TNFRSF25) and osteoprotegerin (OPG) none of which contain functional intracellular signaling domains. Instead, these molecules compete with the other 2 20 signaling groups of receptors for their ligand and function by hindering the activation of signal transduction pathways by other TNF receptors (68). The functional modularity of TNF receptors, which depends on several intracellular molecules activating various interconnected signaling pathways downstream, allows these proteins to modulate various aspects of the immune system, including morphogenesis and maintenance of lymphoid structure, lymphocyte homeostasis, innate and adaptive immunity and immune surveillance. 1.3.2 Multiple functions of TNF superfamily members Signaling through TNF receptors via interaction with their respective ligands play various roles that include promoting cell activation, proliferation, survival, differentiation, and apoptosis, mediating protection against bacterial infection, and orchestrating the development of multicellular structures such as lymphoid organs, hair follicles, bones, mammary glands, as well as nonpermanent inflammatory foci during acute inflammation. Here we will discuss how the expression of TNF family members controls the immune system and inflammatory responses at different levels. 1.3.2.1 Development and maintenance of lymphoid structure The expression of TNF family members mediates crosstalk between cells and orchestrates the development of secondary lymphoid organs including lymph nodes and Peyer’s patches. These are areas of aggregated lymphocytes, antigen-presenting cells, and other immune-influencing cells positioned throughout the body with strategic vascular connections to gateways of foreign antigen entry. Interestingly, mice that are deficient in LTβR or LTβ(α1β2) do not develop lymph nodes, Peyer’s patches, and have defective spleens and humoral immunity (71). RANK and RANKL deficient mice also lack 21 peripheral and mesenteric lymph nodes but they develop Payer’s patches and their splenic structure is intact (72-74). Additionally, ectopic expression of LTα1β2 or LTα3, or B cell chemokines influenced by expression of LTα1β2 or LTα3 on B cells, stimulates vasculature adhesion molecules and generates ectopic lymphoid tissue creating plasticity in lymphoid organ boundaries (48, 75-77). Deficiency of LTβR or any of its receptors leads to the perivascular infiltration of B and T cells into multiple tissues (48, 78, 79). In summary, the expression of TNF members establishes spatial constraints required for lymphoid organ definition. 1.3.2.2 Protection against microbial infections The expression of TNF superfamily signaling and the ability to produce an appropriate Th1 type cytokine are both required for protection against microbial infections. Neutralizing TNF revealed that the host immune response against pathogens is severely impaired in the absence of TNF. Genetic deletion of TNFR1 in mice resulted in increased susceptibility to infections with intracellular bacteria such as Listeria monocytogenes, Mycobacterium tuberculosis, M. avium, and Salmonella. TNFR1deficient mice are incapable of hindering the replication of L. monocytogenes in phagocytes although other antimicrobial defense systems, including generation of oxygen radicals and reactive nitrogen intermediates are not defective in these mice (37, 80, 81). It is not surprising that anti-TNF therapies, including antibodies specific for TNF and soluble TNFRs, approved for treatment of Crohn’s disease and rheumatoid arthritis, increase the risk of development of diseases such as tuberculosis due to TNF’s important role in killing M. tuberculosis in macrophages. 22 1.3.2.3 Mediators of cell death The ability to induce cell death in different immune or non-immune cells is one of the unique properties that TNF family members have evolved with great adaptive value. Six of the DD containing TNF members, including TNFRSF25, have the ability to directly induce apoptosis by activating caspases, while non-DD containing TNFSF members have the capacity to modulate the response to DD or directly influence cell survival. For example, signaling through TNFR2 directly enhances TNFR1-induced T cell death while CD40 also augments CD95 mediated B cell death (82, 83). As mentioned earlier, signaling through CD95 on CD8+ T cells is a major calcium-independent mechanism of CTLs that results in cell-mediated cytotoxicity in response to infectious agents (84). Importantly, this mechanism is also vital in maintaining immune homeostasis by regulating the balance between different lymphocyte subsets in the limited space of lymphoid organs. Genetic deficiencies in CD95 mediated apoptosis in humans and mice leads to drastic loss of lymphocyte homeostasis and autoimmunity (85, 86), while dysregulation of TNF has also been associated with human systemic lupus erythematosus and other autoimmune diseases (48, 87). 1.3.2.4 TNF superfamily members in cellular responses TNF superfamily members can stimulate conventional T cells and antigen presenting cells, influence antibody production by B cells, mediate communication between CD4+ and CD8+ T cells, which can potentially amplify signals that are initiated by APCs and promote immune responses. The ligand/receptor duo can also facilitate interactions between T cells and NK cells, between NKT cells and APCS presenting lipid antigens, and between T cells and other immune cells or tissue cell. TNF superfamily 23 member interactions are also crucial during the clonal expansion/effector phases of primary and at least some secondary immune responses. 1.3.2.4.1 CD4+ and CD8+ T effector cells TNFSF receptor costimulation can simply decrease the activation threshold of TCR stimulated T cells, or can provide additional signals to promote cell division, augment cell survival, or induce effector function such as cytokine secretion or cytotoxicity. These effects can occur by TNF/TNFR directly acting on T cells or on APCs with which they interact. The studies of LIGHT-HVEM show that blocking LIGHT can inhibit T-cell proliferation and cytokine secretion in allogeneic mixed lymphocyte reactions (MLR). In vitro studies show that LIGHT-deficient splenocytes that respond to alloantigen have reduced production of Th1 and Th2 cytokines and weak generation of CD8+ CTL activity (88), while in vivo studies indicate that blocking LIGHT reduces the generation of alloreactive CTLs (89). Similarly, interruption of CD27-CD70 interaction decreases the cytokine production and proliferation response in the initial stages of T cell response (90-92). T cells that lack CD27 initially divide normally, but they proliferate slowly after initial activation. In vivo, CD27 deficient mice have reduced numbers of antigen specific CD4+ and CD8+ T cells in the peak of primary response (days 4-8), and fewer memory T cells develop over 3 or more weeks (93). Unlike CD27CD70, early proliferation is unimpaired in OX40 deficient naïve CD4+ T cell populations, but reduced proliferation and increased apoptotic death occurs 4-5 days after activation resulting in reduced long-term T cells (94). OX40L-OX40 has been extensively studied using transgenic mice overexpressing OX40L or with agonistic antibodies. The overexpression of OX40L on dendritic cells 24 (95) and T cells (96) results in the accumulation of antigen responding CD4+ T cells and autoimmune-like symptoms that are associated with pathogenic T cells. Mice treated with agonist antibody for OX40 after immunization results in the accumulation of a larger number of antigen specific CD4+ T cells and effector CD8+ CTLs in the primary response, followed by an increase in the number of memory T cells (97, 98). Similar observations have been made in transgenic systems overexpressing TL1A and with the use of agonistic antibody to TNFRSF25, which will be discussed in further detail. 1.3.2.4.2 Other immune cells Since TNF family members are upregulated by antigen driven lymphocytes during the priming phase, it is not surprising that these molecules play an important role in the T-cell and DC interaction. The general idea is that TNF ligands are expressed on activated T cells, while the paired receptor is highly expressed on DC that requires prestimulation through CD40 or through pattern recognition receptors (PPR). CD40L and LTαβ are highly induced on antigen specific CD4+ T cells that interact with antigen bearing DC in the context of infection or immunization. These TNF superfamily members enable DC to cross-present cognate antigen to CD8+ T cells, by signaling through CD40, which is highly upregulated on DCs, and LTβR that is constitutively expressed on DCs. Blocking of CD40-mediated signaling causes defects in CD8+ T cell clonal expansion, function, and memory(99), while defective LTβR on DCs results in reduced production of type 1 IFN production required for optimal CD8+ T cell priming(100). The interactions of TNF superfamily members also regulate the functions of other immune cells that enhance immune responses mediated by T cell counterparts. It has 25 been reported that OX40/OX40L, CD70/CD27, TNFRSF25/TL1A have the ability to either directly enhance NK effector functions of cytotoxic ability or cytokine production or indirectly mediate NK driven conventional T cell activation and differentiation (101105). For example, IFN-γ production by NKT cells induces upregulation of CD70 on dendritic cells that subsequently primes a Tconv response. Lei Fang et al. in Dr. Podack’s laboratory reported that signaling through TNFRSF25 is required to co-stimulate IL-13 production by glycosphingolipid-activated NKT cells. In vivo, antibody blockade of TL1A inhibits lung inflammation and production of Th2 cytokines such as IL-13, even when administered days after airway antigen exposure. To further support these results, in vivo blockade of TNFRSF25 by a dominant-negative (DN) transgene, DN TNFRSF25, results in resistance to lung inflammation in mice. Allergic lung inflammation-resistant, NKT-deficient mice become susceptible to disease when wild-type NKT cells are adoptively transferred, but not after transfer of DN TNFRSF25 transgenic NKT cells (106). Members of TNF superfamily also perform critical roles in peripheral B cell maturation, homeostasis, and antigen dependent proliferation and antibody production. The expression of CD27, CD70, and OX40L is induced on most B cells and can promote B cell proliferation and antibody production. CD40 promotes B cell survival, costimulation proliferation, enhances T-cell collaboration, and enables immunoglobulin class switch recombination (CSR) (107). Resting B cell constitutively express CD40 that is upregulated after interaction with CD40L on activated T cells in an antigen dependent manner. In the absence of CD40, germinal center formation is disrupted and antibody responses are largely limited to low affinity IgM produced in a T-cell independent 26 manner (108, 109). BAFF is the most critical soluble factor for peripheral B-cell maturation and survival. Genetic disruption of BAFF or BAFF-R results in a similar phenotype of a peripheral B cell block (110-112). The expression of OX40/OX40L, 41BB/41BBL and CD70 can be induced on mast cells. OX40L expression on mast cells has been shown to directly costimulate T-cell activation (113, 114) and 41BB signaling in mast cells increases the productions of proinflammatory meditators by Tconv (115). Stimulation through OX40 and 41BB on neutrophils has been reported to contribute to tissue inflammation by enhancing cell survival or the production of pro-inflammatory molecules (116). Interestingly, constitutive expression of TNFRSF25 has also been detected on a CD4+CD3- lymphoid tissue inducer cells (LTi) and signaling through TNFRSF25 upregulates OX40L on these cells. This mechanism has been described to further promote T cell responses and prolong survival of memory T cells (117, 118). 1.3.2.4.3 Regulatory T cells The triggering of different TNF receptors can influence the differentiation, function and costimulation proliferation capacity of the Treg population. Signaling triggered by OX40 and TNFRSF25 has been found to inhibit the development of FoxP3+ Treg cells that differentiate from naïve CD4+ T cells in the presence of TGF-β and RA (119-121). Furthermore, signaling through OX40, TNFRSF25, 4-1BB, and GITR also block the suppressive ability of Treg to inhibit the proliferation of Tconv cells (120-127). Several studies report that this phenomenon seems to be dependent either only on the direct effect of blocking Treg function or together with the indirect effect on Tconv making them resistant to Treg mediated suppression. Transgenic mice over-expressing 27 TL1A on dendritic cells or T cells have higher number of FoxP3+ Tregs despite the fact that TL1A suppresses generation of iTregs (128), while soluble TL1A induces the proliferation of Tregs in vitro (129). Given the overlap between either functional suppression or induction of Tregs between TNFRSF25 and these other TNFSF members, Dr. Schreiber et al. in our laboratory tested Treg expansion in vivo after stimulation of TNFRSF25, OX40, 4-1BB, GITR, or CD27 with agonists. In all cases, we used well-characterized agonistic monoclonal antibodies to the respective receptor to trigger specific signaling. These studies demonstrated that TNFRSF25 was unique among the TNFRSF members examined in its ability to selectively induce expansion of Tregs in naïve mice. Signaling through TNFR25 induced rapid and selective expansion of preexisting Tregs in vivo such that they became 30%-35% of all CD4+ T cells in the peripheral blood within 4 days of treatment. TNFRSF25-induced Treg proliferation was dependent upon TCR engagement with MHC class II, IL-2 receptor, and Akt signaling, but not upon costimulation by CD80 or CD86; it was unaffected by rapamycin. TNFRSF25-expanded Tregs remained highly suppressive ex vivo, and Tregs expanded by TNFRSF25 in vivo were protective against allergic lung inflammation, a mouse model for asthma, by reversing the ratio of effector T cells to Tregs in the lung, suppressing IL-13 and Th2 cytokine production, and blocking eosinophil exudation into bronchoalveolar fluid (130). 1.3.3 TNF superfamily members in disease and immunotherapy The TNF members regulate immune responses at different levels that modulate both the inflammatory and regulatory aspects of immunity. Hence, it is not surprising that homeostatic disruption of these molecules have been implicated in inflammatory and 28 autoimmune diseases and other diseases including heart failure, bone reabsorption, AIDS, Alzheimer’s disease, and other disorders, hence targeting these molecules may be extremely useful for clinical exploitation (Figure 9). Figure 9. Present and future therapeutics based on members of the TNF superfamily and their receptors (adapted from (39)) 1.3.3.1 TNF superfamily members in cancer, autoimmune and inflammatory diseases Although TNF was discovered as a cytokine that kills tumor cells, its now know that TNF mediates the proliferation, invasion and metastasis of tumor cells. Studies report that TNF is highly carcinogenic and mice deficient in TNF are resistant to skin carcinogenesis (131). CD30 expression is upregulated in various hematological malignancies, including Reed-Sternberg cells in Hodgkin's disease (HD), anaplastic large cell lymphoma (ALCL) and subsets of Non-Hodgkin's lymphomas (NHLs). Increased CD30L expression was also found on mast cells within HD tumors. In the autoimmune disease of rheumatoid arthritis (RA), elevated levels of the soluble form of CD30L were observed in patient synovial fluid together with increased levels of CD30 and CD30L in biopsies with evidence that these molecules contribute to 29 mast cell activation (132). Additionally, synovial CD30+ T cells produce large amounts of IFN-γ, Th2 cytokine IL-4, and inflammatory IL-10 suggesting that T cells may play a role in RA-induced inflammatory responses (133). Similarly, synovial fluids from RA patients also has increased numbers of OX40+ T cells and reduced incidence of collagen type II induced (CII) RA was correlated with decreased expression of OX40 on T cells in mice (134). APRIL and BLyS protein levels are also increased the serum and the synovial fluid of RA patients indicating that they might be produced locally at the sites of inflammation(135, 136). A recent study reported that APRIL is present in the highest levels in germinal-center-positive synovitis and is produced by CD83+ DCs. Blocking APRIL and BLyS was most effective in inhibiting germinal-center-positive synovitis and other forms of synovitis correlated with the presence of TACI+ T cells. Seyler et al. propose that APRIL and BLyS regulate both B and T cell function and may have both pro-and anti-inflammatory regulation in different forms of RA (137) In asthma, its has been reported that OX40 and OX40L are upregulated in the bronchial submucosa in mild asthmatics compared to healthy individuals (138), while CD30 expression on Th2 cells is also elevated in patients with allergic asthma (139). In patients with severe asthma, higher sputum LIGHT concentrations correlate with the most impaired lung function (140). Mutations in both ligands and receptors of TNF superfamily have been found in humans. For example, people diagnosed with autoimmune lymphoproliferative syndrome (LPS) have mutations in CD95 and CD95L resulting in increased risk of developing B and T cell lymphomas, similar to the phenotype in lprl or gld mice that also have mutations in CD95 or CD95L. Their risk of non-Hodgkin’s lymphoma and HD, is greater 30 than expected due to the defective lymphocyte apoptosis, implicating that CD95mediated apoptosis is important for preventing B and T cell lymphomas (141). From the studies of patient cohorts, genetic mutations in humans and mice and murine disease models, it is very clear that TNF superfamily members and their receptors have a wide-ranging role in many cellular and physiological functions that can be therapeutically targeted and translated into new generation therapies. 1.3.3.2 Protein therapeutics targeting TNF super family members Several TNFSF members drive cell division, differentiation, and survival, while others suppress responses by promoting cell death (which is not the focus of this section). Agonistic and blocking reagents such as antibodies and Fc fusion proteins can be used to target these molecules to modulate immune responses for beneficial disease outcomes. Strategies include blocking one or more of these interactions to reduce pathogenic immune responses in autoimmune and inflammatory disease, or enhancing signaling that is triggered by the ligand receptor interactions to stimulate a more robust immune response and promote anti-tumor immunity. In addition to blocking TNF receptor signaling, newly discovered methods include TNFR mediated direct costimulation and proliferation of endogenous nTreg and iTreg to dampen immune responses in inflammation, allergy and autoimmunity, or to expand this immunosuppressive cell population prior to transplantation for induction of immunological tolerance. One method of decreasing immunopathology and inhibiting disease progression in inflammatory or autoimmune diseases should aim to suppress the immune responses of T cells, APCs, NK cells and NKT cells. In order to do so, the logical method would be to prevent TNFR interaction with their ligands, which would decrease the expansion and 31 survival of pathogenic cell populations and/or decrease their production of proinflammatory cytokines. For example, antibodies and Fc fusion proteins that target and block TNF, a proinflammatory TNFSF molecule, have been highly successful in patients for treatment of several autoimmune diseases including RA and Crohn’s disease. These studies show that neutralizing TNF-TNFR interactions can result in strong suppression of disease symptoms, which are usually the result of decreased activity of CD4+ or CD8+ T cells, or in other cases impaired NK and NKT cell function. The second therapeutic approach to dampen inflammation is through the administration of depleting antibodies. These therapies target the ligand or receptor and directly eliminate the pathogenic cells that express a specific molecule. OX40 is highly upregulated on enchephalitogenic myelin basic protein (MBP)-specific T cells at the site of inflammation during the onset of experimental autoimmune encephalomyelitis (EAE). In vivo, injection of an OX40 immunotoxin (anti-OX40 antibody coupled to toxin) at the onset of disease eliminates MBP-specific T cells in the CNS, resulting in the amelioration of EAE (142). Similarly, injection of anti-OX40 coated liposomes in mice that had Mycobaterium tuberculosis (Mt) induced arthritis, resulted in the elimination of MTspecific T cells and resolution of disease (143). However, the depletion strategy can also affect TNFR expressing Treg cells that are essential for the induction of immunological tolerance associated with transplantation and autoimmunity and for the protection against other inflammatory diseases such as asthma. Elimination of both Treg and pathogenic cells could result in short-term benefit and inhibition of disease, yet future lack of Treg function can lead to re-occurrence of disease when new pathogenic cells are uncontrolled (38). 32 The third therapeutic approach relies on the stimulatory rather than the neutralizing or depleting reagents to inhibit the activity of pathogenic effector cells. In this case, agonistic antibodies or Fc fusion proteins would be targeted at a TNF receptor expressed on Treg cells. Natural and inducible CD4+ Treg cells can constitutively express OX40, CD27, 4-1BB, or TNFRSF25 in mice, or these molecules can be induced on these cell populations in humans. Since signaling through TNF molecules can increase the frequency and function of these T cell subsets, therapeutic strategies can be utilized to skew the balance in favor or against Treg. In allergic lung inflammation, an inflammatory disease that is mainly driven by CD4+ T cells (144, 145), treatment with either TNFRSF25 agonist, 4C12, prior to airway antigen challenge (ova aerosolization) induced the preferential accumulation of Tregs recognizing self-antigen, but not Tconvs, within the lungs and reduced eosinophilia and mucus production in the bronchoalveolar space. To take advantage of Treg expansion by TNFRSF25 signaling, it is important to inject the agonist at a time when no exogenous antigen is present that may activate other T cell subsets. The sequence of exposure of CD4+ T cells to cognate antigen and TNFRSF25 costimulation determines whether an inflammatory response is induced by Tconvs or suppressed by Tregs. Dr. Wolf et al. in our laboratory reported that TNFRSF25 mediated expansion of endogenous Treg population prior to transplantation results in prolongation of cardiac allograft survival in a mouse model of fully major histocompatibility complexmismatched ectopic heart transplants (146). Similarly, enhanced inflammation in a model of corneal infection with HSV was observed when 4C12 was administered 6 days post infection, while TNFRSF25 stimulation prior to infection reduced the severity of subsequent stromal keratitis lesions, which was attributed to the expansion of the Treg 33 population that additionally expressed activation markers such as CD103 needed to access inflammatory sites (147). 1.4 TNF-like ligand 1A (TL1A)/TNF receptor superfamily member 25 (TNFRSF25) TNFRSF25 (also known as DR3) is a member of the TNF superfamily that is expressed primarily on lymphocytes and is the receptor of TNF-like ligand, TL1A (also known as TNFSF15). TNFRSF25 costimulates T-cell activation through the intracytoplasmic DD and the adapter proteins TRADD, which is described above. TL1A costimulates T cells to produce various cytokines and can promote expansion of Treg in vitro and vivo. Studies done in our laboratory using transgenic mice that lack TNFRSF25 or TL1A or mice that are treated with blocking antibodies to TL1A report that TNFRSF25 play a specific role in enhancing effector T cell proliferation at the site of tissue inflammation in autoimmune disease models (106). Transgenic overexpression of TL1A in mice results in an IL-13 dependent pathology in the small intestine marked by goblet cell hyperplasia (129). Together, these studies suggest that TNFRSF25 and TL1A are therapeutic targets for therapies designed to modulate the immune system to improve clinical outcome in inflammation, autoimmunity, allergy, transplantation, and cancer. 1.4.1 TL1A TL1A was identified and characterized as the ligand for both TNFRSF25 and decoy receptor TNFRSF25 by Mignone et. al in 2002. TL1A is a longer splice variant of TL1 (also called VEGI), which was previously identified as an endothelium-derived factor that inhibited endothelial cell growth in vitro and tumor progression in vivo (148151). TL1A is a trimeric type II transmembrane protein that can be cleaved by 34 metalloproteases and released as a functional soluble trimer. TL1A lacks an N-terminal signal peptide and the 5’ end carboxyl domain reveals highest sequence identity to TNF (24.6%), followed by FasL (22.9%) and LTα (22.2%). The C-terminal 151 aa of TL1A (aa 101-251) and that of TL1 (aa 24-174) are identical and there is no sequence homology at the N-terminal. The cloned mouse TL1A cDNA encode proteins of 252 aa (Figure 10) and shares 66.1% sequence homology to human TL1A. The 2.02 kb TL1A cDNA has been mapped to chromosome 9q32. Detailed sequence alignment revealed that TL1A is encoded by 4 coding exons utilizing consensus splicing sites(152). ICD:%(aa%1)40)% TM% ECD:%(aa%65)252)% Figure 10. Diagram of TL1A. ICD: intracellular domain; TM: Transmembrane; ECD: extracellular domain. Migone et al. found that TL1A was expressed pre-dominantly by human umbilical, dermal microvascular and uterus myometrial endothelial cells (HUVEC) cells. Very low TL1A expression has been detected on human aortic endothelial cells, adult fibroblasts, aortic smooth muscle cells, skeletal muscle cells, adult keratinocytes, tonsillar B cells, T cells, NK cells, monocytes, or dendritic cells. TL1A mRNA levels were detected in human tissues including prostate, kidney, placenta, and stomach while low levels were observed in intestine, lung, spleen, and thymus. TL1A is undetectable in most cancer cell lines including 293T and HeLa cells (152). TL1A expression can be induced through stimulation with Toll-like receptor (TLR) ligands, such as lipopolysaccharide (LPS), and crosslinking of Fc receptors on dendritic cells and macrophages, as well as exposure to other cytokines including IL-1 and TNF in endothelial cells (41, 105, 152). Such stimulation for TL1A expression is highly transient, declining back to baseline 35 levels within 1 day. TL1A can be induced in a slower and more sustained manner on T cells after TCR stimulation that could be stabilized by the autocrine positive feedback stimulation with TNFRSF25 (152). 1.4.2 TNFRSF25 TNFRSF25 was initially cloned by a number of research groups through homology with TNFR1 and it was initially given several other names including LARD, TRAMP, APO-3, and WSL-1. The coding part of the gene spans 5 kb with 10 exons. Mouse TNFRSF25 has 63% homology at the protein level to human TNFRSF25, with 94% homology in the death domains and 52% in the extracellular domains. Additionally, hTNFRSF25 expression on human tissues does not correspond to mTNFRSF25 expression in mouse tissues. For example, hTNFRSF25 is found in intestine, while mTNFRSF25 is found in the kidney. There are at least 13 splice variants for TNFRSF25 in humans making it complicated to define the precise function of the receptor. There are 2 splice variants of mTNFRSF25, including the full length receptor, soluble receptor that lacks the transmembrane domain and the transmembrane receptor lacking one of the CRD regions in the extracellular domain (153). Signaling through TNFRSF25 may induce caspase dependent apoptosis or activation of NFκB as described in section 1.3.1 (pg. 13). TNFRSF25 is expressed constitutively in the form of randomly spliced transcripts mainly in lymphoid cells (63, 153, 154) and also in other cell types including tumor cells (155, 156). TNFRSF25 is detected at low levels on naive CD4 T cells and CD8 T cells and TCR-activated T cells upregulate expression. NKT cells express high levels of the receptor. A subpopulation of CD11c+ cells and NK cells are also TNFRSF25 positive, 36 whereas B cells are negative (106). Expression is also detected on activated human monocytes (157). Combination of IL-12 and IL-18 upregulated TNFRSF25 expression on NK and CCR9+CD4+ peripheral blood (PB) cells, whereas there is a minimal effect in other T cell subsets. PB CCR9+CD4+ T cells represent a small subset of circulating T cells with mucosal T cell characteristics and a Th1 cytokine profile. Papadakis et al. reported that the TL1A/TNFRSF25 pathway plays a dominant role in the ultimate level of IL-12/IL18 induced IFN-γ production by CCR9+ mucosal and gut homing PB T cells that could play an crucial role in Th1 mediated intestinal diseases such as Crohn’s. 1.4.3 TL1A/TNFRSF25 in immunological responses Although TL1A induces apoptosis in TNFRSF25 expressing cell lines (41), TL1A/TNFRSF25 interactions have been mainly associated with costimulation of Th1 cells with TNFRSF25 being expressed on activated T cell and TL1A being induced on APCs such as DCs. This pair of molecules has been implicated in the pathogenesis of several diseases marked by gut inflammation. Polymorphisms in TL1A, GWAS and selective association studies have linked the duo with inflammatory bowel disease (IBD), ulcerative colitis, and Crohn’s disease (158-160). In 2011 three individual laboratories reported that overexpression of TL1A on T cells or APCs results in T cell dependent inflammatory small bowel pathology (128, 129, 161). Meylan et al. reported mild splenomegaly and mild-to-moderate mesenteric lymphadenopathy in adult mice resulting in higher cellularity. Flow cytometry analysis revealed an accumulation of FoxP3+ Treg, an increased number of CD4+ T cells in the mLN and to a lesser extent in the spleen, and a mild increase in CD8 T cell frequency in the mLN. They also reported an increase in the frequency of CD69+ cells (recent 37 activation marker) and memory cells (CD62LlowCD44hi) gated on the CD4+ T cells. B cell and myeloid cell frequency were normal in the transgenic mice. TL1A mediated costimulation driven proliferation and activation of CD4+ T cells in the absence of exogenous antigen was due to recognition of microflora or other environmental mucosal antigens. These mice develop a Th2-cytokine, IL-13, dependent IBD pathology, and blocking of TL1A-TNFRSF25 abrogated induced colitis(128). Studies looking at Th2 driven models of asthma report that TNFRSF25 deficient mice or anti-TL1A treated wild-type mice have reduced airway inflammation and mucus production, which is associated with inhibition of Th2 cytokine expression and reduced frequency of CD4+ T cells and invariant natural killer cells (iNKT cells) in the lung. The activity of TL1A/TNFRSF25 has also been studied extensively in Th17 mediated inflammatory diseases. TNFRSF25 is expressed on Th17 cells, and in studies of murine EAE, genetic deletion of TNFRSF25 or TL1A significantly reduces the numbers of pathogenic CD4+ T cells and the abrogation of clinical disease symptoms (152, 162). Similar inhibition of TNFRSF25/TL1A signaling protects mice against arthritis, while injections with recombinant TL1A exacerbates the disease (163), which correlates with the elevated expression of TL1A observed in human RA synovial fluid (164). In all these studies, the activity of TL1A is due to the immunomodulation of antigen activated pathogenic CD4+ T cells that contribute to disease. Although TL1A/TNFRSF25 has been implicated in exacerbating inflammatory diseases, our laboratory has recently identified a role for TL1A/TNFRSF25 in maintaining health and resolving inflammation. TNFRSF25 is constitutively expressed on the surface of Treg cells and costimulation of TNFRSF25 by an agonistic antibody, 38 4C12, results in the expansion of pre-existing Treg that are protective against allergic lung inflammation in a mouse model for asthma, by reversing the ratio of effector T cells to Tregs in the lung, suppressing IL-13 and Th2 cytokine production, and blocking eosinophil exudation into bronchoalveolar fluid. The protective role of TNFRSF25 expanded Tregs in allergic lung inflammation does not contradict our previous studies implicating TL1A in the exacerbation of allergic lung inflammation. In our most recent studies, TNFRSF25 signaling preceded antigen exposure, whereas in previous studies, TNFRSF25 signals followed antigen challenge. Since TNFRSF25 costimulates antigen TCR-activated CD4+FoxP3- Tconvs and Tregs, the sequence of antigen exposure and TNFRSF25 signaling determines whether an inflammatory response is suppressed by self-antigen activated Tregs or induced by Tconvs (130). 1.5 Aims of the dissertation Over the past several years, TNF superfamily members have been identified as important costimulators of activated T cells. TCR activated T cells progress to anergy and even apoptosis without co-stimulatory signaling. Our previous study, using clone 4C12, reported that TNFRSF25 has a non-redundant function as regulator of Treg cells and its activity is unique among TNFR family members. These studies demonstrated that TNFRSF25 signaling provides costimulation for the proliferation of pre-existing Tregs in vivo, which receive continuous TCR signals by self-antigen presented by MHC II. Given the evidence that agonistic antibodies are antigenic and do not always precisely mimic the function of TNF ligands on different cells (165, 166), a comparison to the functional effects of the natural ligand is necessary. Transgenic overexpression of TL1A resulted in modulation of both CD4+ Tconv and Treg-cell response in intestinal 39 goblet cell hyperplasia and intestinal inflammation (128, 161, 167, 168) indicating important regulatory functions especially in the mucosa. The murine TL1A Ig fusion protein (TL1A-Ig) enabled comparison to the agonistic antibody and offers flexibility of experimental design for further dissection of TL1A-effects on Treg and Tconv. Recombinant TL1A-Ig fusion protein may serve as an attractive alternate to the heterologous hamster antibody 4C12 that is cleared out due to its antigenic nature. Additionally, trimeric ligand Ig fusion proteins have a shorter biological half –life and the ability to oligomerize receptors on the cell surface, mediating stronger signaling. Our initial aim, therefore, was to genetically engineer the physiological ligand fusion TL1AIg protein for TNFRSF25 and compare the function of the agonists in vitro and in vivo. CHAPTER 2: Results 2.1 Construction and characterization of TL1A-Ig 2.1.1 Genetic engineering and preliminary studies of four TL1A-Ig constructs The cloning strategy for the construction of four TL1A-Ig fusion proteins is described in Figure 11. The fusion proteins differed by the length of the extracellular domain (ECD) and by the presence or absence of the putative cleavage site. The cDNA of each construct comprised of the murine IgG λ-chain peptide leader sequence followed by the hinge, CH2 and CH3 domains of mIgG1 and then the ECD of TL1A (Figure 12a). PCR mIgG1 PCR TL1A (4 constructs) Ligate into pCRII-TOPO Ligate into pCRII-TOPO 1. Cut Fc-mIgG1pCRII and receiving vector pBluescript II SK with EcorI and XhoI; ligate 2. Cut mTL1A-pCRII and receiving vector Fc-mIgG1-pBluescript II SK with EcorI and NotI; ligate Sequence Fc-mIgG1-TL1ApBluescript II Cut Fc-mIgG1-TL1ApBluescript II and receiving vector pBCMGSneo with XhoI and NotI, ligate SalI XhoI Cut Fc-mIgG1-TL1ApBMGSneo with XhoI and ligate synthesized dimer oligomers for Ig κ leader squence flanked with (5’)SalI and (3’) XhoI Neo mIgG1-TL1A pBCMGSneo ~15.5 kbp NotI Neo SalI XhoI site removed when SalI ligates Ig κ leader sequence-mIgG1TL1A pBCMGSneo ~15.5 kbp NotI Restriction digests to confirm correct orientation Figure 11. Schematic diagram of TL1A-Ig-pGMGSneo cloning strategy. 40 41 Each of the fusion protein constructs was transfected and expressed in 3T3-NIH cells. Non-reducing and reducing western blot analysis was done for all fusion proteins in supernatant using an HRP conjugated anti-mIgG1 antibody for immunoblotting (Figure 12b). The non-reduced gel showed that constructs TL1A-Ig (FL ECD), (-3aa ECD), and (-5aa ECD) form dimers (100 kDa), while construct TL1A-Ig (ECD -11a) that lacks a protease cleavage site separates as a monomer (50 kDa). Since the IgG1 had been mutated to replace the three cysteines of the hinge portion to serines (169), we were expecting all constructs to separate as monomers in non-reducing conditions due to the lack of disulfide-bond formation. All TL1A-Ig fusion proteins have an apparent, monomeric molecular weight of approximately 50 kDa upon separation under reducing conditions. All constructs were a intact b A hinge*CH2*CH3# B hinge*CH2*CH3# C hinge*CH2*CH3# D hinge*CH2*CH3# TL1A# TL1A# TL1A# TL1A# and Non-reduced stable. Reduced FL#ECD#TL1A*Ig#(aa#65*252)# *3aa#ECD#TL1A*Ig#(aa#68*252)# *5aa#ECD#TL1A*Ig#(aa#70*252)# *11aa#ECD#TL1A*Ig#(aa#76*252)# a b c d a b c d Figure 12. Construction and expression of TL1A-Ig fusion proteins. (a) Schematic diagram of the four different TL1A-Ig fusion protein constructs. (b) TL1A-Ig variants were stably transfected into and secreted by NIH-3T3 cells. Twenty ng of TL1A-Ig in supernatant (quantified by Elisa) was analyzed by SDS-PAGE under reducing and non-reducing conditions, transferred to a nitrocellulose membrane and detected by Western blot analysis with HRP anti-mIgG mAb. With the aim of identifying the highest TL1A-Ig producing clone, all transfectants were selected for high IgG1 expression using flow cytometry sorting followed by single cell cloning under high antibiotics selection. Briefly, all TL1A-Ig producing cells were expanded, harvested and stained with FITC anti-mIgG1. The highest IgG1 positive cells (top 10%) were FACs sorted. Recovered TL1A-Ig secreting cells were single-cell cloned 42 (0.33 cells/well) under 3 mg/mL G418 selection. TL1A-Ig clones were screened by an indirect IgG sandwich ELISA at each step to select for the highest TL1A-Ig producing clone (Figure Post-transfection IgG1 gp96-Ig FL TL1A-Ig -3aa TL1A-Ig -5aa TL1A-Ig -11aa TL1A-Ig 1.0 OD 405 nm 0.8 0.6 1.0 IgG1 gp96-Ig 0.8 FL TL1A-Ig -3aa TL1A-Ig -5aa TL1A-Ig -11aa TL1A-Ig 0.6 0.4 0.4 0.2 0.2 0.0 20 21 22 23 24 25 26 27 28 29 210 Dilution 0.0 20 21 22 23 24 25 26 27 28 29 210 Dilution c Post-single cell cloning 1.0 0.8 OD 405 nm Post-FLOW sort b OD 405 nm a 13). 0.6 IgG1 gp96-Ig FL TL1A-Ig-A FL TL1A-Ig-B FL TL1A-Ig-C -3aa TL1A-Ig-A -3aa TL1A-Ig-B -5aa TL1A-Ig-A -5aa TL1A-Ig-B -11 aa TL1A-Ig-A 0.4 0.2 0.0 20 21 22 23 24 25 26 27 28 29 210 Dilution Figure 13. Selection of the highest producing TL1A-Ig cell clone. (a) Each of the four TL1A-Ig expression plasmids was transfected and expressed in 3T3-NIH cells. Transfected cells were expanded and seeded at 1 million cells per well in a 6 well plate for 24 hours. Supernatants were collected and quantified for TL1A-Ig using an indirect IgG1 ELISA. (b) TL1A-Ig expressing cells from (a) were expanded, harvested and stained with FITC-anti-IgG1 antibody. The top 10% cells expressing IgG1 were FLOW sorted and supernatants were collected for TL1A-Ig quantification using ELISA as described above. (c) Highest TL1A-Ig expressing cells for each construct were single cell-cloned at 0.3 cells/well in 96-well plates in 10% FBS supplemented media with G418 selection. Supernatants were collected from wells that turned yellow (indicating cell growth) to quantify for TL1A-Ig using IgG1 directed ELISA. The cells recovered from each well were expanded, harvested, frozen, and stored at -135° C for future use. Size exclusion chromatography was used to determine the apparent molecular weights of unpurified TL1A-Ig fusion proteins (Figure 14). Briefly, 0.5 mL TL1A-Ig supernatant was applied on a Superdex 200 gel filtration column equilibrated with Tris buffer. Elution fractions were collected at a flow rate of 0.5 mL/min (200 µl/fraction) and 10 µl of each fraction were applied to a nitrocellulose membrane (dot blot) and blocked 43 with 5% filtered non-fat dry milk. TL1A-Ig was detected with an HRP conjugated antimouse IgG antibody (1:1000 dilution) and the SuperSignal West Pico Chemiluminescent Substrate (Thermo Fisher Scientific, Rockford, IL). The signals from each blotted dot were quantified using a densitometry program on the Versa Doc imaging system and the readout was overlapped with the UV absorption profile (280 nm) chromatogram of standards IgG and albumin separated on the same column (Figure 14a). b TL1A-Ig, 120 void Albumin, 44 Exclusion#peak# IgG, 150 100 60 6 8 10 8 10 440# 10 Exclusion#peak# Buffer:# 150#mM#NaCl# 10#mM#Tris# 1#mM#EDTA# 669# 10%#glycerol# # 12 12 8 mL# 80 6 5#frac(ons/mL# Buffer:# 150#mM#NaCl# 10#mM#Tris# 1#mM#EDTA# 669# # Density ODu/mm2 Absorbance (280 nm) a 14 Posi(ve# Nega(ve## control# control# Elution volume (mL) 8 440# 10 Thyroglobulin,#669#kDa# Ferri7n,#440#kDa# Figure 14. TL1A-Ig exists as a high molecular weight protein in supernatant (a) Representative dot-blot densitometry analysis of elution fractions collected from gel filtration of TL1A-Ig secreted from 3T3 cells in supernatant superimposed on the elution chromatogram of standards. (b) Supernatants containing TL1A-Ig were applied on a Superdex 200 column and buffer (with or without 10% glycerol) was used to transport the sample through the column. All TL1A-Ig fusion proteins had a similar densitometry profile that suggested higher molecular weight oligomerization of the protein causing it to elute in the void volume. The addition of 10% glycerol to the Tris buffer did not change the elution profile (Figure 14b). 2.1.2 GS selection system for generation of high TL1A-Ig expressing clone All four TL1A-Ig constructs had functional activity assessed by in vitro caspase activation assays that will be discussed in section 2.2.1 (pg. 51). The highest producing clone of TL1A-Ig construct (-3aa ECD aa 68-252 with cleave site) was selected for 44 purification and further analysis. The murine glutamine synthetase (mGS)/ methionine sulfoxamine (MSX) gene amplification system was utilized to attain high TL1A-Ig producing clones (170). Glutamine synthetase is an enzyme that is required for the biosynthesis of glutamine from glutamate and ammonia. Mammalian cell lines utilize this enzymatic pathway to make glutamine, which is required for survival. MSX binds to endogenous GS enzyme and prevents the production of glutamine. Cell lines including Chinese Hamster Ovarian cells (CHO) can be transformed with a plasmid with a gene of interest and the GS gene. Gene amplification occurs when cells are subjected to increasing concentrations of MSX. The transfected GS gene can function as a selectable marker to select for gene amplified clones that produce high levels of recombinant proteins. Using this system, CHO-K1 cells were transfected with the pVitro-2-hygro vector (Invivogen, San Diego) double cassette plasmid expressing TL1A-Ig and mGS (Figure 15a). The cDNA for the fusion protein comprised of the murine IgG k-chain peptide leader sequence, followed by the hinge, CH2 and CH3 domain of mouse IgG1 and then the extracellular domain (ECD) of murine TL1A (amino acid 68-252) (Figure 15b). The pVITRO plasmid carries two human ferritin composite promoters, FerH (heavy chain) and FerL (light chain). a b hFerL mIgG1-mTL1A hFerH mGS leader mIgG1 peptide hinge-CH2-CH3 5’ 62 bp 681 bp mIgG1 N hinge-CH2-CH3 227 a.a Figure 15. Construction of the TL1A-IgpVitro plasmid. (a) Schematic diagram of the expression cassette of the TL1A-Ig fusion protein. An expression cassette of mIgG1mTL1A is inserted 3′ to hFerL promoter in the 3’ pVitro2-hygro plasmid. The mouse glutamine synthetase (mGS) cDNA is inserted 3′ to the hFerH promoter, which provides a selection marker for amplification in transfected mammalian cells. (b) Schematic of the TL1AIg cDNA and the corresponding translated monomeric protein structure. mTL1A ECD 558 bp mTL1A ECD 186 a.a C 45 The transformants were single-cell cloned with 1 mg/mL hygromycin selection and supernatants were analyzed by ELISA for mouse IgG as a read-out for TL1A-Ig. The highest producing clone (40 µg/mL/ 106cells/ 24h) was subsequently passaged in standard cell culture media and 10% FBS. FBS was slowly reduced and substituted with increasing proportions of serum-free media. Serum-free subclones were subjected to further selective pressure in glutamine-free media and with increasing concentrations of MSX, an inhibitor of GS, resulting in gene amplification. After the MSX selection, the subclone producing the highest level of TL1A-Ig (200 µg/mL/ 106cells/ 24h) was identified and maintained for production of TL1A-Ig using a hollow fiber cell cartridge and culture in serum free and glutamine free medium. By utilizing cartridges, we increased the cells per volume per day that resulted in higher TL1A-Ig yields (up to 4.4 mg/mL/day). TL1A-Ig was purified to homogeneity by affinity chromatography by binding to protein A and elution with diethylamine (0.1 M, 11.5 pH). 2.1.3 Biochemical and gel filtration analysis of TL1A-Ig TL1A is a trimeric protein (171-174) while the IgG heavy chain forms dimers. The theoretical m.w of monomeric TL1A-Ig is 47 kDa with the IgG contributing 26 kDa and TL1A part of 21 kDa. Upon SDS-PAGE analysis, unreduced TL1A-Ig migrated as a dimer of 100 kDa indicating that the IgG1 heavy chains did not disassociate. Reducing conditions resulted in an apparent m.w band of approximately 50 kDa (Figure 16a). The low m.w band in Figure 16a does not stain with either anti-IgG or anti-TL1A antibody and represents a minor contaminant. By Western blot analysis, both anti-TL1A and antiIgG antibody detected the 50 kDa band indicating that all of TL1A is in association with 46 IgG and a kDa no cleavage 2-ME - + 2-ME - + occurred 2-ME - + 150 100 75 50 37 25 150 100 75 50 37 25 (Figure 16a). b kDa 150 100 75 50 37 25 1 α-TL1A α -IgG Western Blot Coomassie Blue 2 3 4 Coomassie Blue Figure 16. Characterization of purified TL1A-Ig by SDS-PAGE and western blot analysis (a) Non-reduced (-2-ME) and reduced (+2-ME) TL1A-Ig samples were separated on SDS gel and stained with Coommassie Blue or analyzed by immunoblotting using antibodies to mouse-TL1A or mouse-IgG (b) SDS-PAGE separation of reduced TL1A-Ig after enzymatic deglycosylation. Protein samples were treated with glycanases and separated on SDS-PAGE followed by staining with Coommassie Blue Stain. Denatured TL1A-Ig was loaded in each lane. Lane 1: Untreated control, lane 2: treated with Nglycanase only, lane 3: treated with N-glycanase and sialidase A, and lane 4: treated with N-glycanase, sialidase A and O-glycanase. Multiple bands in non-reduced conditions may be explained by thiol-disulfide exchange or post-translational glycosylation. N-glycanase treatment indicates N-linked post- translational glycosylation in CHO cells while O-glycanase and salidase had no effect (Figure 16b). To determine whether preparative conditions and purification methods affect the final oligomerization and function of TL1A-Ig, we collected separate batches of TL1A-Ig supernatants from 3T3 cell or CHO cell cultures and purified them using different affinity chromatography columns and elution buffers. Since 3T3 cells produced low amounts of TL1A-Ig (~5 µg/mL), we applied a large 5 L volume of TL1A-Ig containing supernatant on a traditional protein A column for purification of TL1A-Ig Prep 1. Void Aldolase, Ovalbumin, 158 44 Hexameric TL1A-Ig, 528 kDa TL1A7Ig#Prep1# Thyroglobulin, 670 Protein# Marker#(kDa)# 47 Absorbance (280 nm) Dimeric TL1A-Ig, 175 kDa 75# 50# 37# TL1A-Ig Prep 1 Hexameric Dimeric d Elution volume (mL) Figure 17. Characterization of purified TL1A-Ig Prep 1 by gel filtration and SDS-PAGE analysis. After the volume passed through the column, bound TL1A-Ig was eluted using a basic elution buffer diethylamine, (0.1 M, 11.5 pH) and neutralized with potassium dihydrophosphate (1M, monobasic). The TL1A-Ig containing solution was dialyzed against PBS overnight and the recovered protein was stored at -80° C. An aliquot of TL1A-Ig Prep 1 was applied on a Superdex 200 gel filtration chromatography column to determine the apparent molecular weights of 528 kDa (hexamer) and 175 kDa (dimer), which suggests high frictional coefficient as depicted in schematic drawings of the quarternary structure (Figure 17). Upon SDS-PAGE analysis and Coomassie blue staining the reduced fusion protein migrated as bands (due to N-glycosylation as described above) at 50 kDa with a faint band of contaminating albumin at approximately Ovalbumin, 44 Aldolase, 158 Void TL1A7Ig#Prep4# TL1A3Ig(Prep(2( Thyroglobulin, 670 Protein( Protein# Marker((kDa)( (Marker#(kDa)# Absorbance (280 nm) 65 kDa (Figure 17). 75# 50# TL1A-Ig Prep 2 37# Elution volume (mL) Figure 18. Characterization of purified TL1A-Ig Prep 2 by gel filtration and SDS-PAGE analysis. 48 Purification on A protein A column followed by elution with an acidic glycine buffer (0.1 M, 2.5 pH) was done for TL1A-Ig Prep 2 (Figure 18). The gel filtration analysis revealed higher molecular weight oligomerization of TL1A-Ig Prep 2, while SDS-PAGE analysis of reduced TL1A-Ig resulted in expected bands at 50 kDa (Figure 18). We encountered difficulty in handling large supernatant volumes due to the low amount of TL1A-Ig secreted by 3T3 cells. Undesired protein aggregation clogged the protein A column and frequent centrifugation and filtration of the supernatant was laborious and resulted in loss of protein at each step. Hence, in the next protein purification (TL1A-Ig Prep 3), ammonium sulfate precipitation was used to concentrate the proteins and reduce the volume of TL1A-Ig supernatant (Figure 19). Briefly, solid ammonium sulfate was added to the supernatant to achieve a 55% ammonium sulfate and the solution was mixed overnight at 4° C. The supernatant was centrifuged and the precipitate containing TL1A-Ig was resuspended in binding buffer (1.6 M Glycine, 3.2 M NaCl, pH 9.0) and dialyzed against fresh binding buffer overnight. The solution from the dialysis tube was centrifuged, filtered and applied on a protein A column for purification. Size exclusion chromatography analysis resulted in majority of TL1A-Ig Prep 2 eluting as a dimer of 175 kDa molecular weight. Upon SDS-PAGE analysis, reduced TL1A-Ig bands with 50 Thyroglobulin, 670 Void kDa molecular Aldolase, Ovalbumin, 158 44 Hexameric TL1A-Ig, 528 kDa Dimeric TL1A-Ig, 175 kDa weight (Figure 19). Protein( Protein( Marker((kDa)( Marker((kDa)( ( TL1A7Ig(Prep2( TL1A3Ig(Prep(3( as Absorbance (280 nm) migrated 75( 50( TL1A-Ig-Prep3 37( Elution volume (mL) Figure 19. Characterization of purified TL1A-Ig Prep 3 by gel filtration and SDS-PAGE analysis. 49 We next evaluated the affect of acidic elution using a protein G column for homogenous purification of TL1A-Ig. The TL1A-Ig containing supernatant was directly applied on the protein G column without prior preparative methods. Bound fusion protein was eluted with an acidic glycine buffer (0.1 M, 2.5 pH) and neutralized with Tris (1 M, 9.0 pH). Size exclusion chromatography showed that TL1A-Ig purified under these conditions resulted in dimeric oligomerization of TL1A-Ig. Separation of reduced TL1AIg on an SDS-PAGE gel resulted in clean bands at 50 kDa confirming that the recovered Hexameric TL1A-Ig, 528 kDa Dimeric TL1A-Ig, 175 kDa 75# 50# TL1A-Ig-Prep 4 37# Thyroglobulin, 670 Void Protein# Protein# #Marker#(kDa)# #Marker#(kDa)# TL1A7Ig#Prep#4# TL1A7Ig#Prep#5# Void Aldolase, Ovalbumin, 158 44 Absorbance (280 nm) Thyroglobulin, 670 Protein# #Marker#(kDa)# TL1A7Ig#Prep#4# Absorbance (280 nm) TL1A-Ig was intact and the preparation had no contaminants (Figure 20). Aldolase, Ovalbumin, 158 44 Hexameric TL1A-Ig, 528 kDa 75# 75# 50# 50# Purified TL1A-Ig Prep 5 37# 37# Elution volume (mL) Elution volume (mL) Figure 20. Characterization of purified TL1A-Ig Prep 4 by gel filtration and SDS-PAGE analysis. Figure 21. Characterization of purified TL1A-Ig Prep 5 by gel filtration and SDSPAGE analysis. After the establishment of the GS/MSX protein production system, we were able to harvest volumetrically smaller and highly concentrated TL1A-Ig supernatants (up to 4.4 mg/mL). A small 75 mL batch of TL1A-Ig containing supernatant was passed over a protein A column followed by elution with a basic diethylamine buffer (0.1 M, 11.5 pH). The recovered TL1A-Ig p Prep 5 was analyzed using gel filtration that revealed a molecular weight of 528 kDa (hexamer) (Figure 21). Separation under reduced conditions on an SDS-PAGE gel resulted in bands at approximately 50 kDa molecular weight. The lower contaminating band did not stain with anti-TL1A or anti-IgG1 as seen in Figure 16a, confirming that the protein was intact and pure (Figure 21). 50 2.2 In vitro functional activity of TL1A-Ig 2.2.1 TL1A-Ig binds and stimulates TNFRSF25 overexpressed on tumor cells TL1A-Ig bound to P815-TNFRSF25 cells with a similar profile to the TNFRSF25-specific monoclonal antibody 4C12 but not to untransfected P815 cells as determined by flow cytometry (Figure 22a-c). In addition, binding of TL1A-Ig to P815TNFRSF25 cells was competitively inhibited by pre-incubation with the monoclonal TL1A blocking antibody, L4G6. TL1A-Ig purified using either acidic or basic elution buffers maintained structural integrity and bound to TNFRSF25 (Figure 22b). Hexameric and dimeric TL1A-Ig separated by gel filtration also bound to TNFRSF25 (data not a shown). b TL1A-Ig acidic elution FL TL1A-Ig -3 aa TL1A-Ig -5 aa TL1A-Ig -11 aa TL1A-Ig Untransfected P815 2° Ab control mIgG1 TL1A-Ig basic elution L4G6 treated TL1A-Ig Untrasfected P815 2° Ab control mIgG1 c Unstained Hamster IgG Untransfected P815 2° Ab control 4C12 Figure 22: TL1A-Ig and 4C12 bind to their receptor, TNFRSF25, expressed on P815. (a) P815 cells were stably transfected with expression vectors encoding mouse TNFRSF25. TNFRSF25-P815 cells were incubated with isotype mIgG1, (a) TL1A-Ig in culture supernatant or (b) purified TL1A-Ig or (c) hamster IgG or 4C12 and stained with fluorochrome conjugated anti-IgG secondary antibody. Negative controls included: Untransfected P815 cells incubated with TL1A-Ig followed by secondary antibody, TNFRSF25-P815 cells stained with secondary antibody only, and TNFRSF25-P815 cells incubated with TL1A-Ig pretreated with L4G6 (TL1A blocking Ab) followed by incubation with + secondary antibody. TNFRSF25 cells were then visualized by flow cytometry. Migone et al. reported that TL1A induces NF-kappaB activation and apoptosis in TNFRSF25-expressing cell lines(41). During apoptosis, the activation of specific 51 proteases, called caspases (cysteinyl-aspartic-acid-proteases), is one of the initial intracellular biochemical events. To determine whether the four TL1A-Ig fusion proteins can activate caspases, tumor P815 cells over-expressing TNFRSF25 were exposed to titrating concentrations of TL1A-Ig fusion proteins in supernatants harvested from transfected 60 40 20 0 0.01 300 3 Rhodamine counts (10 ) c 200 b No fusion protein FL TL1A-Ig -3 aa TL1A-Ig -5aa TL1A-Ig -11 aa TL1A-Ig 3 1 Concentration (ng/mL) No fusion protein mIgG1 TL1A-Ig CHO cell sup. Purified TL1A-Ig 4C12 100 0 0.0001 0.01 1 100 Rhodamine counts (10 ) 80 cultures 3 3 Rhodamine counts (10 ) 100 cell Rhodamine counts (10 ) a 3T3 100 Concentration (ng/mL) 80 60 23a). No fusion protein Untransfected P815 L4G6 treated TL1A-Ig Basic elution TL1A-Ig Acidic elution TL1A-Ig Hexameric TL1A-Ig Dimeric TL1A-Ig 4C12 40 20 0 0.0001 100 (Figure 0.01 1 100 Concentration (ng/mL) 10000 Figure 23. TL1A-Ig induced apoptosis in TNFRSF25 expressing P815 cells. TNFRSF25P815 cells were exposed to titrating concentrations of (a) unpurified TL1A-Ig constructs secreted from 3T3 cells, (b) acidic or basic purified TL1A-Ig, hexameric or dimeric TL1A-Ig separated using gel filtration (3T3 cells), or (c) unpurified or purified TL1A-Ig secreted from CHO cells. Negative controls: TNFRSF25-P815 cells cultured without fusion protein, TNFRSF25-P815 cells exposed to titrating concentration of IgG1, untransfected P815 10000 cells incubated with purified TL1A-Ig, and TNFRSF25-P815 cells incubated with TL1A-Ig pretreated with L4G6. Cells were incubated with caspase substrate solution and free Rhodamine 110 was determined fluorimetrically. These data are representative of more than 5 experiments. Caspase activity was also observed when TNFRSF25-P815 cells were exposed to TL1AIg purified using either acidic or basic elution buffers, or hexameric and dimeric TL1A-Ig that was separated by gel filtration (Figure 23b). Pre-incubation of TL1A-Ig with L4G6 completely inhibited apoptosis of P815-TNFRSF25 cells, and apoptosis was not observed when untransfected P815 cells were exposed to TL1A-Ig. TL1A-Ig was able to induce 52 caspase activation at a 100-fold lower concentration by weight than 4C12 (Figure 23c), suggesting high avidity binding and induction of ligand-mediated oligomerization on the receptor resulting in enhanced TNFRSF25 signaling relative to 4C12. As expected, adding titrating concentrations of control mIgG1 did not induce apoptosis. 2.2.2 TL1A-Ig binds to and stimulates endogenous TNFRSF25 expressed by T cells Resting Tconv, Treg and CD8+ T cells express low levels of TNFRSF25 that was detected using a triple sandwich staining method with 4C12 (Figure 24a). a b Iso. Conrol Unstained Tconv Iso. Control Treg Treg CD8+ Teff CD8+ Teff % Max % Max Tconv 4C12 TNFRSF25 c TNFRSF25 d Tconvs CPM (103) 300 *** *** 40 200 ns *** 30 20 100 0 Tregs 50 nv nv nv nv nv 10 0 nv nv nv nv nv αCD3 --- + --- --- + + --- + + --- + IL-2 --- --- + --- + --- + + --- + + --- --- + --- + --- + + --- + + --- --- --- + --- + + + --- --- --- --- --- --- + --- + + + --- --- --- --- --- --- --- --- --- --- --- + --- --- --- --- --- --- --- --- + TL1A-Ig 4C12 + + --- + --- --- + + --- + + --- + + + Figure 24. TL1A-Ig binds to and stimulates endogenous TNFRSF25 expressed on activated T cells (a) FIR splenocytes were harvested and sequentially incubated with isotype hamster IgG or 4C12, + biotin labeled anti-hamster IgG, and finally streptavidin Ab (b) CD4 T cells and CD8+ T cells were magnetically purified from FIR mice and activated using plate bound anti-CD3 for 4 days. Cells were harvested and incubated with isotype IgG or TL1A-Ig followed by staining with FITC anti-mouse IgG. (a) 4C12 bound or (b) TL1A-Ig bound TNFRSF25 was analyzed using flow cytometry by gating on + + + + + + CD4 FIR Tconv and CD4 FIR Treg or CD8+ Teff cells. (c) CD4 CD25 Tconv or (d) CD4 FIR Treg cells were cultured in proliferation assays with indicated stimuli: anti-CD3 (2 µg/mL; 2C11), mIL-2 (10 U/mL), 4C12 (10 µg/mL), or purified TL1A-Ig (0.1 µg/mL) in triplicates for each condition. ***P < 0.001 versus appropriate control. Significance was determined by 1-way ANOVA with Tukey post-test. Error bars indicate mean + SEM. NV refers to not visible. We failed to detect basal levels of TNFRSF25 expressed by all T cell subsets using TL1A-Ig or biotinylated TL1A-Ig (data not shown) that maybe due to the low expression 53 of TNFRSF25 on resting T cells. Anti-CD3 antibody activated T cells including CD4+ Tconv and Treg cells and CD8+ T cells express elevated levels of TNFRSF25 compared to resting T cells as detected by TL1A-Ig (Figure 24b) (62). In vitro incubation of Tconv cells with TL1A-Ig, but not 4C12, costimulated proliferation of Tconv cells in an antiCD3 antibody and IL-2 dependent fashion (Figure 24c). The fusion protein, unlike 4C12, also stimulated proliferation of purified natural CD4+FoxP3+ Treg cells in vitro in the presence of low 10 U/ml IL-2, even without the addition of anti-CD3 (Figure 24d). The sorting of live CD4+FoxP3+ Treg was made possible by utilizing FoxP3-reporter (FIR) mice (175) expressing a red fluorescent protein (RFP) under the FoxP3 promoter. Activation of naïve CD4+ Tcells by anti-CD3 or specific antigen in the presence of TGF-β, retinoic acid (RA) and IL-2 results in the induction of FoxP3 in a substantial proportion of Tconv cells resulting in iTregs. Foxp3 induction is partially suppressed by the TNFRSF25-agonist 4C12 and more completely by TL1A-Ig (Figure 25a) similar to OX40L (119, 120, 176). Additionally, TL1A-Ig also mediated proliferation of iTregs that were generated from culturing CD4+FoxP3- Tconv with plate-bound anti-CD3, IL2, a acid %FoxP3/Total CD4+ 100 80 (RA), and TGF-β b No Agonist 4C12 TL1A-Ig 150 CPM (103) retinoic 60 40 100 (Figure 25b). *** Unstimulated IL-2 only IL-2 + 4C12 IL-2 + TL1A-Ig ns 50 20 0 Polyclonal iTregs 0 OT-II iTregs Figure 25. TL1A-Ig blocks induction and induces proliferation of iTregs (a) For iTreg induction, FIR Tconv were cultured with plate-bound anti-CD3, TGF-β, RA, mIL-2 and 4C12 or TL1A-Ig and + OTII Tconv were cultured as above plus 1:2 APCs and OVA. Cultures were analyzed for FoxP3 cells + + in the CD4 gate. (b) Polyclonal CD4 FIR iTregs were generated as described in (a) and cultured in proliferation assays for 72 hrs. One representative analysis of 3 independent experiments is shown. ***P < 0.001 versus IL-2 only. Significance was determined by 1-way ANOVA with Tukey post-test. 54 Since TNFRSF25 mediated Treg proliferation is dependent on TCR engagement of MHC class II as reported by Dr. Schreiber et al. (130), we wanted to determine why freshly isolated CD4+FoxP3+ Treg proliferate in vitro without the addition of anti-CD3. Since both Tconv and Treg express MHC II (Figure 26a), our first hypothesis was that TCR expressed on highly purified Treg cell surface, recognize self-antigen that is presented by MHC II expressed on other cocultured Tregs. However, addition of blocking MHC II antibody did not abrogate TL1A-Ig mediated Treg expansion in the absence of anti-CD3 a (Figure 26b). b CPM (103) 50 40 30 20 Unstimulated Only IL-2 IL-2+TL1A-Ig IL-2+TL1A-Ig+Iso Control IL-2+TL1A-Ig+MHC II blocking Ab ns 10 0 Figure 26. MHCII blocking antibody does not abrogate TL1A-Ig mediated Treg proliferation in vitro. (a)Total CD4+ cells and T cell depleted APCs were magnetically separated and stained with FITC isotype control or anti-MHC II antibody. MHC II+ cells were detected in FIR- Tconv or FIR+ Treg cells pregated on CD4+ cells using FLOW cytometry. (b) Flow cytometry sorted CD4+FIR+ Treg cells were cultured in proliferation assays in the indicated conditions. Cells were treated with isotype antibody or blocking anti-MHC II for 45 minutes at 4°C before IL-2 and TL1A-Ig were added. Cultures 3 in were pulsed with H-thymidine for the last 6 hours of 72 hr incubation and incorporated isotope was measured by liquid scintillation counting.1way ANOVA and Tukey's Multiple Comparison Test. Our next hypothesis was that residual TCR signaling from recognizing selfantigen in vivo enabled TNFRSF25 mediated proliferation of freshly isolated Tregs in vitro. In an attempt to decrease/completely abrogate TCR signaling, Tregs were “rested” in 100U/mL IL-2 for 72 hours prior to culturing them in proliferation assays. This method resulted in a significant decrease in proliferation of cells that received only IL-2 and TL1A-Ig as compared to cultures that received anti-CD3, IL-2 and TL1A-Ig (Figure 27a). Supporting our second hypothesis, the addition of cyclosporine to cultures inhibited 55 TL1A-Ig triggered proliferation of Tregs (Figure 27b) suggesting that freshly isolated Treg maintain residual TCR signals from binding to self-antigens or commensal antigens normally present in vivo. Others have reported that freshly isolated Tregs have a higher level of phosphorylation of the TCR ζ-chain compared to Tconv cells, which is a 150 CPM (103) a consequence 100 of IL-2 ** IL-2 and anti-CD3 anti-CD3 and TL1A-Ig IL-2 and TL1A-Ig IL2+anti-CD3+TL1A-Ig TCR b 80 CPM (103) biochemical 50 60 signaling (177). IL-2 only IL-2+TL1A-Ig IL-2 + TL1A-Ig+ CsA 40 20 0 0.1 0 1 10 CsA (µg/mL) 100 Figure 27. Treg cells maintain residual TCR signaling from self-peptide recognition in vivo. (a) “Resting” Tregs were made by FACs sorting CD4+FoxP3+ Tregs from FIR splenocytes and culturing them with 100 U/mL IL-2 for 72 hrs. “Resting" Tregs were harvested, washed and cultured in proliferation assays in the indicated conditions. (b) FACs sorted CD4+FIR+ Treg cells were cultured in proliferation assays in the indicated conditions. 2 ug/mL anti-CD3 (2C11), 100 ng/mL TL1A-Ig, and/or 10 U/mL IL-2 were used where indicated in (a) and (b). Cultures were pulsed with thymidine for the last 6-8 hrs of 72 hr incubation and thymidine uptake measured using scintillion counter. 1way ANOVA and Tukey's Multiple Comparison Test. **P < 0.01. 2.3 In vivo functional activity of TL1A-Ig 2.3.1 Half-lives of TL1A-Ig and 4C12 Before determining functional effects in vivo, we determined the half-life of both TNFRSF25 agonists injecting mice with 4C12 or TL1A-Ig and analyzing timed serum samples by ELISA specific for Armenian hamster IgG or TL1A (Figure 28). Serum concentration (% of initial) 256 128 64 32 16 8 4 2 1 0 Figure 28. Half-lives of TL1A-ig and 4C12 are 13.5 hr and 4 d, respectively. (a) The time-related serum concentrations of 4C12 or TL1A-Ig in C57BL/6 mice (n=3 or more) was determined after a single i.p injection of 100 ug protein. Protein concentration was measured in blood samples collected at indicated time points by a sandwich ELISA specific for 4C12 or TL1A. 4C12 TL1A-Ig 2 4 6 8 Time post injection (d) 56 B6 mice were injected i.p with 100 µg 4C12 or TL1A-Ig in 200 µl PBS on day 0. Blood samples were collected at time points 3 hr, 6 hr, 12 hr, and 1-8 days. After each collection, the sample was allowed to clot by leaving it undisturbed at room temperature for 30 minutes. The clot was removed by centrifuging the sample at 1,000 g for 30 minutes in a refrigerated centrifuge. The resulting supernatant (serum) was stored at 20°C for further analysis. A sandwich ELISA utilizing primary antibodies specific to Armenian hamster IgG and TL1A was performed to measure protein concentration at each time point. The observed half-life is 13.5 hours for TL1A-Ig and 4 days for the 4C12 antibody. The shorter half-life of TL1A-Ig requires daily injection but allows easy adjustment of desired serum levels. 2.3.2 TL1A-Ig induces rapid proliferation of CD4+FoxP3+ Treg cells in vivo We previously reported that TNFRSF25 stimulation by 4C12 rapidly expands preexisting Tregs in vivo (130). By the use of naïve FoxP3-reporter mice (FIR), we were able to continuously monitor the frequency and phenotype of the Treg population in peripheral blood following one i.p dose of 50 or 100 µg TL1A-Ig (Figure 29a). 20 100 µg IgG 15 10 µg TL1A-Ig 50 µg TL1A-Ig 100 µg TL1A-Ig b 10 5 0 0 5 60 %FoxP3+/Total CD4+ %FoxP3+/Total CD4+ a Time (d) 50 µg TL1A-Ig i.p 100 µg TL1A-Ig i.p 100 µg IgG i.v 50 µg TL1A-Ig i.v 100 µg TL1A-Ig i.v 40 30 20 10 0 10 100 µg IgG i.p 50 0 5 10 15 20 Time(d) Figure 29. TL1A-Ig stimulates rapid proliferation of CD4+FoxP3+ Treg cells in vivo. (a) The kinetics and dose-dependent expansion of Treg cells in peripheral blood was determined after a single i.p injection of titrating doses of TL1A-Ig (n=3) or IgG (n=3) in FIR mice. Mice were bled on indicated days and the percentage of peripheral Tregs relative to total CD4+ cell was determined by flow cytometry. (b) Comparison of in vivo expansion of Tregs determined as (a) after 3 consecutive i.v or i.p injections of IgG or TL1A-Ig. Data representative of 2 or more independent experiments, with 2 or more mice per group. All data are mean + SEM. 57 Due to the short half-life, a single dose of TL1A-Ig did not induce a 3-fold expansion of Tregs in the total CD4+ T cell population in the blood as observed with one 10 µg dose of 4C12. Maximal Treg expansion with TL1A-Ig was dependent on 3 consecutive doses of fusion protein with no difference between 50 or 100 µg TL1A-Ig i.p to see maximal responses (Figure 29b). The site of injection did not play a role in this expansion, as demonstrated by equivalent Treg expansion following TL1A-Ig injections either i.p. or i.v (Figure 29b). In vivo expanded TL1A-Ig-Tregs persisted in the peripheral blood examined for 2 weeks, slowly contracting to levels observed in unstimulated mice. To determine whether in vivo TNFRSF25 mediated Treg expansion is dependent on TCR signaling, we adoptively transferred purified CD4+ T cells harvested from FIR mice into MHC-II-deficient (CD74-/-) or CD4-/- mice. CD74-/- mice lack MHC IIantigen presentation and as a consequence also lack CD4+ T cells, while CD4-/- mice can present antigen via MHC II to adoptively transferred CD4+ cells including CD4+ Tregs. %FoxP3/Total CD4+ 15 Ig G T L 1 A -Ig 10 5 0 CD74-/- CD4-/Spleen CD74-/- CD4-/Lymph nodes Figure 30. TNFRSF25 mediated Treg expansion is dependent on MHC class II. (a) Ten million CD4+ cells were highly purified by FACS sorting from FIR mice and adoptively transferred into CD74-/- or CD4-/mice. After three days (Day 0), recipient mice were treated with 100 ug of TL1A-Ig or IgG followed by 2 consecutive doses on days 1 and 2. The percentage of FoxP3+ cells was analyzed in the spleen and pooled lymph nodes on day 6. Data representative of 2 independent experiments, with 2 or more mice per group. All data are mean + SEM. Two days after transfer (day 0), mice were treated from days 0 – 2 with 100 µg TL1A-Ig or isotype control IgG (Figure 30). Analysis on day 6 revealed no TL1A-Ig mediated CD4+FoxP3+ Treg expansion in MHC II deficient mice. In contrast, TL1A-Ig mediated potent Treg expansion in CD4-/- mice that are able to present MHC II antigens. Treg expanded even in the absence of extraneous TL1A-Ig suggesting TCR signaling 58 primarily at intestinal mucosal sites (Figure 30). These experiments indicate that MHC II is required for costimulation of Treg proliferation by TNFRSF25. These data imply that TCR signaling is a pre-requisite for TNFRSF25 costimulation, which is similar to the requirements that we observed for TNFRSF25 signaling for in vitro Tconv and Treg proliferation assays and the known requirement for TNFRSF25 signaling in Tconv (41, 152). 2.3.3 Long-term administration of TL1A-Ig maintains elevated Treg levels Daily administration of TL1A-Ig was able to sustain high Treg levels for over 20 days (Figure 31a) in the peripheral blood. Memory markers were also continuously monitored during the 20-day period that revealed an increase in effector memory Tconv cells (TEM) (CD62LlowCD44high) (Figure 30b), while central memory (TCM) markers (CD62LhighCD44high) were upregulated on gated CD4+FoxP3+Treg cell population as 50 b IgG *** %FoxP3+/Total CD4+ compared TL1A-Ig ** 40 ** 30 ** ** 20 * 10 0 0 5 10 15 20 25 30 to mice injected c 30 IgG TL1A-Ig 20 10 0 with %CD62LhighCD44high/Total Treg a 30c) %CD62LlowCD44high/Total Tconv (Figure 0 5 Time(d) 10 15 Time(d) 20 25 60 control IgG. IgG TL1A-Ig 40 20 0 0 5 10 15 20 25 Time(d) Figure 31. Daily injections of TL1A-Ig lead to sustained Treg expansion in vivo for over 20 days. (a) Treg expansion was monitored in the peripheral blood while administering daily i.p injections of 100 ug TL1A-Ig (n=4) or IgG (n=2) starting on day 0 and ending on day 20. Expression of central and effector memory markers CD62L and CD44 were determined on (b) FoxP3 – Tconv and (c) FoxP3+ Treg cells pre-gated on CD3+CD4+ cells. Statistical analysis was performed by unpaired two-tailed Student’s t-test (a). All data are mean + SEM. *P< 0.05, **P < 0.01, ***P < 0.001 versus control. 59 H&E staining of formalin fixed tissue sections from the heart, kidney, lungs, liver, and intestine harvested on day 5 from 3-day TL1A-Ig treated mice (data not shown) or analyzed on day 23 from 21-day TL1A-Ig treated mice did not indicate any cellular infiltration or tissue inflammation (Figure 32). TL1A-Ig IgG Heart 200x Kidney 200x Liver 200x Lung 200x Small Intestine 100x Large Intestine 100x Figure 32: H&E staining of tissue sections from mice injected daily with TL1A-Ig. B6 mice were injected i.p with 100 µg IgG or TL1A-Ig daily from day 0 to day 20 and the heart, liver, kidney, lungs, and intestine were harvested on day 23. Indicated tissue sections were H&E stained, 100-200x. 60 2.3.4 Characterization of T cell subsets in TL1A-Ig treated mice. In the course of examining the effect of TL1A-Ig on Tregs in vivo, we observed slightly enlarged spleens and lymph nodes in TL1A-Ig treated mice as compared to agematched IgG treated control mice (Figure 33a). The total cellularity increased slightly in the spleen, while we observed a significant increase in the total cell number harvested from inguinal, mesenteric, axillary and brachial pooled lymph nodes (LN) on day four after the first dose of TL1A-Ig. Flow cytometric analysis revealed significantly increased numbers of CD4+ T cells in the LNs and to a lesser degree in the spleen, while CD8 T cell yields were only slightly higher in LN and normal in the spleen (Figure 33b). Lymph nodes c Spleen 80 100 IgG TL1A-Ig 60 40 20 0 Tconv Treg *" Ig G T L 1 A -Ig Ig G T L 1 A -Ig Total CD3 CD4 CD8 cells Lymph nodes % Ki67+of T cell subset % Ki67+of T cell subset 100 Ig G Ig G T L 1 A -Ig Ig G T L 1 A -Ig Ig G T L 1 A -Ig Total CD3 CD4 CD8 cells ***" 20 0 T L 1 A -Ig 0 **" 40 T L 1 A -Ig 50 ****" 60 Ig G 100 80 T L 1 A -Ig 6 N o . C e lls ( 1 0 ) 150 Ig G TL1A-Ig 6 IgG Spleen b N o . C e lls ( 1 0 ) a 80 60 40 20 0 CD8 IgG TL1A-Ig Tconv Treg CD8 Figure 33. Characterization of T cell subsets in TL1A-Ig treated mice. (a) Spleen and pooled LNs (inguinal, mesenteric, axillary and brachial pooled LN) harvested on day 4 from FIR mice that were + injected i.p with 100 µg IgG or TL1A-Ig on days 0,1, and 2. (b) Absolute numbers of total cells, CD3 + + T cells, CD4 T cells, and CD8 T cells from spleen and pooled LNs from 8-12 weeks old age-matched IgG and TL1A-Ig treated mice as described in (a). The line represents the average absolute number from mice analyzed in 7 independent experiments. (c) Increased numbers of T cell subsets in TL1A-Ig + + treated mice as depicted by the frequency of proliferating (Ki67 ) Tconv, Treg, and CD8 T cells in the spleen and pooled LNs. Statistical analysis was performed by unpaired two-tailed Student’s t-test. . *P< 0.05, **P < 0.01, ***P<0.001 ****P < 0.0001. 61 The percentage of proliferating antigen Ki-67 expressing CD4+FoxP3+ Treg increased from 20% to 80% in the spleen and LNs. Only about 5% of CD4+FoxP3- Tconv cells and CD8+ T cells in IgG treated mice were Ki67+ and this ratio increased to 25% and 17% after TL1A-Ig treatment (Figure 33c). TL1A-Ig treated mice had normal frequencies of B cells, macrophages, dendritic cells (DC), natural killer cells (NK), and NKT cells (Table 2). Table 2: Leukocyte subsets with similar frequencies in IgG-treated and TL1A-Ig treated mice Cell Type IgG TL1A-Ig B cells (CD19+) 58% 56% Macrophages (F4/80+) 2% 3% Dendritic cells (CD11c high) 5% 6% NK cells (NK1.1+CD3-) 11% 16% 2% 2% NKT cells (NK1.1+CD3+) Total splenocytes were harvested from IgGtreated and TL1A-Ig-treated mice as in Figure 33. Listed frequency is the percentage of alive gated cells per total cells analyzed by flow cytometry. The frequency of memory CD4+ T cells (TM), including FoxP3-CD62LhighCD44high central memory CD4+ cells (TCM) and FoxP3-CD62LlowCD44high effector memory CD4+ cells (TEM), doubled IgG in spleen CD62L 5% 6% 12% LN (Figure IgG TL1A-Ig Spleen 78% and 34). TL1A-Ig Lymph nodes 53% 5% 77% 11% 31% 17% 2% 73% 5% 4% 11% 11% CD44 Figure 34. TL1A-Ig treatment increases expression of memory markers on Tconvs. Representative + flow cytometry plots and compilation of percentage of memory markers on CD4 FIR Tconv cells harvested from spleen and pooled LN from IgG and TL1A-Ig injected mice. 8-12 week old mice; the data are compiled percent averages of 5-7 mice per group from 2 independent experiments. 62 There was no significant difference in the expression of the activation marker CD69 on either CD4+ TM cell subsets in the spleens and LN of IgG or TL1A-Ig treated mice (data not shown). No differences in memory/activation markers were detected in the CD8+ T cell subset between the IgG and TL1A-Ig treated mice (data not shown). Since the intensity of an immune response is associated with the balance of Tconv to Treg, the Tconv:Treg and TM:Treg ratios were determined (Table 3). Together, these data suggest that treatment with TL1A-Ig in the absence of exogenous antigen resulted in the proliferation of FoxP3- CD4+ T conventional cells that may have previously encountered environmental and/or commensal antigens. As mentioned before, H&E staining of tissue sections from the heart, kidney, lungs, liver, and intestine harvested from 3-day (data not shown) or 21-day (Figure 32) TL1A-Ig treated mice did not indicate any cellular infiltration or tissue inflammation. Table 3. TL1A-Ig decreases Tconv: Treg ratio and (TCM + TEM):Treg IgG TL1A-Ig Tconv per spleen (no.) 8,048,067 7,201,228 TCM per spleen (no.) 299,608 575,196 TEM per spleen (no.) 1,074,847 2,369,402 Treg per spleen (no.) 1,350,559 5,121,313 Tconv:Treg ratio (TCM+TEM):Treg ratio 6.0 1.0 1.4 0.6 Total splenocytes were harvested as in Figure 32. Cell numbers were calculated by multiplying the number of cells obtained in a single-cell suspension of the spleen by the percentage of lymphoid gated cells per total cells analyzed by flow cytometry by the percentage of total Tconv, TCM (CD4+FoxP3-CD62LhiCD44hi), TEM (CD4+FoxP3-CD62LloCD44hi ), or Tregs within the lymphoid gated cell population. To determine the phenotype of TL1A-Ig expanded Tregs, we analyzed CD4+FoxP3+ cells from the spleen and lymph nodes harvested from TL1A-Ig or IgG control treated mice. TL1A-Ig treatment significantly increased the frequency of CD25int Treg population (Figure 35a) such that both CD25hi and CD25int Treg populations have similar frequencies (51% and 49% of the CD4+FoxP3+ gate). The expansion of the 63 CD25int Treg cells was not entirely unexpected since similar observations were reported after 4C12 a IgG administration TL1A-Ig 10% b c IgG d 53% (130). 71% 8% Ki67+CD25int Ki67+CD25hi CD4 IgG TL1A-Ig TL1A-Ig 14% 23% Ki67- 100 % of total CD4+FoxP3+ Treg FoxP3 21% 80 60 40 20 49% 63% -Ig 1A 32% Ig 51% TL 68% CD25 CD25 G 0 Ki67 FSC hi Figure 35. TL1A-Ig treatment leads to Treg expansion in vivo by inducing proliferation of CD25 int and CD25 Tregs . (a) FIR mice were treated with IgG or TL1A-Ig on days 0,1, and 2 and splenocytes were harvested on day 4 and analyzed by flow cytometry. Representative plots are shown. (b) + + + hi Representative dot plots were pre-gated on CD4 FIR Tregs and analyzed for Ki67 on CD25 and int CD25 Tregs. Percentages indicate the proportion of each phenotype of the total fraction of + + hi int CD4 FoxP3 Tregs. (c) Proportion of Ki67+ and Ki67– cells among CD25 and CD25 Tregs as in b. 8-12 week old mice; the data are compiled percent averages of 5-7 mice per group analyzed in 2 independent experiments. However, Schreiber et al. reported that majority of 4C12-expanded Treg comprised of CD25int cells. Flow cytometric analysis revealed approximately 3-fold increase in the expression of Ki-67 in both the CD25hi and CD25int Treg populations in TL1A-Ig treated mice compared to IgG controls (Figure 35b,c). An increase in αEβ7 integrin (CD103) and killer cell lectin-like receptor G1 (KLRG1) indicating activation was observed in FoxP3+ Tregs in spleen and LNs of TL1A-Ig treated mice (Figure 36a) (178-180), while the expression was unchanged in Tconv and CD8+ T cell subsets (data not shown). No differences were observed in the expression of CD127, CTLA-4, OX40, GITR, and 64 CD39 on FoxP3+ Treg between IgG and TL1A-Ig treated mice. We also found an increase in the frequency of splenic and LN FoxP3+ Treg with increased expression of Tcell memory markers in the TL1A-Ig treated mice as compared to IgG treated controls (Figure 36b). IgG a KLRG1 b CD103 6% 2% IgG 15% 19% TL1A-Ig Spleen 34% 13% 28% 26% 8% 20% 28% 44% 21% 7% 28% 32% 28% 41% CD62L TL1A-Ig Lymph nodes Spleen Lymph nodes 6% 25% 13% 31% 17% 40% CD44 Figure 36. TL1A-Ig treatment enhanced activation and memory formation of Treg cells. (a) + + Representative histogram plots (spleen) for KLRG1 and CD103 expression on CD4 FoxP3 Tregs in the spleen and pooled LN. Black: Spleen; Red: Pooled LN (b) Representative flow cytometric profiles + + and compilation of the percentage of memory markers as a percentage of CD4 FoxP3 Treg cells in spleen and pooled LN (8-12 week old mice; the data are compiled percent averages of 5-7 mice per group analyzed in 2 independent experiments). 2.3.5 FoxP3+ Tregs from TL1A-Ig treated mice are highly suppressive ex vivo To determine whether TL1A-Ig-expanded Tregs retain suppressive activity, we purified CD4+FoxP3+ Tregs from FIR mice on day 4 after i.p injections of either TL1AIg or IgG isotype control antibody on days 0, 1 and 2. These Treg cells were then cultured in proliferation assays in the presence of APCs and CD4+CD25- transgenic Tconv expressing a dominant negative mutant of TNFRSF25 (DN-TNFRSF25). DN TNFRSF25 Tconv are not costimulated in the presence of anti-CD3 and TL1A-Ig 65 (Figure 37a) in vitro. The Tregs from TL1A-Ig treated mice suppressed proliferation of CD4+CD25– cells to a greater degree than the Tregs from IgG treated mice (Figure 37b). To determine whether addition of TL1A-Ig during the suppression assay affects the suppressive activity of Tregs, similar assays were performed in the presence of TL1A-Ig and IgG1. The presence of TL1A-Ig partially recovered DN TNFRSF25 Tconv proliferation whether the Tregs were obtained from TL1A-Ig (Figure 37c) or IgG isotype control–treated mice (data not shown). Like 4C12, these data show that inhibition of Treg-suppressive activity by TL1A-Ig mediated TNFRSF25 signaling occurred in conditions in which only Tregs express a functional TNFRSF25, which shows that this effect is the result of signaling by TNFRSF25 on Tregs and not Tconvs. b 0 11::1 1 Unstimu- α-CD3 lated No Treg d 250 ns TL1A-Ig-Treg + IgG TL1A-Ig-Treg + TL1A-Ig 200 150 100 50 Treg:Tconv IgG Treg IgG Treg +TL1A-Ig TL1A-Ig Treg TL1A-Ig Treg+TL1A-Ig 200 150 100 50 16 1: 0 1: 16 1: 8 1: 4 1 2 8 1: 4 2 1: 0 Treg:Tconv 1: No Treg 1: 1: 1 0 1: 250 TL1A-Ig α-CD3+ TL1A-Ig CPM (103) c CPM (103) 50 50 0 0 CPM (103) 100 100 1: 1:4 4 1: 8 1: 1: 8 16 1: 16 20 150 150 1: 2 40 IgG-Treg TL1A-Ig-Treg 200 200 1: 60 250 250 CPM (103) WT Tconv DN TNFRSF25 Tconv CPM (103) CPM (103) 80 CPM (103) a Figure 37. Suppressive activity of in vivo expanded Tregs. (a) WT and DN-TNFRSF25 CD4+CD25Tconv were magnetically sorted and cultured in proliferation assays in the indicated conditions for 72 hrs. (b,c) Tregs were FACs sorted from TL1A-Ig and IgG injected mice (i.p days 0, 1 and 2) on day 4 and subjected to standard in vitro suppression assays using DN-TNFRSF25 CD4+CD25- cells as Tconv. (d) Tregs were FACs sorted from TL1A-Ig and IgG injected mice (100 ug i.p daily D0-D20 ) on day 23 and cultured in a suppression assay using wt CD4+CD25- cells as Tconv. (a-d) Cultures were stimulated with soluble anti-CD3 (0.5 µg/mL) and 1:1 wt APCs in the absence or presence of titrating numbers of IgG or TL1A-Ig-Treg. (a-d) IgG or TL1A-Ig was added to the suppression assay (0.1 3 µg/mL) where indicated. (a-d) H-thymidine was added for the last 6 hr of the 72 hr incubation period and incorporated isotope was measured by liquid scintillation counting. Data are mean ± SEM of triplicates. 66 Notably, Tregs expanded in vivo with daily injections of TL1A-Ig for 21-days and then subjected to in vitro suppression assays were highly suppressive for proliferation of w.t CD4+CD25- Tconv under conditions in which the TL1A-Ig was not present (Figure 37d). The addition of TL1A-Ig to the suppression assays also partly restored the proliferative capacity of the Tconvs. 2.3.6 Depletion of gut commensal bacteria by antibiotics treatment To test the hypothesis that elimination of gut commensal bacteria will abrogate TNFRSF25 mediated activation and proliferation of memory CD4+ T cells, mice were treated with an antibiotics cocktail for a month with subsequent TL1A-Ig administration. Briefly, mice were provided ampicillin (1 g/L), vancomycin (500 mg/L), neomycin sulfate (1 g/L), and metronidazole (1 g/l, Sigma) in drinking water from day -25 to day 5. On days 0-3 mice were treated with 3 consecutive doses of 100 µg of control IgG or TL1A-Ig a and sacrificed Antibiotics cocktail in drinking water Day -25 0 and b analyzed on day 5 (Figure 38a). Antibiotic-treated 5 IgG or TL1A-Ig Analysis: Flow Cytometry Figure 38. Antibiotics treatment protocol results in ceca dilation. (a) Schematic of the experimental design (b) Representative (TL1A-Ig treated mouse) gross anatomy of antibiotictreated mice later treated with IgG and TL1A-Ig and analyzed on day 5. The gross anatomy of IgG and TL1A-Ig treated mice was very similar and revealed a dilated ceca due to antibiotics treatment (181) (Figure 38b). The frequency of proliferation antigen Ki-67 expressing Tconv, Treg, and CD8+ T cells was higher in the pooled LNs and spleens of TL1A-Ig treated mice as compared to IgG treated mice (Figure 39a) similar to the observations with experiments done without treating mice with antibiotics (Figure 33c). 67 b 80 60 IgG TL1A-Ig Spleen IgG TL1A-Ig 40 20 0 80 60 Tconv Tregs CD8 Lymph nodes IgG TL1A-Ig 40 20 0 Tconv Tregs CD62L %Ki67+ of T cell subset %Ki67+ of T cell subset Lymph nodes Spleen a CD8 CD44 Figure 39. Antibiotics treatment does not abrogate TL1A-Ig mediated proliferation and activation of memory T cells. (a) Increased numbers of T cell subsets in TL1A-Ig treated mice as + + depicted by the frequency of proliferating (Ki67 ) Tconv, Treg, and CD8 T cells in the spleen and pooled LNs. (b) Representative flow cytometry plots and compilation of percentage of memory markers on CD4+FIR- Tconv cells harvested from spleen and pooled LN from IgG and TL1A-Ig injected mice treated as Fig. 38a. Data are compiled percent averages of 2-3 mice per group analyzed. Notably, treatment with antibiotics prior to costimulation with fusion protein increased the frequency of both TCM and TEM CD4+ T cell populations in the total CD4+ T cell population as compared to mice that were treated with IgG (Figure 39b). This outcome suggests that removal of microbiota in the gut does not influence TL1A-Ig mediated costimulation of memory CD4+ T cells. Increase in activation markers KLRG1 and CD103 (Figure 40a) and T cell memory markers (Figure 40b) on the FoxP3+ Treg population was observed in TL1A-Ig treated mice as compared to controls. 68 a b IgG KLRG1 5.6% 1.6% CD103 17.2% 36.5 11.7% 22.1% TL1A-Ig 45.6% 15.1% 5.0% 22.4% 37.9% 11.8% 29.1% 25.8% 37.3% Figure 40. Antibiotics treatment does not abrogate TL1A-Ig mediated Treg activation and formation of memory Tregs . (a) Representative histogram plots (spleen) for KLRG1 and CD103 expression on CD4+FoxP3+ Tregs in the spleen and pooled LN. Black: Spleen; Red: Pooled LN. (b) Representative flow cytometric profiles and compilation of the percentage of memory markers as a percentage of CD4+FoxP3+ Treg cells in spleen and pooled LN. Data are compiled percent averages of 2-3 mice per group analyzed. 2.3.7 TNFRSF25 costimulation and induction of ovalbumin specific Tregs in vivo Since our previous in vitro data suggested that stimulation through TNFRSF25 abrogates induction of iTregs from Tconv cells in the presence of cognate antigen, RA, and TGF-β, we wanted to determine if the same occurs in vivo. This protocol required the use of splenocytes from transgenic mice with MHC Class-II restricted T-cell receptors specific for ovalbumin (OTII mice) as a source for CD4+FoxP3- naïve T cells. Briefly, CD4+FIR-OTII (from FIR-OTII mice) and CD4+FIR+FoxP3+ nTreg (from FIR mice) were adoptively transferred i.v into congenic CD45.1 SJL mice on day -2. On day 0, all mice were treated i.p with ova/alum in combination with 100 µg IgG or TL1A-Ig on days 0-3 (Figure 41a). 69 a CD62L& OVA/ALUM %CD62L-CD44-/ Total OTII 300 1.5 15 200 1.0 10 100 0.3 1.0 0.2 50 0.5 2 1 0.1 Ig Ig G Ig A- TL 1 Ig G 0 TL 1 Ig Ig G ATL 1 Ig A- Ig G TL 1 0.0 A- 0 0.0 Ig 50 100 40 90 30 80 20 70 10 60 0 50 Ig 3 A- Ig TL 1 0.5 0.4 1.5 50 A- Ig G Ig ATL 1 150 2.0 Ig G A- Ig G TL 1 AIg TL 1 Ig G Ig 0 0.0 60 0 A- 0.0 0 70 10 Ig G 5 TL 1 0.5 Ig G mLN 80 TL 1 100 0.5 spleen 90 30 20 1.0 %EM OTII/Total OTII 100 40 2.0 1.5 %CM OTII/Total OTII Ig %Naïve OTII/Total OTII A- OTII Teff: iTreg CD44& Ig 2.5 Sacrifice 100 ug IgG or TL1A-Ig A- %iTreg/total OTII EM& Ig G b ///& TL 1 1.5 x 106 OTII-FIR0.5 x 106 nTreg-FIR+ 5 Ig G 0 CM& TL 1 -2 Naive& Figure 41. TL1A-Ig does not abrogate the induction of Tregs in vivo. (a) Schematic of the experimental design and markers on effector memory (EM) and central memory (CM) cells (b) IgG and TL1A-Ig treated mice were sacrificed on day 5 and harvested mLNs, pLNs (data not shown), and spleens were analyzed for the frequencies of ova-specific OTII Tregs (gated on CD45.1TCRα+β+CD4+FoxP3+) and ova-specific OTII Tconv (pre-gated CD45.1-TCRα+β+CD4+FoxP3-) memory subsets in the total OTII compartment. OTII specific Teff:iTreg ratios were also calculated. Data are mean ± SEM with each dot representing a value from one mouse. All mice were sacrificed on day 5, single cell suspensions were made from harvested mLNs, pLNs (data not shown), and spleens, and cells were analyzed for ova-specific OTII Tregs (gated on CD45.1-TCRα+β+CD4+FoxP3+) and ova-specific OTII Tconv (CD45.1-TCRα+β+CD4+FoxP3-) on memory subsets as defined in Figure 41a. Interestingly, TNFRSF25 costimulation given at the same time as cognate antigen (OVA) does not abrogate the induction of iTreg (Figure 41b). In the spleen, the % iTreg in the total OTII cell population was 1.0% in IgG treated mice, which significantly increased to 1.7% in the TL1A-Ig treated mice. TNFRSF25 stimulation by TL1A-Ig resulted in the reduction of the ovalbumin-specific Teff to Treg ratio in the spleen from 100 in control 70 IgG treated mice to 50 in TL1A-Ig-treated mice. These data indicate that in the presence of cognate antigen, TL1A-Ig mediated TNFRSF25 expansion of Tregs may effectively suppress an antigen-specific effector response as indicated by the skewing of the antigen specific Teff:Treg towards a regulatory phenotype and away from effector dominance. Although induction of iTregs was observed in the mLN, there was no difference in the %iTreg of total OTII cells or the ova-specific Teff:Treg ratio between IgG and TL1A-Ig treated mice. The percentage of TEM cells in the total OTII cell population increased in the spleens and mLN of TL1A-Ig treated mice. 2.3.8 Suppression of allergic lung inflammation by TL1A-Ig expanded Tregs We have shown previously that in vivo stimulation of TNFRSF25 by the agonistic antibody 4C12 expands Tregs in ovalbumin-sensitized mice resulting in suppression of allergic lung inflammation upon exposure to aerosolized ovalbumin (130). We sought to determine whether the activity of TL1A-Ig is sufficiently specific to Treg in the acute allergic lung inflammation model to prevent airway pathology. A modified therapeutic protocol was Day developed 5 OVA/ALUM i.p. based on the 10 findings 15 TL1A-Ig or OVA/PBS Aerosol IgG i.p. of 4C12 (Figure 42). 20 Analysis: BALF Histology Flow Cytometry Figure 42. Therapeutic protocol for the acute model of allergic lung inflammation. Naïve FIR mice were primed on day 0 and boosted on day 5 with ovalbumin adsorbed to ALUM adjuvant. Starting on day 11, ovalbumin-sensitized mice were injected with either TL1A-Ig or mIgG isotype control i.p for three consecutive days. Mice treated with 71 TL1A-Ig showed significant expansion of CD4+FoxP3+ Tregs in the peripheral blood, with a peak approximately 4-5 days after the first administration with TL1A-Ig or IgG (Figure 43a). On day 16, all mice were exposed to aerosolized ovalbumin in saline for 1 hour, and three days later, day 19, analyzed to evaluate the Tregs in the lungs and spleens. The frequency of FoxP3+ Tregs was significantly increased in single-cell suspensions of lung tissue and spleens of mice treated with TL1A-Ig (Figure 43b). b Lung 60 40 20 g -I A 1 L T 4 3 2 *** 1 g -I G A g A -I G T 1 L L e 1 ro Ig l. 0 so g A G l. ro e -a n o N 0 Lung 5 T c o n v :T re g 50 -I G * 100 L Ig so g A 1 L T 150 1 Ig T d o N N o n -a e ro so l. 0 20 -I G l. Ig so ro e -a n o N 4 ns 50 N o . T re g c e lls (1 0 ) 100 40 0 Lung -a 150 *** 60 n 4 N o . T c o n v c e lls (1 0 ) Lung 80 0 11 12 13 14 15 D a y s a fte r O V A /a lu m c T o ta l C D 4 *** 80 % FoxP 3+/ 25 T o ta l C D 4 % FoxP 3+/ 50 0 Spleen 100 100 T Ig G T L 1 A -Ig Ig Blood 75 T o ta l C D 4 + % FoxP 3+/ a Figure 43. TL1A-Ig mediated Treg expansion in the peripheral blood, lungs and spleens. (a) + + Peripheral blood was collected and analyzed for FoxP3 cells gated in CD4 T cells from OVA/alum immunized mice treated with either control IgG or TL1A-Ig on days 11, 12, and 13. Black arrows indicate injection of IgG or TL1A-Ig. (b) Total lung cells and splenocytes were harvested and analyzed + + for the frequency of FoxP3 Treg cells in the CD4 T cell compartment on day 19. (c) The total + numbers of CD4 FoxP3 Tconv and CD4+FoxP3+ Tregs in the lung tissue. (d) TL1A-Ig decreases Tconv/Treg cell number ratio in the lung tissue. Data are mean ± SEM of 2 independent experiments with each dot representing a value from one mouse (n=6-8). *P < 0.05 ***P < 0.001, 1-way ANOVA with Tukey post-test. Treg analysis in the lung tissue revealed that the frequency of Treg cells was 66% of all CD4+ T cells in TL1A-Ig treated mice as compared to 25% in control IgG-treated mice. The number of CD4+FoxP3- Tconv cells within the lungs was similar between control 72 IgG and TL1A-Ig treated mice, while in TL1A-Ig treated mice the number of Tregs was significantly increased (Figure 43c). Several studies have reported that the balance between Tconv to Tregs is a better determinant of disease pathogenesis rather than the absolute number of Treg cells (182, 183), hence the Tconv:Treg ratio was calculated in the lung tissue (Figure 43d). The average Tconv:Treg ratio in the lung tissue decreased from 2.8 to 0.5 in TL1A-Ig treated mice. Analysis of BALF recovered from TL1A-Ig mice sacrificed on day 19 resulted in observations similar to treatment with anti-TNFRSF25 antibody, 4C12 (130). IgG control-treated mice showed significant eosinophilia in the total cells recovered from BALF as compared to TL1A-Ig treated mice, both in the percentage and absolute number of eosinophils recovered (70.4% of BALF and 400x103 cells, Figure 44). In mice that were treated with TL1A-Ig, analysis of BALF showed a significant decrease in both the percentage and number of eosinophils recovered, as compared to IgG control-treated (17.2% 60x103 and cells, *** 25 0 .5 * e -a g -I G A 1 L ro A 1 L T o N N o n n T l. so g -I G Ig so ro e 1 .0 0 .0 l. 0 -a 1 .5 6 in B A L F (1 0 ) T o ta l e o s in o p h ils 75 50 44). BALF 100 in B A L F % e o s in o p h ils BALF Figure Ig mice Figure 44. TL1A-Ig treatment reduces eosinophils in the BALF. Bronchiolar lavage fluid was harvested 3 days(day 19) after aerosolization with OVA/PBS, The percentage (left) and absolute number (right) of eosinophil are shown. *P < 0.05, ***P < 0.001, 1-way ANOVA with Tukey post-test. n=6-8 To determine whether the therapeutic expansion of Tregs by TL1A-Ig prior to allergen aerosol affects histopathology, formalin-fixed lung sections from control and 73 TL1A-Ig treated mice were obtained for histology on day 19. H&E and PAS staining of lung tissue revealed reduced lymphocyte infiltration and airway mucus secretion in TL1A-Ig-treated animals as compared to OVA sensitized/aerosolized IgG-treated mice (Figure 45a). PAS staining is a marker for mucus production in goblet cells. Quantification of images from PAS-stained slides using ImageJ software showed a large number of PAS positive cells within the bronchiolar epithelium in control IgG treated mice as compared to TL1A-Ig treated mice that showed significant reduction in the number a of positive cells (Figure 45b). b IgG TL1A-Ig 100 H&E 200x No. PAS+ Cells Saline Aerosol PAS *** 80 60 40 20 nv PAS 200x O O VA VA / /P PB PBS BS S + + I TL gG 1A -Ig 0 Figure 45. TL1A-Ig treatment reduces lymphocyte infiltration and airway mucus secretion in the lungs (a) Images from formalin fixed and paraffin embedded lung sections from OVA sensitized/aerosolized mice treated with IgG or TL1A-Ig and analyzed on day 19. Representative H&E and PAS image at 200x for each treatment group. (b) Images from PAS stained lung sections were quantified using Image J software as described in Methods. The number of PAS positive cells per bronchiole in IgG and TL1A-Ig treated mice is shown. 2 or more representative images were quantified from each treatment group. 2.3.9 Prolongation of allogeneic skin transplant by TL1A-Ig expanded Tregs Recently much effort has been focused on targeting TNF members as therapeutic agents in transplantation. Dr. Wolf et al. reported that TNFRSF25 mediated expansion of endogenous Treg population by 4C12 prior to transplantation results in prolongation of cardiac allograft survival in a mouse model of fully major histocompatibility complexmismatched ectopic heart transplants (146). We were then interested in testing the 74 efficacy of TL1A-Ig in a stringent murine allogeneic skin transplantation model. Although several immunosuppressive therapies are available, acute rejection is prevalent in many patients that receive composite tissue allografts (CTAs). The skin is usually the first, if not the only tissue, to reject, making it the most difficult component of a CTA. To test if pre-treatment with TNFRSF25 agonists can prolong survival of a full mismatch skin transplant, recipient B6 mice were injected with one 10 ug dose of 4C12 (day -4) or daily 100 ug dose of TL1A-Ig (day -4 until day of graft rejection) (Figure 46a). a Day -4 0 5 15 10 Hamster IgG or 4C12 mIgG or TL1A-Ig Remove bandage Analyze for Treg frequency in blood Allogeneic skin transplant Balb/c!B6 100 Percent survival b P=0.04& hamster IgG 4C12 mouse IgG mTL1A-Ig 80 60 *P=0.04& *P=0.04& 40 20 0 0 5 10 15 20 Graft survival (Days) Figure 46. TNFRSF25 agonists prolong allogeneic skin grafts. (a) Protocol for the allogeneic skin transplant model. FIR (C57BL/6 background) mice were injected with control antibody or TNFRSF25 agonists (20 µg hamster IgG or 4C12 or 100 µg mIgG or TL1A-Ig i.p) on days indicated. In vivo Treg levels were determined on day 0 and allogeneic (Balb/c) ear skin was grafted onto the right thorax of control and TNFRSF25 agonist treated recipients. Bandages were removed on day 6 and skin grafts were monitored for rejection. TL1A-Ig was administered daily until the day of rejection. Grafts were scored as rejected when more than 75% of the grafted tissue area had been lost. (b) Survival curves of mice undergoing allogeneic skin transplants . On day 0 (day of transplantation), mice were bled and the frequency of endogenous Treg in the 4C12 and TL1A-Ig treated mice was confirmed to be 30-35% of the total CD4+ cell population. The median graft survival for 4C12 and TL1A-Ig treated mice, determined by visually observing donor skin necrosis, was 14 and 13 days, respectively (Figure 46b). 75 This median survival was significantly longer than median survival of 8 days for IgG controls (p=0.04). Daily TL1A-Ig treated mice maintained an elevated endogenous Treg population on day 9 post-transplantation (data not shown), however, the larger Treg population did not prolong graft survival as compared to 4C12 treated mice. CHAPTER 3: Discussion The importance of Tregs in the control of several disease settings, including autoimmunity, asthma, allergy, and transplantation, is very well established. Tregs have the capacity to actively block immune responses, inflammation, and tissue destruction by suppressing the function of various cell types including CD4+ effector T cells, B cell antibody production and affinity maturation, CD8+ CTL granule release, and APC function and maturation state (184-186). Several pharmacological and cellular therapies have been investigated that shift the overall balance in the immune system to favor Treg mediated immune regulation. Some of the drugs used and being developed promote Treg development and survival in vivo, while others target the cells themselves, using therapeutic approaches to isolate and expand polyclonal or antigen specific Tregs for immunotherapy. These approaches have important implications in the potential use of drug therapy that promote Treg in patients with autoimmunity or allergy and adoptive transfer of Tregs to correct an immunological balance or promote survival of future transplanted tissues. TL1A-Ig mediated in vivo Treg expansion and maintenance of the immunosuppressive functional cell subset with daily injections circumvents the need to expand Tregs in vitro for cellular therapy, an approach that may be problematic due to practical limitations in the isolation and expansion of sufficient numbers of these cells for clinical use. The majority of therapeutic approaches to enhance immune regulation have focused on generalized immunosuppression rather than targeting Treg specific markers with heterologous antibodies (non-human derived products) that result in undesirable side effects such as serum sickness and depletion of multiple cell types resulting in prolonged 76 77 lymphophenia. Efforts have been focused on designing monoclonal antibodies targeting cell specific markers including studies of humanized mAbs directed at the CD3-ε chain of the TCR complex. Anti-CD3 treatment altered the Teff/Treg ratio balance through a combination of activation induced cell death of Teff cells, selective inactivation of Th1 cells (187, 188), while sparing nTregs and TGF-β dependent iTregs (189). However, treatment with such targeting reagents leads to depletion of most lymphocytes that results in uncontrolled global immunosuppression. Our laboratory’s previous study showed that in vivo administration of TNFRSF25-agonist 4C12 induced the proliferation of preexisting Tregs, and similar observations with the TL1A-Ig fusion protein support the hypothesis that specific TNFRSF25 signaling mediated the expansion of Tregs to therapeutic levels, and this phenomenon is not a consequence of unexpected off-target effects of 4C12. However, the non-antigenic fusion protein has an advantage over heterologous 4C12 since repeated administration of TL1A-Ig maintains elevated Treg levels in vivo. Unlike 4C12, hexameric TL1A-Ig may be able to crosslink multiple TNFRSF25 receptor complexes that enhances TNFRSF25 signaling allowing the fusion protein to induce Treg proliferation in vitro. A summary of comparative studies of 4C12 and TL1A-Ig indicates that both TNFRSF25 agonists have varying outcomes in vitro and in vivo (Table 3). Similarly, OX40 agonist antibody, OX86, has also been reported to expand Tregs in naïve mice (190) yet fails to induce Treg proliferation in vitro (124). Studies have suggested that TNF agonist antibodies and ligands can stimulate different components of the signaling pathway (166) or totally different signaling pathways (165), hence there are limitations of studying physiological pathways using receptor agonist antibodies. 78 Table 4: Summary of comparative studies of 4C12 and TL1A-Ig Similarities Differences In vitro In vivo 1. Block de novo biogenesis of induced Tregs 1. 2. Induce caspase activation and apoptosis in TNFRSF25-transfected cells Mediate in vivo expansion of Tregs such that they become 30-35% percent of the total CD4+ T cells 2. Do not expand Tregs in MHC II deficient mice, indicating requirement of TCR activation prior to TNFRSF25 costimulation 3. In vivo expanded Tregs are highly suppressive for Tconvs proliferation ex vivo 4. Therapeutic pre-expansion of Tregs in vivo p r o t e c t s m i c e a g a i n s t a l l e rg i c l u n g inflammation 1. TL1A-Ig in combination with IL-2 induces 1. the proliferation of polyclonal and induced Tregs. Unlike 4C12, daily injections of TL1A-Ig maintains elevated levels of Tregs for at least 20 days. 2. TL1A-Ig in combination with anti-CD3 and 2. IL-2 induces the proliferation of Tconvs. 3. 4C12 fails to induce proliferation of CD4+ T cells. Unlike 4C12, TL1A-Ig administration significantly increases cellularity and absolute numbers of CD3+, CD4+ and CD8+ cells in lymph nodes. 3. Unlike 4C12, TL1A-Ig treatment increases expression of activation markers and memory markers on both Tconvs and Tregs in the spleen and lymph nodes. The explanation may be because of the qualitative differences between the agonist antibody and the natural ligand. The ligand aggregation model and the crystal structure of TL1A (191), suggests that ligand aggregates or clusters three receptor fragments, resulting in strong stimulation that activates intracellular effector molecules. Based on structural studies, the receptor-binding interface appears to involve the inner surface of the groove formed between two adjacent TNFRSF25 subunits. The ligand interacts with the receptor in a symmetrical fashion, where the receptor runs parallel to the ligand with the face-to-face interaction surfaces are distributed evenly along the upper and lower parts of the ligand (171, 172) whereas, the agonist antibody is expected to aggregate as many as two adjacent receptors back-to-back resulting in a different 3-dimensional interaction. According to our hydrodynamic analysis, the TL1A-Ig construct is a dimer of 79 TL1A-trimers. Each trimer will be able to interact with each subunit of TNFRSF25 and crosslink two receptor complexes. This difference in binding sites and ability to crosslink may account for some of the differences observed between TL1A-Ig and 4C12 in vitro and in vivo. Both TNFRSF25 agonists induced apoptosis in transfected tumor cells overexpressing TNFRSF25. TL1A-Ig, however, is effective at a 100-fold lower concentration, suggesting higher affinity and/or effects of cross-linking. To evaluate the requirements of TL1A-Ig mediated proliferation of CD4+T cells in vitro, highly purified CD4+CD25- Tconv or CD4+FoxP3+ Treg cells were cultured in several different conditions. We demonstrated that 4C12 is a poor costimulator of antiCD3 activated CD4+ Tconv in vitro, while TL1A-Ig is quite effective with soluble antiCD3. As reported previously, 4C12 does not costimulate proliferation of Treg in vitro while TL1A-Ig is quite potent, however strictly in dependence of added IL-2 and TL1AIg. In contrast, both the agonist antibody to GITR and Fc-GITRL fusion protein (14) function as costimulatory molecules for T-cell activation in vitro since the GITRL associates and activates GITR as a dimer (192) and not a trimer. An interesting extension of TNFRSF25 studies is to determine if the addition of 4C12 crosslinking antibodies results in proliferation of both Tconv and Treg in vitro. Interestingly, TL1A-Ig mediated Treg proliferation occurred in the absence of soluble anti-CD3 and was abrogated with the addition of cyclosporine A. Moreover, “resting” Tregs proliferate more robustly in the presence of soluble anti-CD3, IL-2, and TL1A-Ig as compared to IL-2 and TL1A-Ig only. These observations suggest that prior TCR signaling by self-antigens was maintained in Treg cells that enabled subsequent TNFRSF25 mediated proliferation in vitro. An alternative approach to test this hypothesis is to determine whether the proliferation of 80 freshly isolated antigen-specific CD4+Foxp3+ OTII Tregs is dependent on the presence of OVA in addition to IL-2 and TL1A-Ig in culture. In vivo we find that both 4C12 and TL1A-Ig potently costimulate CD4+FoxP3+ Treg expansion with similar kinetics. As suggested by the increase in the ratio of the CD4+FoxP3+CD25hi Treg to CD4+FoxP3+CD25int, the majority of Ki67+ cells were CD4+FoxP3+CD25int in mice treated with TL1A-Ig. However, TL1A-Ig mediated expansion of CD25int cells (49% of CD4+FoxP3+ Treg gate) was not as robust as reported with 4C12 treatment (75% of CD4+FoxP3+ Treg gate) (130). Unlike 4C12, approximately 3-fold increase in Ki67 expression was observed in both CD25hi and CD25int Treg populations with TL1A-Ig treatment. TL1A-Ig and 4C12 treatment resulted in a smaller portion, 14% and 27% of total CD4+FoxP3+ Treg cells respectively, that did not stain for Ki67. It is unclear whether the relative boost in CD25hi Treg cells proliferation following TL1A-Ig treatment as compared to 4C12 treatment was due to the availability of IL-2 produced by proliferating Tconv, which was not observed with 4C12 administration. To evaluate whether in vivo TNFRSF25-induced Treg proliferation was dependent upon TCR engagement with MHC class II, total CD4+ T cells (comprising of 10% FoxP3+ Treg) were adoptively transferred into MHC II deficient mice and treated with TL1A-Ig. In vitro and in vivo abrogation of fusion protein mediated Treg proliferation due to disrupted signaling downstream of TCR (with cyclosporine) or the absence of MHC II implicates that TCR recognition of self-antigen is a prerequisite to TNFRSF25 costimulation. Our observations using both TNFRSF25 agonists, TL1A-Ig and 4C12, 81 complement data reporting that TNFRSF25 signaling mediates activation and proliferation of both opposing cell types, Tconv and Treg, in the presence of cognate antigen (41, 106, 130, 152). Self-peptide activated Treg cells were costimulated in vivo by 4C12 in the absence of foreign antigen, while treatment with TL1A-Ig simultaneously expanded a population of CD4+ T memory cells (TM). Meylen et al. reported that transgenic overexpression of TL1A on T cells results in the spontaneous development of inflammatory small bowel pathology. To determine whether the costimulation and intestinal inflammation triggered by TL1A is dependent on T cells recognition of microflora or other environmental mucosal antigens, they restricted the T cell repertoire of TL1A transgenic mice to a monoclonal specificity by back-crossing the CD2-TL1A transgenic line (transgenic overexpression of TL1A on T cells) to the OT-II ovalbumin specific TCR transgene. Transgenic expression of TL1A in this background was not able to increase the percentage of memory T cells and revealed a significant amelioration of TL1A-dependent intestinal changes (128). These observations and our data indicating costimulation of TM cells after TL1A-Ig injections in vivo support two hypothesis: 1) TL1A-Ig mediates a stronger signal through TNFRSF25 as compared to 4C12, inducing TM costimulation with suboptimal TCR activation provided by low concentration of microbial/environmental antigens. Our in vitro Tconv proliferation assays also report that TL1A-Ig, and not 4C12, induces the proliferation of Tconv that is dependent on soluble anti-CD3. 2) TL1A-Ig treatment results in a larger and more immunosuppressive Treg population that interferes with TM expansion and function. The absolute numbers of Treg, total Tconv, TCM and TEM in response to TL1A-Ig stimulation in mice clearly reveal that Treg expand more extensively than Tconv resulting in a reversal in the (TCM+TEM):Treg 82 and Tconv:Treg ratio in favor of Treg. Although memory CD4+ T cells proliferate due to TL1A-Ig, this effect is more than off-set by the larger Treg proliferation and expansion resulting in an overall immunosuppressive effect of TL1A-Ig administration in vivo as shown in the acute lung inflammation model. Additionally, we did not observe any physical signs of inflammation, such as weight loss, diarrhea, or dermatitis in naive mice that were treated with TL1A-Ig with 3 daily consecutive doses or daily for a 20-day period. Histopathology also failed to detect cellular infiltration or inflammation in any organ. In studies investigating suppressive activity in vitro, Tregs harvested from TL1AIg injected mice significantly abrogated the proliferation of Tconv cells. An increase in αEβ7 integrin (CD103) and killer cell lectin-like receptor G1 (KLRG1) indicating activation, as well as, T-cell memory markers, were also observed in FoxP3+ Tregs in the spleen and LNs of TL1A-Ig treated mice (178-180). To test the hypothesis that elimination of gut commensal bacteria will abrogate TNFRSF25 mediated activation and proliferation of memory CD4+ T cells, mice were treated with an antibiotics cocktail prior to treatment with TL1A-Ig and subsequent analysis of memory CD4+ T cells in the spleen and lymph nodes. Interestingly, Bollyky et al. reported that they were able to culture limited numbers of viable fecal bacteria four weeks after the initiation of antibiotics (193). The persistence of memory CD4+ T cell costimulation with TL1A-Ig administration may be explained by activation provided by the remaining commensal bacteria in the gut that are sufficient for subsequent TNFSF25 costimulation. Furthermore, there has been extensive debate about the role of persisting antigen required for the maintenance of CD4+ T cell memory (194, 195) and it is now generally accepted that memory CD4+ T cell maintenance is antigen-independent. Hence 83 it is possible that depletion of commensal antigen does not affect the costimulation ability of pre-existing CD4+ memory T cells. An interesting extension of these studies would be the treatment of OTII Rag -/- transgenic mice with TL1A-Ig and analyzing the absolute counts and activation status of ova-specific CD4+ OTII cells. We would expect the expansion of self-peptide activated natural Treg without costimulation of CD4+ Tconv cells. In the iTreg induction studies, we sought to address whether costimulation of TNFRSF25 abrogates the generation of iTregs. In vitro, activation of naïve CD4+ T cells by anti-CD3 or specific antigen in the presence of TGF-β, retinoic acid (RA) and IL-2 results in the induction of FoxP3 in a substantial proportion of cells. Our studies indicate that Foxp3 induction is partially suppressed by the TNFRSF25-agonist 4C12 and more completely by TL1A-Ig similar to OX40L (119, 120, 176). We also examined the role of TNFRSF25 costimulation in the induction of Treg in vivo. In these studies antigen specific CD4+FoxP3- Tconv cells were adoptively transferred into recipient mice that were subsequently treated with OVA/ALUM and TL1A-Ig or IgG. Surprisingly, there was induction of iTreg in mice treated with TL1A-Ig although the cognate antigen and TNFRSF25 costimulation were provided at the same time. Moreover, the frequency of splenic iTreg in the total CD4+ T cell population was higher in TL1A-Ig treated mice compared to IgG treated controls suggesting that TNFRSF25 costimulation also induced proliferation of newly generated iTregs. The discrepancy between in vitro and in vivo observations may be explained by the 2-day hiatus between the last dose of TL1A-Ig (day 2) and analysis (day 5) that could have resulted in TL1A-Ig depletion in the Tconv cell microenvironment permitting TGF-β dependent iTreg induction and proliferation. An 84 extension of investigating requirements for TNFRSF25 abrogation of Treg induction is to determine an in vivo treatment schedule that will replicate conditions maintained in vitro. The murine asthma studies, performed in collaboration with Dr. Matthew Tsai, indicate that both agonists, 4C12 (130) and TL1A-Ig, work similarly in the presence of foreign antigen. In allergic lung inflammation, an inflammatory disease that is mainly driven by CD4+ T cells (144, 145), treatment with either TNFRSF25 agonists prior to airway antigen challenge (ova aerosolization) induced the preferential accumulation of Tregs, but not Tconvs, within the lungs and reduced eosinophilia and mucus production in the bronchoalveolar space. There was no significant difference in the absolute numbers of Tconv population in the lungs of ovalbumin-sensitized mice treated with TL1A-Ig or IgG and analyzed 3 days after aerosolization. These observations are consistent with 4C12 treated mice compared to hamster isotype control treated IgG mice (130), suggesting that TL1A-Ig, like 4C12, administered during non-inflammatory setting specifically induces a 4.6-fold induction of Treg cells without increasing the absolute number of Tconv cells in the lungs, resulting in a lower Tconv:Treg ratio predictive of reduced disease pathogenesis (182, 183). Since the mice were exposed to OVA antigen prior to and post treatment with TL1A-Ig, we were expecting that TCR signals provided by OVA antigen will permit TNFRSF25 mediated Tconv costimulation. However, that was not the case. The preferential expansion of Tregs and not Tconv may be accountable by the following possibilities: 1) Induction of antigen-specific Tregs after OVA/ALUM priming can (directly or via dendritic cells) interfere with subsequent Tconv proliferation. 2) OVA antigen was completely cleared or at present at very low concentration that may 85 be insufficient for Tconv costimulation, while polyclonal Tregs are continuously TCRactivated with self-peptide. 3) Tregs maintain TCR-activation/signaling from prior stimulation for a longer period of time as compared to Tconv, hence giving them a “head” start when costimulated by TL1A-Ig subsequently. This possibility is similar to possibility 2 since it suggests a lower TCR-activation threshold for TNFRSF25 costimulation. Possibility 3 is supported by our polyclonal in vitro Treg assays showing that TL1A-Ig mediated proliferation of Treg cells is only dependent on IL-2 and TL1A-Ig and is abrogated with cyclosporine suggesting residual TCR-activation from in vivo selfantigen exposure. Currently we have ongoing experiments to investigate the affect of TL1A-Ig on antigen specific CD4+ T cell memory response and tolerance induction. We hypothesize that ova-sensitized mice treated with TL1A-Ig will have a reduced/non-existing ovaspecific Tconv memory response, resulting in an ova-specific Tconv:Treg ratio favoring a regulatory over inflammatory phenotype. Briefly, highly FACs purified CD45.2 OT-II cells were adoptively transferred i.v into congeneically marked CD45.1 mice on day -2. On days 0 and 5 mice were immunized with OVA/ALUM followed by treatment with control IgG or TL1A-Ig on days 12, 13 and 14. Mice were allowed to rest until day 40 on which they were immunized with OVA/ALUM. On day 45, mice were sacrificed and the peripheral lymph nodes, mesenteric lymph nodes, and spleens were harvested for analysis. Although the transferred transgenic OTII cells were detectable in the peripheral blood on day 5 after the second treatment with OVA/ALUM, we failed to detect OTII cells on the final day of analysis (day 45). We will therefore utilize magnetic bead 86 separation instead of FACs sorting to isolate the CD45.2 OTII to increase number and quality of cell transferred into recipients. In the murine model of allogeneic skin transplantation, we sought to determine whether the in vivo expansion of Treg by administration of TNFRSF25 agonist, 4C12 or TL1A-Ig, prior to transplantation prolongs the survival of an allogeneic skin transplant. Recent studies in our lab reveal that TNFRSF25 mediated expansion (by 4C12) of endogenous Treg population prior to transplantation results in prolongation of cardiac allograft survival in a mouse model of fully major histocompatibility complexmismatched ectopic heart transplants (146). In the allogeneic skin transplant model, TL1A-Ig and 4C12 mediated expansion of Tregs was associated with a significant prolongation of median graft survival from 8 days to 15 days. Daily administration of TL1A-Ig post transplantation maintained elevated level of Treg in vivo, however, they did not extend the graft survival as compared to 4C12 treated mice. There is increasing evidence suggesting that lack of vascularization of skin allografts at the time of their placement is responsible for increased immunogenicity of these grafts by favoring skin dendritic cell trafficking via lymphatic vessels that migrate to draining lymph nodes and activate T cells, while preventing some regulatory immunity requiring blood circulation. It is possible that alloantigen specific effector T cells compete with TNFRSF25-expanded Treg to the graft site and augment inflammation caused by an earlier innate immune response. It is likely that combination therapy using TL1A-Ig with reagents that block effector T cell activation and proliferation, such as rapamycin, may provide therapeutic benefit in allogeneic skin transplantation. The functional efficiency of TL1A-Ig in murine models can readily be translated 87 for human disease by constructing human TL1A-Ig in an analogous fashion. Rigorous experimental verification to that effect is ongoing in mice with a human immune system to determine whether human TL1A-Ig is sufficiently Treg-specific in vivo to warrant further clinical development. Since these studies require a large quantity of TL1A-Ig, we have established the mammalian cell lines using the GS gene as a selection and amplification marker. Bebbington et al. (170) first reported the use of this selectable marker in myeloma cells in which transfectants, expressing GS and a chimeric antibody, were selected by culturing in a glutamine-free medium. Subsequently, vector amplification was selected by adding glutamine synthetase inhibitor, MSX. Other popular cell lines used for the production of antibodies and recombinant proteins include NSO (mouse myeloma cells), CHO (chinese hamster ovarian cells), and HEK-293 (human embryonic kidney cells). We have created this technology in our laboratory using CHO cells and selected high producing clones that can accumulate up to 4.4g/L of TL1A-Ig in a hollow-fiber cartridge system. Because TNFRSF25 signaling has the unique ability to expand and transiently inhibit Treg suppressive function, we are also investigating the potential use of this reagent in modulating immune responses in disease models of transplantation, autoimmune disease, chronic infection and cancer to benefit clinical outcome. CHAPTER 4: Material and Methods 4.1 Mice Wild-type C57BL/6 mice were purchased from Jackson Laboratories. The FoxP3 reporter mice on C57BL/6 background (FIR mice) were bred in our animal facility (provided by R. Flavell, Yale University, New haven, Connecticut, USA; ref (175)). Congeneic CD45.1 SJL, CD4-/-, CD74 -/-, OTII, and Balb/c mice were also bred in our animal facility. Mice were used at 6-12 weeks of age and were maintained in pathogen-free conditions at the University of Miami animal facilities. The University of Miami Animal Care and Use Committee approved all the animal procedures used in this study. 4.2 Antibodies and reagents Intracellular Ki67 and FoxP3 stainings were performed using mAb and fixation/permeabilization reagents from eBioscience (San Diego, CA). IgG isotype controls were purchased from BioLegend (San Diego, CA). All commercial antibodies used for flow cytometry staining were purchased from eBioscience, BD BiosciencesPharmingen (San Jose, VA), Biolegend, and Jackson ImmunoResearch (West Grove, PA). Recombinant mouse IL-2 was purchased from R & D systems (Minneapolis, MN). Armenian hamster hybridoma producing antibody to mouse TNFRSF25 (agonist 4C12) was maintained as described previously (106). 4C12 (anti-TNFRSF25 agonist) and L4G6 (anti-TL1A blocking mAb) were produced in hollow fiber bioreactors (Fibercell Systems) and purified from serum-free supernatants on protein G column using PBS for elution. Cyclosporin-A was purchased from Calbiochem/EMD. 88 89 4.3 Plasmid Construction The mTL1A cDNA was purchased from OriGene. Varying lengths of the mTL1A were PCR amplified using primers that were located upstream and downstream of the cloning sites. All constructs had downstream primer 5’CATGCGGCCGCAATA TCGTTCTT-3’ paired with a unique upstream primer for each construct: TL1A-Ig full (65-252 aa): 5’CATGAATTCCGGGTCCCCGGAAAAGACTG-3’, TL1A-Ig -3aa(68252 aa): 5’- CATGAATTCGGAAAAGACTGTATGCTTCG-3’, TL1A-Ig -5aa (70-252 aa): 5’- CATGAATTCGACTGTATGCTTCGGGCCAT-3’, and mTL1A-Ig -11aa (76252 aa): 5’CATGAATTCATAACAGAAGAGAGATCTGAGCC TTCACC 3’. The mouse IgG kappa chain leader sequence was ligated to the 5’end of the cDNA encoding the Fc portion of murine IgG1, containing the hinge, CH2, and CH3 regions. IgG1 had been mutated to replace the three cysteines of the hinge portion to serines (169), with the aim of reducing the antibody-dependent cellular cytotoxicity (ADCC) that can occur due to binding of IgG1 to Fcγ receptors (196). Each of the four TL1A PCR amplified products mentioned above were ligated to the 3’end of the cDNA encoding the Fc mIgG1 fragment, resulting in four final constructs containing the leader sequence, hinge-CH2CH3, and TL1A ECD. The final TL1A-Ig cDNA was cloned into the pBMGs-neo expression plasmid (pBMGs-neo-TL1A-Ig). The correct primary structure was verified by sequencing for each construct. The -3aa ECD TL1A-Ig (aa 68-252) cDNA and murine glutamine synthetase (mGS) cDNA were inserted into two independent expression cassettes of the plasmid pVitro2-hygro (Invivogen) using the PCR strategy. Briefly, SGRA1 and NHE1 restriction sites were added to the flanking regions of TL1A-Ig-3aa in the pBMGs-neo-TL1A-Ig 90 expression plasmid. TL1A-Ig was cut, and ligated into the second multiple cloning site of pVitro2-mGS, which had the mGS cDNA inserted in the first multiple cloning site (pVitro2-GS-TL1A-Ig expression plasmid). The mGS cDNA was purchased from OriGene, and the open reading frame (ORF) was PCR amplified with primers containing the MLU1/SAL1 restriction sites. 4.4 Cells and Culture Conditions 3T3-NIH cells and CHO-K1 cells were purchased from the American Type Culture Collection (Manasas, VA). Untransfected cells were cultured in Iscove's Modified Dulbecco's Medium (IMDM) supplemented with 10% bovin serum (BS) (3T3-NIH cells) or 10% fetal bovine serum (FBS) (CHO cells) and 0.5 mg/mL gentamicin (Invitrogen). 4.5 Transfection and selection Lipofectimine reagent was used to transfect the pBMGs-neo-TL1A-Ig expression plasmid into 3T3-NIH cells according to the vendor’s protocol (Invitrogen). The doublecassette pVitro2-GS-TL1A-Ig expression plasmid expressing TL1A-Ig and mGS was first transfected into adherent CHO-K1 cells (cultured in 10% FBS IMDM) using electroporation. The following conditions were applied while using the Gene Pulser apparatus for transfection: 0.4 cm cuvette gap, 0.75 kV, 25 µF and 0.5 msec time constant. After electroporation the cells were cultured in 10% FBS IMDM media and equally distributed into a 6-well plate (Costar). At 48 hours, the cells were re-transfected with the same plasmid using standard procedures for the Effectene reagent (Qiagen) and subjected to selection pressure when cultured in 10%FBS IMDM supplemented with 1 mg/mL hygromycin. Transfectants were single-cell cloned in 96-well round-bottomed plates (Costar) and subjected to hygromycin selection to generate supernatant samples for 91 analysis by mouse IgG ELISA. The highest producing clone (secreting 40 µg/mL TL1AIg/1 x 106 cells/24 hrs) was expanded to confluency and subjected to sequential adaptation from 10% FBS supplemented IMDM to serum free OptiCHO media supplemented with 8 mM L-glutamine, and GS and HT supplements (Invitrogen). Fiveseparate CHO clones were established in this manner and subjected to further selection when cultured in serum free OptiCHO media lacking L-Glutamine. Another mIgG ELISA was used to pick the highest producing clone, which was chosen for the third round of selection under varying concentrations of MSX (25 µM, 100 µM, 1 mM and 2 mM). The surviving clone at 1 mM MSX was passaged and ELISA samples were collected as described previously. A single clone expressing TL1A-Ig at about 200 µg/mL/1 x 106 cells/24 hrs was chosen for generation of protein. 4.6 Production and Purification Conditions The highest yielding TL1A-Ig CHO cells were placed into hollow fiber cell culture cartridges (Fibercell Systems) and cultured in serum free and glutamine free media containing GS and HT supplements. About 50% of the cells were harvested with 20 mL of TL1A-Ig supernatants every 3 days, on which the cartridge was replenished with 1L of fresh media. Cell viability was maintained at 50% viable cells/mL in the cartridge, allowing us to maintain culture for many months of continuous production. IgG directed ELISA was used to quantify TL1A-Ig in the harvested media, which was stored at -20°C until purification. The secreted fusion proteins were purified by the traditional protein A affinity chromatography method using a basic elution buffer (0.1 M diethylamine; 11.5 pH). In initial comparative studies, a TL1A-Ig preparation was purified to homogeneity on a protein G column. The bound protein was eluted with an acidic elution buffer (0.1 M 92 glycine; 2.5 pH). In another TL1A-Ig preparation, solid ammonium sulfate was added to the to the TL1A-Ig supernatant to achieve a 55% ammonium sulfate and the solution was spun overnight at 4° C. The solution was centrifuged and the precipitate containing TL1A-Ig was resuspended in binding buffer (1.6 M Glycine, 3.2 M NaCl, pH 9.0) and dialyzed against binding buffer overnight. The solution from the dialysis tube was, spun, filtered and applied on a protein A column for purification. 4.7 ELISA quantification assays Ninety-six well plates were coated with capture antibody anti-mIgG1 (100 µl/well; 10 µg/mL) for 1 hour at 37°C, followed by blocking (10% FBS in PBS), and 3 washes with washing buffer (PBS containing 0.1% Tween-20). 100 µl of standard (mIgG1), TL1A-Ig, or blank, was added to each well (with serial dilutions) and incubated for 2 hours. After washing, 100 µl of secondary antibody horseradish peroxidase (HRP) conjugated antimIgG was added to each well (1:1000 dilution in PBS) and incubated for 1 hour. After 5 washes, 100 µl of ABTs substrate was added to each well, incubated for 10 – 20 minutes, and analyzed using a Benchmark Plus microplate spectrophotometer at 405 OD. This protocol was used to pick the highest TL1A-Ig producing cell clones and to analyze the production of TL1A-Ig in the CHO-cell cartridges. For 4C12 and TL1A-Ig half-life experiments, serum samples were analyzed by ELISA using an anti-Armenian hamster IgG (10 µg/mL) and an anti-mTL1A specific capture antibody (L4G6, 10 µg/mL), respectively. Specie and isotype matched HRP anti-armenian hamster IgG or HRP antimouse IgG was used as a secondary detection antibody (Jackson Research). 93 4.8 Coomassie Blue stain and Western blot analysis TL1A-Ig was denatured by boiling for 5 min in the absence or presence of 2-ME, Laemmli sample buffer (2% SDS, 2.5% glycerol, 15 mM Tris (pH 6.8)) and separated by electrophoresis on a 4-15% SDS-PAGE gel. For the detection of protein bands, the gel was incubated with a Coomassie Blue stain solution followed by washing with destaining buffer (50% v/v methanol and 10% v/v acetic acid). For western-blotting analysis, the SDS-PAGE gel was transferred to a nitrocellulose membrane. The membrane was washed with TTBS (50 mM Tris, 150 mM NaCl, 0.05% Tween 20 (pH 7.6)) and the TL1A-Ig fusion proteins were detected with an anti-TL1A Ab (0.5 µg/mL; Jackson ImmunoResearch) or an anti-mIgG Ab (1:1000 dilution;Jackson ImmunoResearch), HRP-coupled secondary Ab (1:1000 dilution; Jackson ImmunoResearch), and the SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific). The glycosylation studies were performed according to the protocol provided with the Enzymatic Deglycosylation Kit GK80110 (Prozyme). Briefly, four samples of reduced purified TL1A-Ig (2 µg) were incubated in the absence or presence of 1 µl each of Nglycanase, Sialidase A, and O-glycanase in the appropriate tube. The first control replicate received no enzymes, the second tube received only N-glycanase, the third tube received only N-glycanase, and the fourth tube received all the 3 enzymes. The tubes were incubated for 3 hours at 37°C. Samples were loaded on an SDS-PAGE gel, subjected to electrophoresis, and stained with Coomassie Blue. 4.9 Gel filtration and dot blot analysis TL1A-Ig (purified or in supernatant) was analyzed by size exclusion chromatography on a Superdex 200 gel filtration column equilibrated with Tris buffer (10 mM Tris, 150 mM 94 NaCl, 1mM EDTA). The fractions were collected at a flow rate of 0.5 mL/min (200 µl/fraction). The column was calibrated with a mixture of standards including bovine thyroglobulin (670 kDa), aldolase (148 kDa) and OVA (43 kDa) (GE Healthcare). The apparent molecular weights were calculated based on the elution volumes of the standards. Dot blot analysis was done to determine the molecular weights of dilute TL1A-Ig (secreted by 3T3 cells) in supernatants that contained serum as well as other proteins. After gel filtration of 500 µl of TL1A-Ig supernantant, 10 µl of each fraction was applied as a dot on a nitrocellulose membrane through circular holes on an apparatus. Membranes were blocked with 5% non-fat dry milk, washed with TTBS, and incubated with HRP anti-mouse IgG antibody (1:1000 in PBS) to detect membrane bound TL1A-Ig. 4.10 In vitro binding assays to mouse TNFRSF25 expressing cells P815 cells (1x106 cells) transfected with TNFRSF25 were incubated with TL1A-Ig, L4G6 treated TL1A-Ig, 4C12 or isotype control IgG (0.5 µg/million cells) at 4°C for 30 mins, followed by washing with FACs (1% BSA and 0.1% sodium azide in PBS) buffer. Cells were stained with fluorochrome conjugated anti-mIgG (BioLegend) at 4°C for 30 mins, washed with FACs buffer, and analyzed using flow cytometry for TNFRSF25 positive cells. Total splenocytes or CD4+ or CD8+ T cells were isolated from FoxP3+FIR mice or B6 mice for experiments testing for binding of TL1A-Ig and 4C12 to endogenous TNFRSF25 on T cells. CD4+ T cells and CD8+ T cells were isolated using positive selection beads (Miltenyi Biotec). For activation, cells were plated at 2 x 106 cells/mL in a 6-well plate pre-treated with 1 ug/mL of anti-CD3 antibody. The plate was incubated at 37°C for 4 days. Cells were harvested, washed, and incubated for 15 min at 4°C with 1 µg /106 cells of Fc blocking antibody (eBioscience). Recovered cells were 95 incubated with 1 µg/106 cells TL1A-Ig, 4C12 or isotype control. The cells were washed and double stained with fluorochrome conjugated anti-CD4 or anti-CD8 (1 µg /106 cells) and anti-IgG (1 µg /106 cells). Finally, CD4+FIR- Tconvs, CD4+FIR+ Tregs and CD8+ T cells were analyzed using flow cytometry for cell bound 4C12 or TL1A-Ig. 4.11 In vitro caspase assays The enzyme activity of natural caspases was detected using the fluorimetric homogeneous caspase assay according to the manufacturer’s protocol (Roche Diagnostics). Briefly, TNFRSF25-P815 cells were incubated with titrating concentrations of IgG, TL1A-Ig (purified or in supernatant), TL1A-Ig pretreated with L4G6, or 4C12 for 5 h at 37°C in a 96-well plate (total volume 100 µl). Subsequently, substrate solution was added to the wells and the plates were incubated for 1.5 h. This treatment lysed the cells and allowed caspases to cleave the substrate to free rhodamine 110 (R110). Free R110 was determined fluorimetrically at λmax=521 nm (Wallac Victor 1420). The developed fluorochrome was directly proportional to the activity of caspases. 4.12 In vitro T cell culture For proliferation assays, CD4+FIR+ Tregs were highly purified (>98% purity) from CD4+ enriched FIR splenocytes using a FACs aria cell sorter (BD Biosciences) and CD4+CD25Tconv cells were purified by using the CD4+CD25+ Regulatory T Cell Isolation Kit (Miltenyi Biotec) to obtain a Treg-free Tconv population. Tregs or Tconv (5 x 104/well in triplicates) were plated in 96-well round bottomed plates and treated in presence or absence of: anti-CD3 (2 µg/mL; 2C11), mIL-2 (10 U/mL), 4C12 (10 µg/mL), or purified TL1A-Ig (0.1 µg/mL). In some Treg proliferation assays, FACs sorted Treg cells were pre-incubated with MHC II blocking antibody (10 µg/mL) for 45 min before culturing 96 them. In another experiment, FACs sorted Tregs were cultured in 100 U/mL IL-2 for 72 hours to make “resting” Tregs before adding them into proliferations assays. Cultures were incubated for 72 hours at 37°C and pulsed with 3H-thymidine (1 µCi/well, Perkin Elmer) for the last 6 hours. The incorporated isotope was measured by liquid scintillation counting (Micro Beta TriLux counter; Perkin Elmer). For iTreg induction experiments, Tconv cells were FACs sorted from FIR mice (CD4+FIR-) and OT-II transgenic mice (FACs sorted for CD4+CD25lowGITRlow). For induction of polyclonal iTregs, FIR Tconv were seeded in 24-well flat bottomed plate pre-treated with plate-bound anti-CD3 (2 µg/mL), in the presence of TGF-β (5 ng/mL), IL-2 (100 U/mL); retinoic acid (100 nM) plus or minus 4C12 or TL1A-Ig (10 µg/mL). For OT-II iTreg, OTII Tconv were cultured with 1:2 APCs, ovalbumin protein (10 nM), TGF-β (5 ng/mL), IL-2 (100 U/mL); retinoic acid (100 nM) in the absence or presence of 10 ug/ml 4C12 or TL1A-Ig. Cultures were incubated for 72 hours, washed, and analyzed for FoxP3+ cells in the CD4+ gate. 4.13 In vitro suppression assays TNFRSF25 DN CD4+CD25- cells (5 × 104) were plated in 96-well round-bottomed plates and activated with 0.5 µg soluble anti-CD3 (2C11) antibody in the presence of APCs (1:1 ratio) and titrating numbers of CD4+FIR+ Tregs isolated from IgG treated or TL1A-Ig treated mice. Control IgG or TL1A-Ig was added at a concentration of 0.1 µg/ml in some experiments. In some experiments wt CD4+CD25- T cells were used as responders. Cultures were incubated for 72 hours and pulsed with 3H-thymidine (1 µCi/well; Perkin Elmer) for the last 6 hours. Incorporated isotope was measured by liquid scintillation counting (Micro Beta TriLux counter; Perkin Elmer). 97 4.14 Antibiotics Mice were treated with ampicillin (1 g/L), vancomycin (500 mg/L), neomycin sulfate (1 g/L), and metronidazole (1 g/l, Sigma) in drinking water from day -25 to day 5 to remove gut microbiota. On days 0-3 mice were injected i.p with 100 µg isotype control IgG or TL1A-Ig in 100 µl PBS. Mice were sacrificed on day 5 to harvest spleens and lymph nodes for further analysis. 4.15 Induction of allergic lung inflammation Mice were sensitized by i.p. injection of 66 µg OVA (crystallized chicken egg albumin, grade V; Sigma-Aldrich) adsorbed to 6.6 mg alum (aluminum potassium sulfate; SigmaAldrich) in 200 µl PBS on day 0, with an i.p. boost on day 5. On days 11, 12 and 13 mice were injected i.p. 100 µg TL1A-Ig or mouse IgG (Jackson ImmunoResearch Laboratories Inc.) in 200 µl PBS. On day 16, mice were aerosol challenged with 0.5% OVA (SigmaAldrich) in PBS for 1 hour using a BANG nebulizer (CH Technologies) into a JaegerNYU Nose-Only Directed-Flow Inhalation Exposure System (CH Technologies). On day 19, mice were sacrificed, lungs were perfused with PBS, and bronchoalveolar lavages were obtained. Lung lobes and spleens were harvested for flow cytometry analysis, and lung lobes were also analyzed for lung histology as described previously (106). Quantification of periodic acid-Schiff–stained (PAS-stained) lung sections was performed using MacBiophotonics Image J software by color deconvolution (using the H PAS vector) followed by thresholding of images (color “2,” set to 95) and counted using the nucleus counter (limits set between 400 and 7,000). 98 4.16 Skin transplantation Recipient FIR-B6 mice were pre-injected i.p with one 20 µg dose of hamster-IgG or 4C12, or daily 100 µg doses of mouse IgG or TL1A-Ig 4 days prior to skin transplantation (days -4 to 0). On day of transplantation (day 0), 4C12 and TL1A-Ig treated mice were bled and the CD4+FoxP3+ Treg frequency was analyzed to ensure expansion of Treg to at least 30% of the total CD4+ T cell gate. A 1 cm skin incision was made at the operative site on the right thorax of FIR-B6 recipients. Full thickness skin grafts (1-2 cm in diameter) were obtained from the ears of Balb/c donor mice, trimmed to fit graft bed, and transplanted onto the right thorax of recipient FIR-B6 mice. The recipient mouse was wrapped with a sterile bandage for 6-7 days after transplant. On day 6-7, the bandage was removed to assess graft survival. TL1A-Ig treated mice were injected with 100 µg TL1A-Ig i.p daily until graft rejection, which was scored as rejected when more than 75% of the grafted tissue area had been lost. 4.17 Tumor inoculation and immunization EG7 cells were isolated from log-phase cultures and washed in PBS. One million cells were then injected s.c. in the hind-flank of mice in 100 µL PBS. One million nonirradiated EG7-gp96-Ig cells were injected i.p. in 100 µL PBS or in combination with 20 µg 4C12 or 100 µg TL1A-Ig on days of vaccination (day 7,10,13,16,19, and 22). In some experiments, TL1A-Ig was injected on day 7, 8, 9, 10 and subsequently on days of EG7-gp96-Ig vaccination. 4.18 Flow cytometry analysis and FACs sorting Single cell suspensions were made from peripheral blood, spleens, and lymph nodes. One to three million cells were used to stain with different antibody combinations. Flow 99 cytometry analysis was performed on a BD FACs Fortessa instrument with further analysis done with the FlowJo software. Negative enrichment of CD4+ T cells was done using the EasySep Mouse CD4+ T cell Pre-enrichment Kit from Stem Cell Technologies followed by staining for the appropriate markers before sorting for live cells using a FACSAria cell sorter (BD) after . 4.19 Cell adoptive transfer experiments Ten million CD4+ cells (comprised of approximately 10% FoxP3+ Treg cells) were highly purified by FACS sorting from FIR mice and adoptively transferred into CD74-/or CD4-/- mice. After three days (day 0), recipient mice were treated with 100 ug of mTL1A-Ig or IgG followed by 2 consecutive doses on days 1 and 2. The percentage of FoxP3+ cells was analyzed in the spleen and pooled lymph nodes on day 6. In OTII adoptive transfer experiments, CD4+CD25lowGITRlow cells were FACs sorted from OTII mice. One million cells were adoptively transferred i.v into CD41.5 SJL mice on day -2. On day 0, mice were immunized with i.p injection of OVA/ALUM in 200 µl PBS. Mice were treated with 100 µg isotype control IgG or TL1A-Ig on day 0, 1, 2 and sacrificed for analysis on day 5. In OT-1 expansion experiments, FIR mice were injected i.v on day -2 with 1 million OT-1 (purified using positive selection for CD8+ receptor) followed by an i.p injection of gp96-Ig vaccine cells on day 0. TL1A-Ig or mIgG1 (100 ug) in 100 µl PBS was injected ip on days 1 and 3 after vaccination. All mice were sacrificed on day 5 and analyzed for OT-1 frequency in the CD8+ gate in the peritoneal cavity and spleen. 4.20 Histology The heart, kidney, liver, lung, small and large intestine were harvested from mice that were treated with 100 µg i.p IgG or TL1A-Ig daily on days 0-2 or days 0-20 and fixed in 100 10% neutral buffered formalin. The fixed samples were sent for Hematoxylin and Eosin staining to the Comparative Pathology Core at the University of Miami. In the acute asthma studies, lungs were removed from mice after the bronchial lavage procedure, fixed and submitted to the Comparative Pathology Core were they were embedded, sectioned, and stained with H&E and Periodic Acid-Schiff. 4.21 Statistics All data was graphed and analyzed using GraphPad Prism 5. Paired comparisons were performed using Student's t test, multiple analysis was performed using a one-way ANOVA, P values are indicated as necessary. Appendix 1: Combination therapy of gp96-Ig vaccine and TNFRSF25 agonists to enhance anti-tumor immunity Although several reports have examined the role of TNFRSF25 regulation of CD4+ T cell subsets, including Tregs, not much is known about the function of TNFRSF25 in modulating CD8+ T cell responses. Recently a group reported that TNFRSF25 triggering in vivo using soluble TL1A induces the proliferation and accumulation of antigen-specific CD8+ T cells and their differentiation into CTLs (197). We next determined whether TL1A-Ig costimulates OVA-specific CD8+ T cells in the presence of cognate antigen (OVA) secreted from the gp96-Ig vaccine. We have previously reported that replacing the KDEL ER retention signal of heat shock protein gp96 with the Fc portion of IgG and transfecting the cDNA into cell lines, including tumor cells, results in the expression of gp96-Ig fusion protein chaperoning endogenous antigens (or tumor antigens) into the extracellular matrix that effectively stimulates cross presentation to CTLs (198). This protocol required the use of splenocytes from transgenic mice with MHC Class-I restricted T-cell receptors specific for ovalbumin (OT-I mice) as a source for CD8+ T cells (OT-I cells) (Figure 47). IgG or TL1A-Ig i.p Day 0 5 1 x 106 GFP-OTI 1 x 106 gp96-Ig i.v into FIR mice vaccine cells i.p Analysis: PEC and spleen flow cytometry Figure 47. Protocol for TL1A-Ig and vaccine treatment for OTI cell expansion. FIR mice were injected i.v on day -2 with 1 million OT-1 followed by an i.p injection of gp96-Ig vaccine cells on day 0. TL1A-Ig or mIgG1 (100 ug) was injected ip on days 1 and 3 after vaccination. All mice were sacrificed on day 5 for analysis. Briefly, we adoptively transferred ova-specific OT-I cells into recipient mice on day -2, followed by an injection of 1 million 3T3-NIH-gp96-Ig vaccine cells on day 0 and i.p injection of IgG or TL1A-Ig on days 1 and 3. All mice were sacrificed on day 5 and the 101 102 frequency of OT-I and Treg cell populations were analyzed in the spleen and lymph nodes of TL1A-Ig or IgG treated controls. The OT-I frequency in the CD8+ T cell gate was significantly higher in the spleens of TL1A-Ig mice as compared to controls. Concurrent significant Treg expansion was also observed in the spleens and LNs of TL1A-Ig treated mice 48a-b). b 50 PEC Spleen * 40 %FoxP3+/total CD4+ %GFP-OTI/total CD8+ a (Figure 30 20 ns 10 0 IgG TL1A-Ig IgG TL1A-Ig 50 PEC Spleen 40 ** *** 30 20 10 0 IgG TL1A-Ig IgG TL1A-Ig Figure 48. TL1A-Ig boosts clonal expansion of CD8+ T cells and Tregs when combined with gp96-Ig vaccine. (a) OT-1 frequency in the CD8+ gate in the peritoneal cavity and spleen. (b) CD4+FoxP3+ Tregs were also analyzed in the CD4 gate using flow cytometry. Significance was determined by Student’s t test. PEC: peritoneal cavity. Although these results seem to conflict with the studies described earlier on the effect of TNFRSF25 on Treg cells, they are not necessarily mutually exclusive. The enhancement of cell proliferation and survival by TNFRSF25 has been described in studies of pathogenic effector CD4+ and CD8+ T cells (105, 128, 129, 152, 162, 167, 197, 199, 200), as well as immunosuppressive Treg cells (130). TNFRSF25 agonists in combination with gp96-Ig vaccine and tumor rejection It is generally recognized that CD8+ cytotoxic T cells (CTLs) play a crucial role in inhibiting and killing tumor cells that hinders tumor growth. However, the extent of their contribution to anti-cancer immunity is dampened by immunosuppressive mechanisms such as recruitment of Tregs and secretion of immunosuppressive cytokines in the tumor microenvironment that tumors utilize to evade the immune system. A study suggests that signaling of GITR results in Treg-resistant CD8+ T cells (201). Hence we hypothesized 103 that TNFRSF25 signaling in the presence of vaccination results in a CTL response that is 15 Only vaccine Rejected: 2/3 10 5 0 0 5 10 15 20 25 30 Days post tumor inoculations b 20 imposed Vaccine + 4C12 Rejected: 3/5 15 10 5 ** * * * * 0 0 5 10 15 20 25 30 Days post tumor inoculations Tumor Diameter (mm) 20 suppression Tumor Diameter (mm) to Tumor Diameter (mm) a Tumor Diameter (mm) resistant by Tregs. 20 Vaccine + TL1A-Ig 15 Rejected: 1/5 10 5 ** * * * * 0 0 5 10 15 20 25 30 Days post tumor inoculations 20 Vaccine + TL1A-Ig 15 Rejected: 5/10 10 5 **** * * * * 0 0 5 10 15 20 25 30 Days post tumor inoculations Figure 49. TNFRSF25 agonist TL1A-Ig does not enhance gp96-Ig mediated rejection of established tumors. WT B6 mice were injected s.c in left flank with 1 million EG7 tumor cells. Tumors were established for 5 days and (a) vaccine (arrow) was administered i.p alone or in combination with 4C12 or TL1A-Ig (orange stars) on days 7,10,13,16,19,& 22. (b) One group received 4 consecutive doses of TL1A-Ig on days 7,8,9,&10 in addition to the regimen described in (a). Previous studies by Dr. Schreiber reported that frequent vaccination with EG7-gp96-Ig resulted in a thirty percent tumor rejection rate. His studies indicate that combination therapy with gp96-Ig vaccine and 4C12 (agonist hamster anti- TNFRSF25) mediated stimulation of TNFRSF25 increased tumor rejection rate to about 80%. We next wanted to determine if TL1A-Ig induces similar anti-tumor activity. Briefly, 1 million tumor cells (EG7) were transplanted (s.c) in the flank of mice. The tumor was allowed to establish for 7 days, at which time it is fully vascularized. From day 7 on all mice were vaccinated 6 times with 1 million live EG7-gp96-Ig i.p. every three days (arrows). IgG, 4C12 (20 µg) or TL1A-Ig (100 µg) was injected i.p on vaccine days (Figure 49a). Tumor size was measured daily. Sixty percent tumor rejection was observed in the group that received 104 vaccine only and vaccine plus 4C12, while only 20% tumor rejection was observed in the group that received TL1A-Ig. Tumor dormancy was observed in one animal in the TL1AIg group. One group of mice received 2 extra doses of TL1A-Ig between vaccine doses 1 and 2 (Figure 49b), increasing the tumor rejection rate to 50%. These experiments indicate that neither TNFRSF25 agonists, 4C12 or TL1A-Ig, enhance the tumor rejection observed with vaccine only. However, experiments with different schedule dosing and with more mice in each treatment group need to be performed in order to have conclusive results. References 1. Kenneth Murphy, P. T., Mark Walport. 2008. Janeway's Immunobiology. Garland Science. 2. Ruffell, B., D. G. DeNardo, N. I. Affara, and L. M. Coussens. 2010. Lymphocytes in cancer development: polarization towards pro-tumor immunity. Cytokine Growth Factor Rev 21:3-10. 3. Annunziato, F., and S. Romagnani. 2009. Heterogeneity of human effector CD4+ T cells. Arthritis Res Ther 11:257. 4. Carding, S. R., and P. J. Egan. 2002. Gammadelta T cells: functional plasticity and heterogeneity. Nat Rev Immunol 2:336-345. 5. Zhu, J., and W. E. Paul. 2008. CD4 T cells: fates, functions, and faults. Blood 112:1557-1569. 6. Djuretic, I. M., D. Levanon, V. Negreanu, Y. Groner, A. Rao, and K. M. Ansel. 2007. Transcription factors T-bet and Runx3 cooperate to activate Ifng and silence Il4 in T helper type 1 cells. Nat Immunol 8:145-153. 7. Hwang, E. S., S. J. Szabo, P. L. Schwartzberg, and L. H. Glimcher. 2005. T helper cell fate specified by kinase-mediated interaction of T-bet with GATA-3. Science 307:430-433. 8. Lazarevic, V., X. Chen, J. H. Shim, E. S. Hwang, E. Jang, A. N. Bolm, M. Oukka, V. K. Kuchroo, and L. H. Glimcher. 2011. T-bet represses T(H)17 differentiation by preventing Runx1-mediated activation of the gene encoding RORgammat. Nat Immunol 12:96-104. 9. Oestreich, K. J., A. C. Huang, and A. S. Weinmann. 2011. The lineage-defining factors T-bet and Bcl-6 collaborate to regulate Th1 gene expression patterns. J Exp Med 208:1001-1013. 10. Zhu, J., H. Yamane, J. Cote-Sierra, L. Guo, and W. E. Paul. 2006. GATA-3 promotes Th2 responses through three different mechanisms: induction of Th2 cytokine production, selective growth of Th2 cells and inhibition of Th1 cellspecific factors. Cell Res 16:3-10. 11. Zhu, J., and W. E. Paul. 2010. Heterogeneity and plasticity of T helper cells. Cell Res 20:4-12. 12. Lohr, J., B. Knoechel, and A. K. Abbas. 2006. Regulatory T cells in the periphery. Immunol Rev 212:149-162. 105 106 13. Zou, W. 2006. Regulatory T cells, tumour immunity and immunotherapy. Nat Rev Immunol 6:295-307. 14. Brusko, T. M., A. L. Putnam, and J. A. Bluestone. 2008. Human regulatory T cells: role in autoimmune disease and therapeutic opportunities. Immunol Rev 223:371-390. 15. Annunziato, F., L. Cosmi, F. Liotta, E. Lazzeri, R. Manetti, V. Vanini, P. Romagnani, E. Maggi, and S. Romagnani. 2002. Phenotype, localization, and mechanism of suppression of CD4(+)CD25(+) human thymocytes. J Exp Med 196:379-387. 16. Sanjabi, S., L. A. Zenewicz, M. Kamanaka, and R. A. Flavell. 2009. Antiinflammatory and pro-inflammatory roles of TGF-beta, IL-10, and IL-22 in immunity and autoimmunity. Curr Opin Pharmacol 9:447-453. 17. Niedbala, W., X. Q. Wei, B. Cai, A. J. Hueber, B. P. Leung, I. B. McInnes, and F. Y. Liew. 2007. IL-35 is a novel cytokine with therapeutic effects against collagen-induced arthritis through the expansion of regulatory T cells and suppression of Th17 cells. Eur J Immunol 37:3021-3029. 18. Shevach, E. M. 2009. Mechanisms of foxp3+ T regulatory cell-mediated suppression. Immunity 30:636-645. 19. Haribhai, D., W. Lin, L. M. Relland, N. Truong, C. B. Williams, and T. A. Chatila. 2007. Regulatory T cells dynamically control the primary immune response to foreign antigen. J Immunol 178:2961-2972. 20. Betts, R. J., N. Prabhu, A. W. Ho, F. C. Lew, P. E. Hutchinson, O. Rotzschke, P. A. Macary, and D. M. Kemeny. 2012. Influenza A virus infection results in a robust, antigen-responsive, and widely disseminated Foxp3+ regulatory T cell response. J Virol 86:2817-2825. 21. Littman, D. R., and A. Y. Rudensky. 2010. Th17 and regulatory T cells in mediating and restraining inflammation. Cell 140:845-858. 22. Vignali, D. A., L. W. Collison, and C. J. Workman. 2008. How regulatory T cells work. Nat Rev Immunol 8:523-532. 23. Liu, Y., P. Zhang, J. Li, A. B. Kulkarni, S. Perruche, and W. Chen. 2008. A critical function for TGF-beta signaling in the development of natural CD4+CD25+Foxp3+ regulatory T cells. Nat Immunol 9:632-640. 24. Saxena, A., G. Martin-Blondel, L. T. Mars, and R. S. Liblau. 2011. Role of CD8 T cell subsets in the pathogenesis of multiple sclerosis. FEBS Lett 585:3758-3763. 107 25. Sad, S., R. Marcotte, and T. R. Mosmann. 1995. Cytokine-induced differentiation of precursor mouse CD8+ T cells into cytotoxic CD8+ T cells secreting Th1 or Th2 cytokines. Immunity 2:271-279. 26. Huber, M., S. Heink, H. Grothe, A. Guralnik, K. Reinhard, K. Elflein, T. Hunig, H. W. Mittrucker, A. Brustle, T. Kamradt, and M. Lohoff. 2009. A Th17-like developmental process leads to CD8(+) Tc17 cells with reduced cytotoxic activity. Eur J Immunol 39:1716-1725. 27. Chavez-Galan, L., M. C. Arenas-Del Angel, E. Zenteno, R. Chavez, and R. Lascurain. 2009. Cell death mechanisms induced by cytotoxic lymphocytes. Cell Mol Immunol 6:15-25. 28. Slifka, M. K., F. Rodriguez, and J. L. Whitton. 1999. Rapid on/off cycling of cytokine production by virus-specific CD8+ T cells. Nature 401:76-79. 29. Trandem, K., J. Zhao, E. Fleming, and S. Perlman. 2011. Highly activated cytotoxic CD8 T cells express protective IL-10 at the peak of coronavirus-induced encephalitis. J Immunol 186:3642-3652. 30. Sun, J., R. Madan, C. L. Karp, and T. J. Braciale. 2009. Effector T cells control lung inflammation during acute influenza virus infection by producing IL-10. Nat Med 15:277-284. 31. Palmer, E. M., B. C. Holbrook, S. Arimilli, G. D. Parks, and M. A. AlexanderMiller. 2010. IFNgamma-producing, virus-specific CD8+ effector cells acquire the ability to produce IL-10 as a result of entry into the infected lung environment. Virology 404:225-230. 32. Zhang, N., and M. J. Bevan. 2011. CD8(+) T cells: foot soldiers of the immune system. Immunity 35:161-168. 33. Carswell, E. A., L. J. Old, R. L. Kassel, S. Green, N. Fiore, and B. Williamson. 1975. An endotoxin-induced serum factor that causes necrosis of tumors. Proc Natl Acad Sci U S A 72:3666-3670. 34. Granger, G. A., S. J. Shacks, T. W. Williams, and W. P. Kolb. 1969. Lymphocyte in vitro cytotoxicity: specific release of lymphotoxin-like materials from tuberculin-sensitive lymphoid cells. Nature 221:1155-1157. 35. Pennica, D., G. E. Nedwin, J. S. Hayflick, P. H. Seeburg, R. Derynck, M. A. Palladino, W. J. Kohr, B. B. Aggarwal, and D. V. Goeddel. 1984. Human tumour necrosis factor: precursor structure, expression and homology to lymphotoxin. Nature 312:724-729. 108 36. Gray, P. W., B. B. Aggarwal, C. V. Benton, T. S. Bringman, W. J. Henzel, J. A. Jarrett, D. W. Leung, B. Moffat, P. Ng, L. P. Svedersky, and et al. 1984. Cloning and expression of cDNA for human lymphotoxin, a lymphokine with tumour necrosis activity. Nature 312:721-724. 37. Hehlgans, T., and K. Pfeffer. 2005. The intriguing biology of the tumour necrosis factor/tumour necrosis factor receptor superfamily: players, rules and the games. Immunology 115:1-20. 38. Croft, M. 2009. The role of TNF superfamily members in T-cell function and diseases. Nat Rev Immunol 9:271-285. 39. Aggarwal, B. B. 2003. Signalling pathways of the TNF superfamily: a doubleedged sword. Nat Rev Immunol 3:745-756. 40. Croft, M., W. Duan, H. Choi, S. Y. Eun, S. Madireddi, and A. Mehta. 2012. TNF superfamily in inflammatory disease: translating basic insights. Trends Immunol 33:144-152. 41. Migone, T. S., J. Zhang, X. Luo, L. Zhuang, C. Chen, B. Hu, J. S. Hong, J. W. Perry, S. F. Chen, J. X. Zhou, Y. H. Cho, S. Ullrich, P. Kanakaraj, J. Carrell, E. Boyd, H. S. Olsen, G. Hu, L. Pukac, D. Liu, J. Ni, S. Kim, R. Gentz, P. Feng, P. A. Moore, S. M. Ruben, and P. Wei. 2002. TL1A is a TNF-like ligand for DR3 and TR6/DcR3 and functions as a T cell costimulator. Immunity 16:479-492. 42. Prehn, J. L., L. S. Thomas, C. J. Landers, Q. T. Yu, K. S. Michelsen, and S. R. Targan. 2007. The T cell costimulator TL1A is induced by FcgammaR signaling in human monocytes and dendritic cells. J Immunol 178:4033-4038. 43. Fesik, S. W. 2000. Insights into programmed cell death through structural biology. Cell 103:273-282. 44. Peschon, J. J., J. L. Slack, P. Reddy, K. L. Stocking, S. W. Sunnarborg, D. C. Lee, W. E. Russell, B. J. Castner, R. S. Johnson, J. N. Fitzner, R. W. Boyce, N. Nelson, C. J. Kozlosky, M. F. Wolfson, C. T. Rauch, D. P. Cerretti, R. J. Paxton, C. J. March, and R. A. Black. 1998. An essential role for ectodomain shedding in mammalian development. Science 282:1281-1284. 45. Croft, M. 2003. Co-stimulatory members of the TNFR family: keys to effective T-cell immunity? Nat Rev Immunol 3:609-620. 46. Idriss, H. T., and J. H. Naismith. 2000. TNF alpha and the TNF receptor superfamily: structure-function relationship(s). Microsc Res Tech 50:184-195. Eck, M. J., and S. R. Sprang. 1989. The structure of tumor necrosis factor-alpha at 2.6 A resolution. Implications for receptor binding. J Biol Chem 264:1759517605. 47. 109 48. Locksley, R. M., N. Killeen, and M. J. Lenardo. 2001. The TNF and TNF receptor superfamilies: integrating mammalian biology. Cell 104:487-501. 49. Bodmer, J. L., P. Schneider, and J. Tschopp. 2002. The molecular architecture of the TNF superfamily. Trends Biochem Sci 27:19-26. 50. Smith, C. A., T. Farrah, and R. G. Goodwin. 1994. The TNF receptor superfamily of cellular and viral proteins: activation, costimulation, and death. Cell 76:959962. 51. Chan, F. K., H. J. Chun, L. Zheng, R. M. Siegel, K. L. Bui, and M. J. Lenardo. 2000. A domain in TNF receptors that mediates ligand-independent receptor assembly and signaling. Science 288:2351-2354. 52. Siegel, R. M., F. K. Chan, H. J. Chun, and M. J. Lenardo. 2000. The multifaceted role of Fas signaling in immune cell homeostasis and autoimmunity. Nat Immunol 1:469-474. 53. Schneider, P., N. Holler, J. L. Bodmer, M. Hahne, K. Frei, A. Fontana, and J. Tschopp. 1998. Conversion of membrane-bound Fas(CD95) ligand to its soluble form is associated with downregulation of its proapoptotic activity and loss of liver toxicity. J Exp Med 187:1205-1213. 54. Grell, M., E. Douni, H. Wajant, M. Lohden, M. Clauss, B. Maxeiner, S. Georgopoulos, W. Lesslauer, G. Kollias, K. Pfizenmaier, and P. Scheurich. 1995. The transmembrane form of tumor necrosis factor is the prime activating ligand of the 80 kDa tumor necrosis factor receptor. Cell 83:793-802. 55. Tanaka, M., T. Itai, M. Adachi, and S. Nagata. 1998. Downregulation of Fas ligand by shedding. Nat Med 4:31-36. 56. Haswell, L. E., M. J. Glennie, and A. Al-Shamkhani. 2001. Analysis of the oligomeric requirement for signaling by CD40 using soluble multimeric forms of its ligand, CD154. Eur J Immunol 31:3094-3100. 57. Wilson, N. S., V. Dixit, and A. Ashkenazi. 2009. Death receptor signal transducers: nodes of coordination in immune signaling networks. Nat Immunol 10:348-355. 58. Kischkel, F. C., D. A. Lawrence, A. Chuntharapai, P. Schow, K. J. Kim, and A. Ashkenazi. 2000. Apo2L/TRAIL-dependent recruitment of endogenous FADD and caspase-8 to death receptors 4 and 5. Immunity 12:611-620. 59. Nagata, S. 1999. Fas ligand-induced apoptosis. Annu Rev Genet 33:29-55. 110 60. Li, H., H. Zhu, C. J. Xu, and J. Yuan. 1998. Cleavage of BID by caspase 8 mediates the mitochondrial damage in the Fas pathway of apoptosis. Cell 94:491501. 61. Gupta, S., A. Agrawal, S. Agrawal, H. Su, and S. Gollapudi. 2006. A paradox of immunodeficiency and inflammation in human aging: lessons learned from apoptosis. Immun Ageing 3:5. 62. Chinnaiyan, A. M., K. O'Rourke, G. L. Yu, R. H. Lyons, M. Garg, D. R. Duan, L. Xing, R. Gentz, J. Ni, and V. M. Dixit. 1996. Signal transduction by DR3, a death domain-containing receptor related to TNFR-1 and CD95. Science 274:990-992. 63. Kitson, J., T. Raven, Y. P. Jiang, D. V. Goeddel, K. M. Giles, K. T. Pun, C. J. Grinham, R. Brown, and S. N. Farrow. 1996. A death-domain-containing receptor that mediates apoptosis. Nature 384:372-375. 64. Bodmer, J. L., K. Burns, P. Schneider, K. Hofmann, V. Steiner, M. Thome, T. Bornand, M. Hahne, M. Schroter, K. Becker, A. Wilson, L. E. French, J. L. Browning, H. R. MacDonald, and J. Tschopp. 1997. TRAMP, a novel apoptosismediating receptor with sequence homology to tumor necrosis factor receptor 1 and Fas(Apo-1/CD95). Immunity 6:79-88. 65. Wen, L., L. Zhuang, X. Luo, and P. Wei. 2003. TL1A-induced NF-kappaB activation and c-IAP2 production prevent DR3-mediated apoptosis in TF-1 cells. J Biol Chem 278:39251-39258. 66. Wang, L., F. Du, and X. Wang. 2008. TNF-alpha induces two distinct caspase-8 activation pathways. Cell 133:693-703. 67. Schutze, S., V. Tchikov, and W. Schneider-Brachert. 2008. Regulation of TNFR1 and CD95 signalling by receptor compartmentalization. Nat Rev Mol Cell Biol 9:655-662. 68. Dempsey, P. W., S. E. Doyle, J. Q. He, and G. Cheng. 2003. The signaling adaptors and pathways activated by TNF superfamily. Cytokine Growth Factor Rev 14:193-209. 69. Dadgostar, H., B. Zarnegar, A. Hoffmann, X. F. Qin, U. Truong, G. Rao, D. Baltimore, and G. Cheng. 2002. Cooperation of multiple signaling pathways in CD40-regulated gene expression in B lymphocytes. Proc Natl Acad Sci U S A 99:1497-1502. 70. Vonderheide, R. H. 2007. Prospect of targeting the CD40 pathway for cancer therapy. Clin Cancer Res 13:1083-1088. 111 71. Fu, Y. X., and D. D. Chaplin. 1999. Development and maturation of secondary lymphoid tissues. Annu Rev Immunol 17:399-433. 72. Dougall, W. C., M. Glaccum, K. Charrier, K. Rohrbach, K. Brasel, T. De Smedt, E. Daro, J. Smith, M. E. Tometsko, C. R. Maliszewski, A. Armstrong, V. Shen, S. Bain, D. Cosman, D. Anderson, P. J. Morrissey, J. J. Peschon, and J. Schuh. 1999. RANK is essential for osteoclast and lymph node development. Genes Dev 13:2412-2424. 73. Kong, Y. Y., U. Feige, I. Sarosi, B. Bolon, A. Tafuri, S. Morony, C. Capparelli, J. Li, R. Elliott, S. McCabe, T. Wong, G. Campagnuolo, E. Moran, E. R. Bogoch, G. Van, L. T. Nguyen, P. S. Ohashi, D. L. Lacey, E. Fish, W. J. Boyle, and J. M. Penninger. 1999. Activated T cells regulate bone loss and joint destruction in adjuvant arthritis through osteoprotegerin ligand. Nature 402:304-309. 74. Kim, D., R. E. Mebius, J. D. MacMicking, S. Jung, T. Cupedo, Y. Castellanos, J. Rho, B. R. Wong, R. Josien, N. Kim, P. D. Rennert, and Y. Choi. 2000. Regulation of peripheral lymph node genesis by the tumor necrosis factor family member TRANCE. J Exp Med 192:1467-1478. 75. Guckelberger, O., J. M. Langrehr, W. O. Bechstein, R. Neuhaus, R. Luesebrink, H. P. Lemmens, B. Kratschmer, S. Jonas, M. Knoop, and P. Neuhaus. 1996. Does the choice of primary immunosuppression influence the prevalence of cardiovascular risk factors after liver transplantation? Transplant Proc 28:31733174. 76. Cuff, C. A., R. Sacca, and N. H. Ruddle. 1999. Differential induction of adhesion molecule and chemokine expression by LTalpha3 and LTalphabeta in inflammation elucidates potential mechanisms of mesenteric and peripheral lymph node development. J Immunol 162:5965-5972. 77. Luther, S. A., T. Lopez, W. Bai, D. Hanahan, and J. G. Cyster. 2000. BLC expression in pancreatic islets causes B cell recruitment and lymphotoxindependent lymphoid neogenesis. Immunity 12:471-481. 78. Banks, T. A., B. T. Rouse, M. K. Kerley, P. J. Blair, V. L. Godfrey, N. A. Kuklin, D. M. Bouley, J. Thomas, S. Kanangat, and M. L. Mucenski. 1995. Lymphotoxinalpha-deficient mice. Effects on secondary lymphoid organ development and humoral immune responsiveness. J Immunol 155:1685-1693. 79. Alimzhanov, M. B., D. V. Kuprash, M. H. Kosco-Vilbois, A. Luz, R. L. Turetskaya, A. Tarakhovsky, K. Rajewsky, S. A. Nedospasov, and K. Pfeffer. 1997. Abnormal development of secondary lymphoid tissues in lymphotoxin betadeficient mice. Proc Natl Acad Sci U S A 94:9302-9307. 112 80. Pfeffer, K., T. Matsuyama, T. M. Kundig, A. Wakeham, K. Kishihara, A. Shahinian, K. Wiegmann, P. S. Ohashi, M. Kronke, and T. W. Mak. 1993. Mice deficient for the 55 kd tumor necrosis factor receptor are resistant to endotoxic shock, yet succumb to L. monocytogenes infection. Cell 73:457-467. 81. Ehlers, S., C. Holscher, S. Scheu, C. Tertilt, T. Hehlgans, J. Suwinski, R. Endres, and K. Pfeffer. 2003. The lymphotoxin beta receptor is critically involved in controlling infections with the intracellular pathogens Mycobacterium tuberculosis and Listeria monocytogenes. J Immunol 170:5210-5218. 82. Garrone, P., E. M. Neidhardt, E. Garcia, L. Galibert, C. van Kooten, and J. Banchereau. 1995. Fas ligation induces apoptosis of CD40-activated human B lymphocytes. J Exp Med 182:1265-1273. 83. Chan, K. F., M. R. Siegel, and J. M. Lenardo. 2000. Signaling by the TNF receptor superfamily and T cell homeostasis. Immunity 13:419-422. Nagata, S., and P. Golstein. 1995. The Fas death factor. Science 267:1449-1456. 84. 85. Lenardo, M., K. M. Chan, F. Hornung, H. McFarland, R. Siegel, J. Wang, and L. Zheng. 1999. Mature T lymphocyte apoptosis--immune regulation in a dynamic and unpredictable antigenic environment. Annu Rev Immunol 17:221-253. 86. Rieux-Laucat, F., F. Le Deist, C. Hivroz, I. A. Roberts, K. M. Debatin, A. Fischer, and J. P. de Villartay. 1995. Mutations in Fas associated with human lymphoproliferative syndrome and autoimmunity. Science 268:1347-1349. 87. Jacob, C. O., G. D. Lewis, and H. O. McDevitt. 1991. MHC class II-associated variation in the production of tumor necrosis factor in mice and humans: relevance to the pathogenesis of autoimmune diseases. Immunol Res 10:156-168. 88. Scheu, S., J. Alferink, T. Potzel, W. Barchet, U. Kalinke, and K. Pfeffer. 2002. Targeted disruption of LIGHT causes defects in costimulatory T cell activation and reveals cooperation with lymphotoxin beta in mesenteric lymph node genesis. J Exp Med 195:1613-1624. 89. Tamada, K., K. Shimozaki, A. I. Chapoval, G. Zhu, G. Sica, D. Flies, T. Boone, H. Hsu, Y. X. Fu, S. Nagata, J. Ni, and L. Chen. 2000. Modulation of T-cellmediated immunity in tumor and graft-versus-host disease models through the LIGHT co-stimulatory pathway. Nat Med 6:283-289. 90. Oshima, H., H. Nakano, C. Nohara, T. Kobata, A. Nakajima, N. A. Jenkins, D. J. Gilbert, N. G. Copeland, T. Muto, H. Yagita, and K. Okumura. 1998. Characterization of murine CD70 by molecular cloning and mAb. Int Immunol 10:517-526. 113 91. Agematsu, K., T. Kobata, K. Sugita, G. J. Freeman, M. P. Beckmann, S. F. Schlossman, and C. Morimoto. 1994. Role of CD27 in T cell immune response. Analysis by recombinant soluble CD27. J Immunol 153:1421-1429. 92. Hintzen, R. Q., S. M. Lens, K. Lammers, H. Kuiper, M. P. Beckmann, and R. A. van Lier. 1995. Engagement of CD27 with its ligand CD70 provides a second signal for T cell activation. J Immunol 154:2612-2623. 93. Hendriks, J., L. A. Gravestein, K. Tesselaar, R. A. van Lier, T. N. Schumacher, and J. Borst. 2000. CD27 is required for generation and long-term maintenance of T cell immunity. Nat Immunol 1:433-440. 94. Rogers, P. R., J. Song, I. Gramaglia, N. Killeen, and M. Croft. 2001. OX40 promotes Bcl-xL and Bcl-2 expression and is essential for long-term survival of CD4 T cells. Immunity 15:445-455. 95. Brocker, T., A. Gulbranson-Judge, S. Flynn, M. Riedinger, C. Raykundalia, and P. Lane. 1999. CD4 T cell traffic control: in vivo evidence that ligation of OX40 on CD4 T cells by OX40-ligand expressed on dendritic cells leads to the accumulation of CD4 T cells in B follicles. Eur J Immunol 29:1610-1616. 96. Murata, K., M. Nose, L. C. Ndhlovu, T. Sato, K. Sugamura, and N. Ishii. 2002. Constitutive OX40/OX40 ligand interaction induces autoimmune-like diseases. J Immunol 169:4628-4636. Gramaglia, I., A. Jember, S. D. Pippig, A. D. Weinberg, N. Killeen, and M. Croft. 2000. The OX40 costimulatory receptor determines the development of CD4 memory by regulating primary clonal expansion. J Immunol 165:3043-3050. 97. 98. 99. De Smedt, T., J. Smith, P. Baum, W. Fanslow, E. Butz, and C. Maliszewski. 2002. Ox40 costimulation enhances the development of T cell responses induced by dendritic cells in vivo. J Immunol 168:661-670. Xiao, Z., K. A. Casey, S. C. Jameson, J. M. Curtsinger, and M. F. Mescher. 2009. Programming for CD8 T cell memory development requires IL-12 or type I IFN. J Immunol 182:2786-2794. 100. Le Bon, A., N. Etchart, C. Rossmann, M. Ashton, S. Hou, D. Gewert, P. Borrow, and D. F. Tough. 2003. Cross-priming of CD8+ T cells stimulated by virusinduced type I interferon. Nat Immunol 4:1009-1015. 101. Kelly, J. M., P. K. Darcy, J. L. Markby, D. I. Godfrey, K. Takeda, H. Yagita, and M. J. Smyth. 2002. Induction of tumor-specific T cell memory by NK cellmediated tumor rejection. Nat Immunol 3:83-90. 102. Liu, C., Y. Lou, G. Lizee, H. Qin, S. Liu, B. Rabinovich, G. J. Kim, Y. H. Wang, Y. Ye, A. G. Sikora, W. W. Overwijk, Y. J. Liu, G. Wang, and P. Hwu. 2008. 114 Plasmacytoid dendritic cells induce NK cell-dependent, tumor antigen-specific T cell cross-priming and tumor regression in mice. The Journal of Clinical Investigation 118:1165-1175. 103. Zingoni, A., T. Sornasse, B. G. Cocks, Y. Tanaka, A. Santoni, and L. L. Lanier. 2004. Cross-talk between activated human NK cells and CD4+ T cells via OX40OX40 ligand interactions. J Immunol 173:3716-3724. 104. Wilcox, R. A., K. Tamada, S. E. Strome, and L. Chen. 2002. Signaling through NK cell-associated CD137 promotes both helper function for CD8+ cytolytic T cells and responsiveness to IL-2 but not cytolytic activity. J Immunol 169:42304236. 105. Papadakis, K. A., J. L. Prehn, C. Landers, Q. Han, X. Luo, S. C. Cha, P. Wei, and S. R. Targan. 2004. TL1A synergizes with IL-12 and IL-18 to enhance IFNgamma production in human T cells and NK cells. J Immunol 172:7002-7007. 106. Fang, L., B. Adkins, V. Deyev, and E. R. Podack. 2008. Essential role of TNF receptor superfamily 25 (TNFRSF25) in the development of allergic lung inflammation. J Exp Med 205:1037-1048. 107. Elgueta, R., M. J. Benson, V. C. de Vries, A. Wasiuk, Y. Guo, and R. J. Noelle. 2009. Molecular mechanism and function of CD40/CD40L engagement in the immune system. Immunol Rev 229:152-172. 108. Kawabe, T., T. Naka, K. Yoshida, T. Tanaka, H. Fujiwara, S. Suematsu, N. Yoshida, T. Kishimoto, and H. Kikutani. 1994. The immune responses in CD40deficient mice: impaired immunoglobulin class switching and germinal center formation. Immunity 1:167-178. 109. Castigli, E., F. W. Alt, L. Davidson, A. Bottaro, E. Mizoguchi, A. K. Bhan, and R. S. Geha. 1994. CD40-deficient mice generated by recombination-activating gene-2-deficient blastocyst complementation. Proc Natl Acad Sci U S A 91:12135-12139. 110. Schiemann, B., J. L. Gommerman, K. Vora, T. G. Cachero, S. Shulga-Morskaya, M. Dobles, E. Frew, and M. L. Scott. 2001. An essential role for BAFF in the normal development of B cells through a BCMA-independent pathway. Science 293:2111-2114. 111. Miller, D. J., and C. E. Hayes. 1991. Phenotypic and genetic characterization of a unique B lymphocyte deficiency in strain A/WySnJ mice. Eur J Immunol 21:1123-1130. 115 112. Thompson, J. S., S. A. Bixler, F. Qian, K. Vora, M. L. Scott, T. G. Cachero, C. Hession, P. Schneider, I. D. Sizing, C. Mullen, K. Strauch, M. Zafari, C. D. Benjamin, J. Tschopp, J. L. Browning, and C. Ambrose. 2001. BAFF-R, a newly identified TNF receptor that specifically interacts with BAFF. Science 293:21082111. 113. Kashiwakura, J., H. Yokoi, H. Saito, and Y. Okayama. 2004. T cell proliferation by direct cross-talk between OX40 ligand on human mast cells and OX40 on human T cells: comparison of gene expression profiles between human tonsillar and lung-cultured mast cells. J Immunol 173:5247-5257. 114. Nakae, S., H. Suto, M. Iikura, M. Kakurai, J. D. Sedgwick, M. Tsai, and S. J. Galli. 2006. Mast cells enhance T cell activation: importance of mast cell costimulatory molecules and secreted TNF. J Immunol 176:2238-2248. 115. Nishimoto, H., S. W. Lee, H. Hong, K. G. Potter, M. Maeda-Yamamoto, T. Kinoshita, Y. Kawakami, R. S. Mittler, B. S. Kwon, C. F. Ware, M. Croft, and T. Kawakami. 2005. Costimulation of mast cells by 4-1BB, a member of the tumor necrosis factor receptor superfamily, with the high-affinity IgE receptor. Blood 106:4241-4248. 116. Baumann, R., S. Yousefi, D. Simon, S. Russmann, C. Mueller, and H. U. Simon. 2004. Functional expression of CD134 by neutrophils. Eur J Immunol 34:22682275. 117. Kim, M. Y., F. M. Gaspal, H. E. Wiggett, F. M. McConnell, A. GulbransonJudge, C. Raykundalia, L. S. Walker, M. D. Goodall, and P. J. Lane. 2003. CD4(+)CD3(-) accessory cells costimulate primed CD4 T cells through OX40 and CD30 at sites where T cells collaborate with B cells. Immunity 18:643-654. 118. Kim, M. Y., K. M. Toellner, A. White, F. M. McConnell, F. M. Gaspal, S. M. Parnell, E. Jenkinson, G. Anderson, and P. J. Lane. 2006. Neonatal and adult CD4+ CD3- cells share similar gene expression profile, and neonatal cells upregulate OX40 ligand in response to TL1A (TNFSF15). J Immunol 177:30743081. 119. So, T., and M. Croft. 2007. Cutting edge: OX40 inhibits TGF-beta- and antigendriven conversion of naive CD4 T cells into CD25+Foxp3+ T cells. J Immunol 179:1427-1430. 120. Vu, M. D., X. Xiao, W. Gao, N. Degauque, M. Chen, A. Kroemer, N. Killeen, N. Ishii, and X. C. Li. 2007. OX40 costimulation turns off Foxp3+ Tregs. Blood 110:2501-2510. 116 121. Chen, M., X. Xiao, G. Demirci, and X. C. Li. 2008. OX40 controls islet allograft tolerance in CD154 deficient mice by regulating FOXP3+ Tregs. Transplantation 85:1659-1662. 122. Takeda, I., S. Ine, N. Killeen, L. C. Ndhlovu, K. Murata, S. Satomi, K. Sugamura, and N. Ishii. 2004. Distinct roles for the OX40-OX40 ligand interaction in regulatory and nonregulatory T cells. J Immunol 172:3580-3589. 123. Choi, B. K., J. S. Bae, E. M. Choi, W. J. Kang, S. Sakaguchi, D. S. Vinay, and B. S. Kwon. 2004. 4-1BB-dependent inhibition of immunosuppression by activated CD4+CD25+ T cells. J Leukoc Biol 75:785-791. 124. Valzasina, B., C. Guiducci, H. Dislich, N. Killeen, A. D. Weinberg, and M. P. Colombo. 2005. Triggering of OX40 (CD134) on CD4(+)CD25+ T cells blocks their inhibitory activity: a novel regulatory role for OX40 and its comparison with GITR. Blood 105:2845-2851. 125. Kroemer, A., X. Xiao, M. D. Vu, W. Gao, K. Minamimura, M. Chen, T. Maki, and X. C. Li. 2007. OX40 controls functionally different T cell subsets and their resistance to depletion therapy. J Immunol 179:5584-5591. 126. Piconese, S., B. Valzasina, and M. P. Colombo. 2008. OX40 triggering blocks suppression by regulatory T cells and facilitates tumor rejection. J Exp Med 205:825-839. 127. Robertson, S. J., R. J. Messer, A. B. Carmody, R. S. Mittler, C. Burlak, and K. J. Hasenkrug. 2008. CD137 costimulation of CD8+ T cells confers resistance to suppression by virus-induced regulatory T cells. J Immunol 180:5267-5274. 128. Meylan, F., Y. J. Song, I. Fuss, S. Villarreal, E. Kahle, I. J. Malm, K. Acharya, H. L. Ramos, L. Lo, M. M. Mentink-Kane, T. A. Wynn, T. S. Migone, W. Strober, and R. M. Siegel. 2011. The TNF-family cytokine TL1A drives IL-13-dependent small intestinal inflammation. Mucosal Immunol 4:172-185. 129. Taraban, V. Y., T. J. Slebioda, J. E. Willoughby, S. L. Buchan, S. James, B. Sheth, N. R. Smyth, G. J. Thomas, E. C. Wang, and A. Al-Shamkhani. 2011. Sustained TL1A expression modulates effector and regulatory T-cell responses and drives intestinal goblet cell hyperplasia. Mucosal Immunol 4:186-196. 130. Schreiber, T. H., D. Wolf, M. S. Tsai, J. Chirinos, V. V. Deyev, L. Gonzalez, T. R. Malek, R. B. Levy, and E. R. Podack. 2010. Therapeutic Treg expansion in mice by TNFRSF25 prevents allergic lung inflammation. The Journal of Clinical Investigation 120:3629-3640. 117 131. Moore, R. J., D. M. Owens, G. Stamp, C. Arnott, F. Burke, N. East, H. Holdsworth, L. Turner, B. Rollins, M. Pasparakis, G. Kollias, and F. Balkwill. 1999. Mice deficient in tumor necrosis factor-alpha are resistant to skin carcinogenesis. Nat Med 5:828-831. 132. Carvalho, R. F., A. K. Ulfgren, M. Engstrom, E. Klint, and G. Nilsson. 2009. CD153 in rheumatoid arthritis: detection of a soluble form in serum and synovial fluid, and expression by mast cells in the rheumatic synovium. J Rheumatol 36:501-507. 133. Gerli, R., C. Pitzalis, O. Bistoni, B. Falini, V. Costantini, A. Russano, and C. Lunardi. 2000. CD30+ T cells in rheumatoid synovitis: mechanisms of recruitment and functional role. J Immunol 164:4399-4407. 134. Giacomelli, R., A. Passacantando, R. Perricone, I. Parzanese, M. Rascente, G. Minisola, and G. Tonietti. 2001. T lymphocytes in the synovial fluid of patients with active rheumatoid arthritis display CD134-OX40 surface antigen. Clin Exp Rheumatol 19:317-320. 135. Tan, S. M., D. Xu, V. Roschke, J. W. Perry, D. G. Arkfeld, G. R. Ehresmann, T. S. Migone, D. M. Hilbert, and W. Stohl. 2003. Local production of B lymphocyte stimulator protein and APRIL in arthritic joints of patients with inflammatory arthritis. Arthritis Rheum 48:982-992. 136. Cheema, G. S., V. Roschke, D. M. Hilbert, and W. Stohl. 2001. Elevated serum B lymphocyte stimulator levels in patients with systemic immune-based rheumatic diseases. Arthritis Rheum 44:1313-1319. 137. Seyler, T. M., Y. W. Park, S. Takemura, R. J. Bram, P. J. Kurtin, J. J. Goronzy, and C. M. Weyand. 2005. BLyS and APRIL in rheumatoid arthritis. The Journal of Clinical Investigation 115:3083-3092. Siddiqui, S., V. Mistry, C. Doe, S. Stinson, M. Foster, and C. Brightling. 2010. Airway wall expression of OX40/OX40L and interleukin-4 in asthma. Chest 137:797-804. 138. 139. Oflazoglu, E., I. S. Grewal, and H. Gerber. 2009. Targeting CD30/CD30L in oncology and autoimmune and inflammatory diseases. Advances in experimental medicine and biology 647:174-185. 140. Hastie, A. T., W. C. Moore, D. A. Meyers, P. L. Vestal, H. Li, S. P. Peters, and E. R. Bleecker. 2010. Analyses of asthma severity phenotypes and inflammatory proteins in subjects stratified by sputum granulocytes. J Allergy Clin Immunol 125:1028-1036 e1013. 141. Straus, S. E., E. S. Jaffe, J. M. Puck, J. K. Dale, K. B. Elkon, A. Rosen-Wolff, A. M. Peters, M. C. Sneller, C. W. Hallahan, J. Wang, R. E. Fischer, C. M. Jackson, 118 A. Y. Lin, C. Baumler, E. Siegert, A. Marx, A. K. Vaishnaw, T. Grodzicky, T. A. Fleisher, and M. J. Lenardo. 2001. The development of lymphomas in families with autoimmune lymphoproliferative syndrome with germline Fas mutations and defective lymphocyte apoptosis. Blood 98:194-200. 142. Weinberg, A. D., D. N. Bourdette, T. J. Sullivan, M. Lemon, J. J. Wallin, R. Maziarz, M. Davey, F. Palida, W. Godfrey, E. Engleman, R. J. Fulton, H. Offner, and A. A. Vandenbark. 1996. Selective depletion of myelin-reactive T cells with the anti-OX-40 antibody ameliorates autoimmune encephalomyelitis. Nat Med 2:183-189. 143. Boot, E. P., G. A. Koning, G. Storm, J. P. Wagenaar-Hilbers, W. van Eden, L. A. Everse, and M. H. Wauben. 2005. CD134 as target for specific drug delivery to auto-aggressive CD4+ T cells in adjuvant arthritis. Arthritis Res Ther 7:R604615. 144. Doherty, T. A., P. Soroosh, D. H. Broide, and M. Croft. 2009. CD4+ cells are required for chronic eosinophilic lung inflammation but not airway remodeling. Am J Physiol Lung Cell Mol Physiol 296:L229-235. 145. Chapoval, S. P., E. V. Marietta, M. K. Smart, and C. S. David. 2001. Requirements for allergen-induced airway inflammation and hyperreactivity in CD4-deficient and CD4-sufficient HLA-DQ transgenic mice. J Allergy Clin Immunol 108:764-771. 146. Wolf, D., T. H. Schreiber, P. Tryphonopoulos, S. Li, A. G. Tzakis, P. Ruiz, and E. R. Podack. 2012. Tregs Expanded In Vivo by TNFRSF25 Agonists Promote Cardiac Allograft Survival. Transplantation 94:569-574. 147. PB, J. R., T. H. Schreiber, N. K. Rajasagi, A. Suryawanshi, S. Mulik, T. VeigaParga, T. Niki, M. Hirashima, E. R. Podack, and B. T. Rouse. 2012. TNFRSF25 Agonistic Antibody and Galectin-9 Combination Therapy Controls Herpes Simplex Virus-Induced Immunoinflammatory Lesions. J Virol 86:10606-10620. 148. Zhang, N., A. J. Sanders, L. Ye, H. G. Kynaston, and W. G. Jiang. 2010. Expression of vascular endothelial growth inhibitor (VEGI) in human urothelial cancer of the bladder and its effects on the adhesion and migration of bladder cancer cells in vitro. Anticancer Res 30:87-95. 149. Zhai, Y., J. Yu, L. Iruela-Arispe, W. Q. Huang, Z. Wang, A. J. Hayes, J. Lu, G. Jiang, L. Rojas, M. E. Lippman, J. Ni, G. L. Yu, and L. Y. Li. 1999. Inhibition of angiogenesis and breast cancer xenograft tumor growth by VEGI, a novel cytokine of the TNF superfamily. Int J Cancer 82:131-136. 119 150. Zhai, Y., J. Ni, G. W. Jiang, J. Lu, L. Xing, C. Lincoln, K. C. Carter, F. Janat, D. Kozak, S. Xu, L. Rojas, B. B. Aggarwal, S. Ruben, L. Y. Li, R. Gentz, and G. L. Yu. 1999. VEGI, a novel cytokine of the tumor necrosis factor family, is an angiogenesis inhibitor that suppresses the growth of colon carcinomas in vivo. Faseb J 13:181-189. 151. Yue, T. L., J. Ni, A. M. Romanic, J. L. Gu, P. Keller, C. Wang, S. Kumar, G. L. Yu, T. K. Hart, X. Wang, Z. Xia, W. E. DeWolf, Jr., and G. Z. Feuerstein. 1999. TL1, a novel tumor necrosis factor-like cytokine, induces apoptosis in endothelial cells. Involvement of activation of stress protein kinases (stress-activated protein kinase and p38 mitogen-activated protein kinase) and caspase-3-like protease. J Biol Chem 274:1479-1486. 152. Meylan, F., T. S. Davidson, E. Kahle, M. Kinder, K. Acharya, D. Jankovic, V. Bundoc, M. Hodges, E. M. Shevach, A. Keane-Myers, E. C. Wang, and R. M. Siegel. 2008. The TNF-family receptor DR3 is essential for diverse T cellmediated inflammatory diseases. Immunity 29:79-89. 153. Wang, E. C., J. Kitson, A. Thern, J. Williamson, S. N. Farrow, and M. J. Owen. 2001. Genomic structure, expression, and chromosome mapping of the mouse homologue for the WSL-1 (DR3, Apo3, TRAMP, LARD, TR3, TNFRSF12) gene. Immunogenetics 53:59-63. 154. Screaton, G. R., X. N. Xu, A. L. Olsen, A. E. Cowper, R. Tan, A. J. McMichael, and J. I. Bell. 1997. LARD: a new lymphoid-specific death domain containing receptor regulated by alternative pre-mRNA splicing. Proc Natl Acad Sci U S A 94:4615-4619. 155. Tan, K. B., J. Harrop, M. Reddy, P. Young, J. Terrett, J. Emery, G. Moore, and A. Truneh. 1997. Characterization of a novel TNF-like ligand and recently described TNF ligand and TNF receptor superfamily genes and their constitutive and inducible expression in hematopoietic and non-hematopoietic cells. Gene 204:3546. 156. Warzocha, K., P. Ribeiro, C. Charlot, N. Renard, B. Coiffier, and G. Salles. 1998. A new death receptor 3 isoform: expression in human lymphoid cell lines and non-Hodgkin's lymphomas. Biochem Biophys Res Commun 242:376-379. 157. Kang, Y. J., W. J. Kim, H. U. Bae, D. I. Kim, Y. B. Park, J. E. Park, B. S. Kwon, and W. H. Lee. 2005. Involvement of TL1A and DR3 in induction of proinflammatory cytokines and matrix metalloproteinase-9 in atherogenesis. Cytokine 29:229-235. 158. Haritunians, T., K. D. Taylor, S. R. Targan, M. Dubinsky, A. Ippoliti, S. Kwon, X. Guo, G. Y. Melmed, D. Berel, E. Mengesha, B. M. Psaty, N. L. Glazer, E. A. 120 Vasiliauskas, J. I. Rotter, P. R. Fleshner, and D. P. McGovern. 2010. Genetic predictors of medically refractory ulcerative colitis. Inflamm Bowel Dis 16:18301840. 159. Tremelling, M., C. Berzuini, D. Massey, F. Bredin, C. Price, C. Dawson, S. A. Bingham, and M. Parkes. 2008. Contribution of TNFSF15 gene variants to Crohn's disease susceptibility confirmed in UK population. Inflamm Bowel Dis 14:733-737. 160. Latiano, A., O. Palmieri, T. Latiano, G. Corritore, F. Bossa, G. Martino, G. Biscaglia, D. Scimeca, M. R. Valvano, M. Pastore, A. Marseglia, R. D'Inca, A. Andriulli, and V. Annese. 2011. Investigation of multiple susceptibility loci for inflammatory bowel disease in an Italian cohort of patients. PLoS One 6:e22688. 161. Shih, D. Q., R. Barrett, X. Zhang, N. Yeager, H. W. Koon, P. Phaosawasdi, Y. Song, B. Ko, M. H. Wong, K. S. Michelsen, G. Martins, C. Pothoulakis, and S. R. Targan. 2011. Constitutive TL1A (TNFSF15) expression on lymphoid or myeloid cells leads to mild intestinal inflammation and fibrosis. PLoS One 6:e16090. 162. Pappu, B. P., A. Borodovsky, T. S. Zheng, X. Yang, P. Wu, X. Dong, S. Weng, B. Browning, M. L. Scott, L. Ma, L. Su, Q. Tian, P. Schneider, R. A. Flavell, C. Dong, and L. C. Burkly. 2008. TL1A-DR3 interaction regulates Th17 cell function and Th17-mediated autoimmune disease. J Exp Med 205:1049-1062. 163. Bull, M. J., A. S. Williams, Z. Mecklenburgh, C. J. Calder, J. P. Twohig, C. Elford, B. A. Evans, T. F. Rowley, T. J. Slebioda, V. Y. Taraban, A. AlShamkhani, and E. C. Wang. 2008. The Death Receptor 3-TNF-like protein 1A pathway drives adverse bone pathology in inflammatory arthritis. J Exp Med 205:2457-2464. 164. Zhang, J., X. Wang, H. Fahmi, S. Wojcik, J. Fikes, Y. Yu, J. Wu, and H. Luo. 2009. Role of TL1A in the pathogenesis of rheumatoid arthritis. J Immunol 183:5350-5357. 165. Thilenius, A. R., K. Braun, and J. H. Russell. 1997. Agonist antibody and Fas ligand mediate different sensitivity to death in the signaling pathways of Fas and cytoplasmic mutants. Eur J Immunol 27:1108-1114. 166. Totpal, K., R. LaPushin, T. Kohno, B. G. Darnay, and B. B. Aggarwal. 1994. TNF and its receptor antibody agonist differ in mediation of cellular responses. J Immunol 153:2248-2257. 167. Barrett, R., X. Zhang, H. W. Koon, M. Vu, J. Y. Chang, N. Yeager, M. A. Nguyen, K. S. Michelsen, D. Berel, C. Pothoulakis, S. R. Targan, and D. Q. Shih. 121 2012. Constitutive TL1A expression under colitogenic conditions modulates the severity and location of gut mucosal inflammation and induces fibrostenosis. Am J Pathol 180:636-649. 168. Schreiber, T. H., S. Q. Khan, and E. R. Podack. 2011. Response to Taraban, Ferdinand, and Al-Shamkhani. The Journal of Clinical Investigation 121:465465. 169. Strbo, N., K. Yamazaki, K. Lee, D. Rukavina, and E. R. Podack. 2002. Heat shock fusion protein gp96-Ig mediates strong CD8 CTL expansion in vivo. Am J Reprod Immunol 48:220-225. 170. Bebbington, C. R., G. Renner, S. Thomson, D. King, D. Abrams, and G. T. Yarranton. 1992. High-level expression of a recombinant antibody from myeloma cells using a glutamine synthetase gene as an amplifiable selectable marker. Biotechnology (N Y) 10:169-175. 171. Zhan, C., Q. Yan, Y. Patskovsky, Z. Li, R. Toro, A. Meyer, H. Cheng, M. Brenowitz, S. G. Nathenson, and S. C. Almo. 2009. Biochemical and structural characterization of the human TL1A ectodomain. Biochemistry 48:7636-7645. 172. Zhan, C., Y. Patskovsky, Q. Yan, Z. Li, U. Ramagopal, H. Cheng, M. Brenowitz, X. Hui, S. G. Nathenson, and S. C. Almo. 2011. Decoy strategies: the structure of TL1A:DcR3 complex. Structure 19:162-171. Jin, T., F. Guo, S. Kim, A. Howard, and Y. Z. Zhang. 2007. X-ray crystal structure of TNF ligand family member TL1A at 2.1A. Biochem Biophys Res Commun 364:1-6. 173. 174. Jin, T., S. Kim, F. Guo, A. Howard, and Y. Z. Zhang. 2007. Purification and crystallization of recombinant human TNF-like ligand TL1A. Cytokine 40:115122. 175. Wan, Y. Y., and R. A. Flavell. 2005. Identifying Foxp3-expressing suppressor T cells with a bicistronic reporter. Proc Natl Acad Sci U S A 102:5126-5131. 176. Ito, T., Y. H. Wang, O. Duramad, S. Hanabuchi, O. A. Perng, M. Gilliet, F. X. Qin, and Y. J. Liu. 2006. OX40 ligand shuts down IL-10-producing regulatory T cells. Proc Natl Acad Sci U S A 103:13138-13143. 177. Andersson, J., I. Stefanova, G. L. Stephens, and E. M. Shevach. 2007. CD4+CD25+ regulatory T cells are activated in vivo by recognition of self. Int Immunol 19:557-566. 178. Leithauser, F., T. Meinhardt-Krajina, K. Fink, B. Wotschke, P. Moller, and J. Reimann. 2006. Foxp3-expressing CD103+ regulatory T cells accumulate in 122 dendritic cell aggregates of the colonic mucosa in murine transfer colitis. Am J Pathol 168:1898-1909. 179. Zhao, D., C. Zhang, T. Yi, C. L. Lin, I. Todorov, F. Kandeel, S. Forman, and D. Zeng. 2008. In vivo-activated CD103+CD4+ regulatory T cells ameliorate ongoing chronic graft-versus-host disease. Blood 112:2129-2138. 180. Beyersdorf, N., X. Ding, J. K. Tietze, and T. Hanke. 2007. Characterization of mouse CD4 T cell subsets defined by expression of KLRG1. Eur J Immunol 37:3445-3454. 181. Yoshiya, K., P. H. Lapchak, T. H. Thai, L. Kannan, P. Rani, J. J. Dalle Lucca, and G. C. Tsokos. 2011. Depletion of gut commensal bacteria attenuates intestinal ischemia/reperfusion injury. Am J Physiol Gastrointest Liver Physiol 301:G10201030. Monteiro, J. P., J. Farache, A. C. Mercadante, J. A. Mignaco, M. Bonamino, and A. Bonomo. 2008. Pathogenic effector T cell enrichment overcomes regulatory T cell control and generates autoimmune gastritis. J Immunol 181:5895-5903. 182. 183. 184. Tang, Q., J. Y. Adams, C. Penaranda, K. Melli, E. Piaggio, E. Sgouroudis, C. A. Piccirillo, B. L. Salomon, and J. A. Bluestone. 2008. Central role of defective interleukin-2 production in the triggering of islet autoimmune destruction. Immunity 28:687-697. Taams, L. S., E. P. Boot, W. van Eden, and M. H. Wauben. 2000. 'Anergic' T cells modulate the T-cell activating capacity of antigen-presenting cells. J Autoimmun 14:335-341. 185. Eddahri, F., G. Oldenhove, S. Denanglaire, J. Urbain, O. Leo, and F. Andris. 2006. CD4+ CD25+ regulatory T cells control the magnitude of T-dependent humoral immune responses to exogenous antigens. Eur J Immunol 36:855-863. 186. Mempel, T. R., M. J. Pittet, K. Khazaie, W. Weninger, R. Weissleder, H. von Boehmer, and U. H. von Andrian. 2006. Regulatory T cells reversibly suppress cytotoxic T cell function independent of effector differentiation. Immunity 25:129-141. 187. Smith, J. A., J. Y. Tso, M. R. Clark, M. S. Cole, and J. A. Bluestone. 1997. Nonmitogenic anti-CD3 monoclonal antibodies deliver a partial T cell receptor signal and induce clonal anergy. J Exp Med 185:1413-1422. 188. Smith, J. A., Q. Tang, and J. A. Bluestone. 1998. Partial TCR signals delivered by FcR-nonbinding anti-CD3 monoclonal antibodies differentially regulate individual Th subsets. J Immunol 160:4841-4849. 189. Belghith, M., J. A. Bluestone, S. Barriot, J. Megret, J. F. Bach, and L. Chatenoud. 2003. TGF-beta-dependent mechanisms mediate restoration of self-tolerance 123 induced by antibodies to CD3 in overt autoimmune diabetes. Nat Med 9:12021208. 190. Xiao, X., W. Gong, G. Demirci, W. Liu, S. Spoerl, X. Chu, D. K. Bishop, L. A. Turka, and X. C. Li. 2012. New insights on OX40 in the control of T cell immunity and immune tolerance in vivo. J Immunol 188:892-901. 191. Bazzoni, F., and B. Beutler. 1996. The tumor necrosis factor ligand and receptor families. N Engl J Med 334:1717-1725. 192. Zhou, Z., Y. Tone, X. Song, K. Furuuchi, J. D. Lear, H. Waldmann, M. Tone, M. I. Greene, and R. Murali. 2008. Structural basis for ligand-mediated mouse GITR activation. Proc Natl Acad Sci U S A 105:641-645. 193. Bollyky, P. L., J. B. Bice, I. R. Sweet, B. A. Falk, J. A. Gebe, A. E. Clark, V. H. Gersuk, A. Aderem, T. R. Hawn, and G. T. Nepom. 2009. The toll-like receptor signaling molecule Myd88 contributes to pancreatic beta-cell homeostasis in response to injury. PLoS One 4:e5063. 194. Bruno, L., J. Kirberg, and H. von Boehmer. 1995. On the cellular basis of immunological T cell memory. Immunity 2:37-43. Garcia, S., J. DiSanto, and B. Stockinger. 1999. Following the development of a CD4 T cell response in vivo: from activation to memory formation. Immunity 11:163-171. 195. 196. Gillies, S. D., and J. S. Wesolowski. 1990. Antigen binding and biological activities of engineered mutant chimeric antibodies with human tumor specificities. Hum Antibodies Hybridomas 1:47-54. 197. Slebioda, T. J., T. F. Rowley, J. R. Ferdinand, J. E. Willoughby, S. L. Buchan, V. Y. Taraban, and A. Al-Shamkhani. 2011. Triggering of TNFRSF25 promotes CD8(+) T-cell responses and anti-tumor immunity. Eur J Immunol 41:2606-2611. 198. Yamazaki, K., T. Nguyen, and E. R. Podack. 1999. Cutting edge: tumor secreted heat shock-fusion protein elicits CD8 cells for rejection. J Immunol 163:51785182. 199. Prehn, J. L., S. Mehdizadeh, C. J. Landers, X. Luo, S. C. Cha, P. Wei, and S. R. Targan. 2004. Potential role for TL1A, the new TNF-family member and potent costimulator of IFN-gamma, in mucosal inflammation. Clin Immunol 112:66-77. 200. Twohig, J. P., M. Marsden, S. M. Cuff, J. R. Ferdinand, A. M. Gallimore, W. V. Perks, A. Al-Shamkhani, I. R. Humphreys, and E. C. Wang. 2012. The death receptor 3/TL1A pathway is essential for efficient development of antiviral CD4(+) and CD8(+) T-cell immunity. Faseb J 26:3575-3586. 201. 124 Nishikawa, H., T. Kato, M. Hirayama, Y. Orito, E. Sato, N. Harada, S. Gnjatic, L. J. Old, and H. Shiku. 2008. Regulatory T cell-resistant CD8+ T cells induced by glucocorticoid-induced tumor necrosis factor receptor signaling. Cancer Res 68:5948-5954.