* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download CHAPTER 10: The Structure and Function of DNA
DNA profiling wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Expanded genetic code wikipedia , lookup
Human genome wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
Nutriepigenomics wikipedia , lookup
SNP genotyping wikipedia , lookup
Non-coding RNA wikipedia , lookup
Genomic library wikipedia , lookup
History of RNA biology wikipedia , lookup
Frameshift mutation wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Genetic engineering wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Designer baby wikipedia , lookup
DNA polymerase wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Epitranscriptome wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Microsatellite wikipedia , lookup
Genetic code wikipedia , lookup
DNA vaccination wikipedia , lookup
Molecular cloning wikipedia , lookup
Epigenomics wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Non-coding DNA wikipedia , lookup
DNA supercoil wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Microevolution wikipedia , lookup
Helitron (biology) wikipedia , lookup
Point mutation wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
History of genetic engineering wikipedia , lookup
Primary transcript wikipedia , lookup
CHAPTER 10: The Structure and Function of DNA Why This Chapter Matters 1. Hereditary information is stored in the chemical language of DNA. 2. DNA directs the biochemical, cellular, anatomical, and physiological activities of the human body. 3. Scientists can manipulate the DNA of cells to modify the traits of crops, transform the characteristics of cells, and treat and potentially prevent disease. 4. Viruses play a key role in the history of molecular biology and continue to be important pathogens in humans, bacteria, plants, and animals. 5. Treatments and cures for viral infections are likely to be the products of research into molecular biology. B: Learning Objectives for Chapter 10 in Textbook (see lecture objectives below) Biology and Society: Tracking a Killer 1. Explain how flu vaccines are produced and why flu vaccines are important. DNA: Structure and Replication 2. Explain what was and was not known about DNA by the early 1950s. 3. Describe and compare the chemical compositions of DNA and RNA. 4. Describe the key features of the overall shape of a DNA molecule. Explain how Watson and Crick determined the structure of DNA. 5. Describe the process of DNA replication. The Flow of Genetic Information from DNA to RNA to Protein 6. Define transcription and translation. Explain why the hypothesis “one gene-one enzyme” is not correct. 7. Explain how the language of DNA directs the production of polypeptides. 8. Explain how codons are used to construct polypeptides. Explain what the authors mean when they state “there is redundancy in the code but no ambiguity.” 9. Describe the steps of transcription and the processing of RNA before it leaves the nucleus. 10. Compare the structures and functions of mRNA, tRNA, and rRNA. 11. Describe in detail the process of translation. 12. Distinguish between insertion, deletion, and substitution mutations. Explain how mutations can be harmful or beneficial to organisms. Viruses and Other Noncellular Infectious Agents 13. Compare the lytic and lysogenic cycles of bacteriophages. 14. Compare the life cycles of RNA and DNA viruses. Describe the spread, symptoms, and prevention of viral diseases in plants and animals. 15. Describe the reproductive cycle of retroviruses such as HIV and the mechanisms by which AZT and protease inhibitors limit AIDS. 16. Explain how viroids and prions cause disease. Evolution Connection: Emerging Viruses 17. Describe the three processes that contribute to the emergence of viral disease. Key Terms adenine (A) AIDS bacteriophages cap codon cytosine (C) DNA DNA polymerase double helix emerging viruses exons genetic code guanine (G) HIV introns lysogenic cycle lytic cycle messenger RNA molecular biology mutagen mutation nucleotide phages polynucleotide prion promoter prophage provirus retrovirus reverse transcriptase ribosomal RNA (rRNA) RNA polymerase RNA splicing start codon stop codon sugar-phosphate backbone tail terminator thymine (T) transcription transfer RNA (tRNA) translation uracil (U) virus Word Roots muta = change; gen = producing (mutagen: a physical or chemical agent that causes mutations) phage = eat (bacteriophages: viruses that attack bacteria) poly = many (polynucleotide: a polymer of many nucleotides) pro = before (prophage: phage DNA inserted into the bacterial chromosome before viral replication) retro = backward (retrovirus: an RNA virus that reproduces by first transcribing its RNA into DNA then inserting the DNA molecule into a host’s DNA) trans = across; script = write (transcription: the transfer of genetic information from DNA into an RNA molecule) LECTURE OBJECTIVES FOR CHAPTERS 10: DNA Structure and Function 1. Explain why proteins were thought to be the cell's genetic material. Was this a logical hypothesis? Was this a correct hypothesis? What is the "tempting template hypothesis" and who is Johann Frederick Miescher (1868)? Compare the terms nuclein, chromatin, and DNA. (class notes) 2. Describe the results of P.A. Levine's research on the biochemistry of DNA. State the two major conclusions he reached? (class notes) 3. Define “nucleotide” and explain why nucleotides are important. 4. Explain Griffith's experiments in which he discovered "transforming factor." What was the significance of these experiments? 5. Explain what significant information O.T. Avery contributed to our understanding of transforming factor. 6. Explain what Escherichia coli (E. coli), phages, and bacteriophages are. Name the two scientists considered the fathers of bactriophage research, prepare a simple sketch of the structure of a bactriophage, and explain why bacteriophages are so useful in studying DNA. 7. Explain the experiments of Hershey and Chase. What did they show? Did their work support the findings of Oswald Avery or the deduction of P. A. Levine? 8. State the results of Chargaff's experiments on the ratios of the four types of nucleotides in the DNA of various species of life. Compare this with the findings of P. A. Levine. (see table below, they are not in your textbook) Chargaff's Results, 1952 COMPARISON OF BASE RATIOS OF THE DNA OF SEVERAL SPECIES Source Human being Ox Salmon sperm Wheat germ E. coli bacteria Sea urchin adenine(A) 30.4% 29.0% 29.7% 28.1% 24.7% 32.8% guanine (G) 19.6% 21.2% 20.8% 21.8% 26.0% 17.7% cytosine (C) 19.9% 21.2% 20.4% 22.7% 25.7% 17.3% thymine (T) 30.1% 28.7% 29.1% 27.4% 23.6% 32.1% 9. Explain what X-ray diffraction is and state how the X-ray diffraction studies of Wilkins and Franklin contributed to our understanding of the structure of the DNA molecule. 10. State at least four characteristics that DNA, or any other molecule, must exhibit if it is to, indeed, be the genetic code of life.(class notes) 1. It must carry genetic information from cell to cell and from generation to generation. It must carry a great amount of information. 2. It must carry information to copy itself and be able to do so with great precision. 3. BUT... it must also make mistakes sometimes (mutate). Mistakes (mutations) must then be copied as faithfully as the original. Without the capacity of the genetic molecule to copy its mistakes, there could be no evolution by natural selection. 4. There must be some mechanism for decoding the stored genetic information and translating it into action in the living cell. 11. List five significant pieces of data known by Watson and Crick as they began their attempt to discover the molecular structure of DNA. (class notes) 1. The DNA molecule known to be a very large, long, and very thin molecule composed of four sub-units: adenine nucleotides, guanine nucleotides, cytosine nucleotides and thymine nucleotides. 2. Levine thought these nucleotides were arranged in repeating units of four-"tetranucleotides" and thought the molecule was therefore pretty uninteristing=boring! 3. Linus Pauling had shown that protein molecules were often great large helices, and suggested that DNA may also be a helix. 4. Wilkin's and Franklin's X-ray diffraction photos showed patterns that very strongly suggested that DNA was helical. 5. Chargaff's data, which contradicted Levine's, suggested that A=T and C=G. 12. Describe the Watson/Crick model of the structure of DNA. 13. Define: replication, DNA polymerase, and semi conservative replication. 14. Describe the structure of a eukaryotic chromosome by defining the following terms and explaining their relationship to each other: chromosome, gene, histone proteins, chromatin. How many of each or the following are found in HUMAN cells? chromosomes, genes, bases, inches of uncoiled DNA, feet of uncoiled DNA OBJECTIVES FOR CHAPTER 14: GENE FUNCTION: RNA AND PROTEIN SYNTHESIS 1. Explain why "making proteins" is so important to cells. 2. Outline the flow of genetic information in cells from DNA to protein. (“the central dogma of biology.) DNA ------------transcription------------RNA---------translation----------PROTEIN . 3. Explain what a gene is. How many genes are found in each human cell? How many chromosomes are found in each human cell? Describe the relationship between nucleotides, genes, chromosomes, and DNA? 4. Explain what DNA triplets are and how they are related to the genetic code, amino acids and proteins. 5. List three differences between the molecular structure of DNA and mRNA and compare mRNA and tRNA anddescribe the function of each of these four molecules. 6. Define and compare the terms replication, transcription, and translation. 7. List the base-pairing rules that apply to DNA and mRNA for transcription. 8. Compare the following pairs: mRNA/tRNA; triplet/codon; codon/anticodon; anticodon/amino acid attachment site (of tRNA). 9. Describe in detail how DNA directs the construction of proteins in a cell. Prepare a diagram like the one passed out in class to help you summarize this process. 10. List the three terminator codons. (UAA, UAG, UGA) more>>> 11. Be able to answer questions like the ones below: a. If a strand of mRNA reads UUUUCACGCGGUGGGGUUCCCCAACCGGACAUUUGGAAAUAA, what polypeptide does it stand for? If a gene (DNA) reads CAGAGTAATAGGTACCATTAGGGAAAAGACACT, what polypeptide does it stand for? b. A polypeptide hormone from the pituitary gland, oxytocin, which causes the uterus to contract during childbirth, has the following amino acid sequence: cys-tyr-phe-glu-asn-cys-pro-arg-gly. Write a possible base sequence for the mRNA which translates for this polypeptide and a possible base sequence for the gene which codes for this polypeptide. c. Disregarding initiators and introns but NOT terminators; how many bases are in the gene for a protein of 100 amino acids; how many codons are in the mRNA for a protein which is composed of 82 amino acids; insulin is composed of two polypeptides, one of 21 amino acids and one of 30 amino acids, how many bases are in each of the genes for the two subunits of insulin? 12. Define the term mutation and explain the possible effects of mutations on protein synthesis. List three types of mutations (additions, deletions, substitutions). Define the terms spontaneous mutation and mutation rate. Key Investigators Freidrich Meischer P.A.T. Levine Frederick Griffith O.T. Avery Hershey and Chase Salvador Luria and Max Delbrϋck Erwin Chargaff James Watson and Francis Crick Maurice Wilkins and Rosalind Franklin