ppt
... •Given a multiple fasta sequence file*, write a script that for each sequence extract the gi number and the species name. and rewrites the file so that the annotation line starts with the gi number, followed by the species/strain name, followed by a space. (The gi number and the species name should ...
... •Given a multiple fasta sequence file*, write a script that for each sequence extract the gi number and the species name. and rewrites the file so that the annotation line starts with the gi number, followed by the species/strain name, followed by a space. (The gi number and the species name should ...
Review Questions
... ribosome is the site of protein synthesis in a cell. A ribosome has two parts called subunits. When not translating, the small subunit is unattached to the large subunit. During translation, the small subunit will bond to the mRNA and the large subunit bonds to the small subunit cradling the mRNA be ...
... ribosome is the site of protein synthesis in a cell. A ribosome has two parts called subunits. When not translating, the small subunit is unattached to the large subunit. During translation, the small subunit will bond to the mRNA and the large subunit bonds to the small subunit cradling the mRNA be ...
Introduction to molecular population genetics
... Nucleotide sequence A difference in nucleotide sequence is the most obvious way in which two homologous stretches of DNA may differ. The differences may be in translated portions of protein genes (exons), portions of protein genes that are transcribed but not translated (e.g., introns, 5’ or 3’ unt ...
... Nucleotide sequence A difference in nucleotide sequence is the most obvious way in which two homologous stretches of DNA may differ. The differences may be in translated portions of protein genes (exons), portions of protein genes that are transcribed but not translated (e.g., introns, 5’ or 3’ unt ...
File - Year 11 Science
... the areas involved in creating transgenic plants. Steps may be missing or out of sequence. the answer communicates ideas using simple language and uses limited scientific terminology spelling, punctuation and grammar are used with limited accuracy ...
... the areas involved in creating transgenic plants. Steps may be missing or out of sequence. the answer communicates ideas using simple language and uses limited scientific terminology spelling, punctuation and grammar are used with limited accuracy ...
translational - Bioinformatics Institute
... • Anti-codon (on tRNA) base-pairs with CODON (on mRNA ). • Amino-acid (a.a.) is attached at 3’-end of tRNA. • Specificity: Each tRNA type is specific for only the a.a. it carries: E.g.: tRNAMet carries only methione; and tRNAGly only glycine. • 50 different tRNAs in eukaryotes. • But only 20 amino a ...
... • Anti-codon (on tRNA) base-pairs with CODON (on mRNA ). • Amino-acid (a.a.) is attached at 3’-end of tRNA. • Specificity: Each tRNA type is specific for only the a.a. it carries: E.g.: tRNAMet carries only methione; and tRNAGly only glycine. • 50 different tRNAs in eukaryotes. • But only 20 amino a ...
Biology I ECA Review Standard 7 Genetics
... allelic and polygenic traits and illustrate their inheritance patterns over multiple generations. 7.3 Determine the likelihood of the appearance of a specific trait in an offspring given the genetic make-up of the parents. 7.4 Explain the process by which a cell copies its DNA and identify facto ...
... allelic and polygenic traits and illustrate their inheritance patterns over multiple generations. 7.3 Determine the likelihood of the appearance of a specific trait in an offspring given the genetic make-up of the parents. 7.4 Explain the process by which a cell copies its DNA and identify facto ...
Genetics: The Information Broker
... Translation of the information - expressing as proteins (requires new language with new alphabet!) ...
... Translation of the information - expressing as proteins (requires new language with new alphabet!) ...
SBI4U: Molecular Genetics Unit Review
... A retrovirus is one whose genome is contained in RNA rather than DNA. HIV is a retrovirus that contains reverse transcriptase within its structure. It selectively targets T-cells in a host’s immune system, and infects them. Once inside the host cell, reverse transcriptase makes a dsDNA copy of the v ...
... A retrovirus is one whose genome is contained in RNA rather than DNA. HIV is a retrovirus that contains reverse transcriptase within its structure. It selectively targets T-cells in a host’s immune system, and infects them. Once inside the host cell, reverse transcriptase makes a dsDNA copy of the v ...
Mutation at the phenylalanine hydroxylase gene (PAH) and its use
... Seven mutations, each unlikely to be disease-causing, were found in cis with a disease-causing mutation; they are: i) three apparent polymorphisms in introns of which two were previously known (IVS2nt19t→c and IVS3nt-22c→t) and the third, heretofore unknown (IVS6nt-55t→c); ii) four silent polymorphi ...
... Seven mutations, each unlikely to be disease-causing, were found in cis with a disease-causing mutation; they are: i) three apparent polymorphisms in introns of which two were previously known (IVS2nt19t→c and IVS3nt-22c→t) and the third, heretofore unknown (IVS6nt-55t→c); ii) four silent polymorphi ...
ODE TO THE CODE - bit
... More generally, there is growing recognition that the genetic code may encompass more information than just the simple mapping from codons to amino acids. Synonymous codons may not always be completely equivalent. It’s certainly true that codon frequencies are not random or uniform. Among the severa ...
... More generally, there is growing recognition that the genetic code may encompass more information than just the simple mapping from codons to amino acids. Synonymous codons may not always be completely equivalent. It’s certainly true that codon frequencies are not random or uniform. Among the severa ...
statgen4
... Third fix point is in the range [0,1] only if r and s have the same sign. It is stable only of both r and s are positive In all other cases one allele is extinct. If r>0 and s=0 then the steady state is still p=0, but is is obtained with a rate pn=1/(nr+1/p0) ...
... Third fix point is in the range [0,1] only if r and s have the same sign. It is stable only of both r and s are positive In all other cases one allele is extinct. If r>0 and s=0 then the steady state is still p=0, but is is obtained with a rate pn=1/(nr+1/p0) ...
17q12 microdeletions but not intragenic HNF1B mutations are
... 38 individuals participated in the study; 18 (47%) had a known intragenic HNF1B mutation and 20 (53%) had a whole-gene deletion. The intragenic mutations included four nonsense, 13 insertions/deletions and one missense change (Supplementary Table 1). The presence of the common 1.3 Mb 17q12 deletion ...
... 38 individuals participated in the study; 18 (47%) had a known intragenic HNF1B mutation and 20 (53%) had a whole-gene deletion. The intragenic mutations included four nonsense, 13 insertions/deletions and one missense change (Supplementary Table 1). The presence of the common 1.3 Mb 17q12 deletion ...
Diversity and molecular evolution of the RPS2 resistance gene in
... the RPS2 protein-coding region, which contains no introns (10, 11), and a portion of the flanking DNA, including 18 nucleotides at the 59 end and 107 nucleotides at the 39 end of the ORF. For two accessions, even though the entire RPS2 gene was present, the complete sequence was not obtained: the Wu ...
... the RPS2 protein-coding region, which contains no introns (10, 11), and a portion of the flanking DNA, including 18 nucleotides at the 59 end and 107 nucleotides at the 39 end of the ORF. For two accessions, even though the entire RPS2 gene was present, the complete sequence was not obtained: the Wu ...
Fine scale mapping
... among cases and not among controls. Decreased probability of sharing as distance from disease locus increases. Approximate location of disease locus inferred. ...
... among cases and not among controls. Decreased probability of sharing as distance from disease locus increases. Approximate location of disease locus inferred. ...
Widespread Macromolecular Interaction Perturbations in Human
... insights pertaining to disease pathogenesis. Although genotype- missense mutations. Since chaperones and associated quality phenotype relationships can be modeled under the assumption control factors (QCFs) can salvage unstable proteins by assisting that most disease-associated mutations lead to com ...
... insights pertaining to disease pathogenesis. Although genotype- missense mutations. Since chaperones and associated quality phenotype relationships can be modeled under the assumption control factors (QCFs) can salvage unstable proteins by assisting that most disease-associated mutations lead to com ...
These practice questions are from prior LS4 finals and are courtesy
... C) How will you distinguish cells that integrated the transgene by homologous recombination from those that integrated it in the incorrect place by non-homologous recombination? ES cells in which homologous recombination occurred will have not have GFP, whereas cells in which non-homologous integrat ...
... C) How will you distinguish cells that integrated the transgene by homologous recombination from those that integrated it in the incorrect place by non-homologous recombination? ES cells in which homologous recombination occurred will have not have GFP, whereas cells in which non-homologous integrat ...
Rapid communication: Nucleotide sequence of the river buffalo beta
... primer and superscript II reverse transcriptase (GIBCOBRL, Grand Island, NY). PCR was performed using the above oligo d(T)17 as reverse primer and a forward primer (5′ GGAAAAAAGGAATTGAGAGCC 3′) designed on the basis of conserved regions, through a multiple alignment of bovine, ovine, caprine, and po ...
... primer and superscript II reverse transcriptase (GIBCOBRL, Grand Island, NY). PCR was performed using the above oligo d(T)17 as reverse primer and a forward primer (5′ GGAAAAAAGGAATTGAGAGCC 3′) designed on the basis of conserved regions, through a multiple alignment of bovine, ovine, caprine, and po ...
Last semester I tried a new strategy to teach macro
... was Halloween & I had lots of candy, so I brought in bags of candy so students could use it to illustrate the various processes. It could be used with anything really, but the candy was fun, cheap, & they can eat it as a reward or in the process. I broke them up into groups & gave them assorted cand ...
... was Halloween & I had lots of candy, so I brought in bags of candy so students could use it to illustrate the various processes. It could be used with anything really, but the candy was fun, cheap, & they can eat it as a reward or in the process. I broke them up into groups & gave them assorted cand ...
proposal
... gene, coded for by exon 8 of LMNA/C. In fact there are at least three different mutations affecting the Arginine at position 482 (R482Q, R482W, R482L). 90% of the FPLD-associated LMNA patients and 12% of all laminopathy patients have a mutation in this highly conserved arginine [28, 31]. Nearby the ...
... gene, coded for by exon 8 of LMNA/C. In fact there are at least three different mutations affecting the Arginine at position 482 (R482Q, R482W, R482L). 90% of the FPLD-associated LMNA patients and 12% of all laminopathy patients have a mutation in this highly conserved arginine [28, 31]. Nearby the ...
Exam 3
... Screening the library for the colony that contains human hgh gene using Hgh antibodies. 1. Transfer the colonies to filter paper. 2. Obtain the antibody to Hgh. 3. Place the filter into a bag along with the antibody to Hgh. 4. The Hgh antibody will bind to the Hgh made by the colonies that contain t ...
... Screening the library for the colony that contains human hgh gene using Hgh antibodies. 1. Transfer the colonies to filter paper. 2. Obtain the antibody to Hgh. 3. Place the filter into a bag along with the antibody to Hgh. 4. The Hgh antibody will bind to the Hgh made by the colonies that contain t ...
NOTE slides 15-21
... Define operon. Identify the operon in this diagram and the organism it is in. What do the genes in this operon code for and how does it benefit E. coli? Study the diagram and identify the two regulatory regions. Describe and explain the function of the promoter region. Describe and explain the funct ...
... Define operon. Identify the operon in this diagram and the organism it is in. What do the genes in this operon code for and how does it benefit E. coli? Study the diagram and identify the two regulatory regions. Describe and explain the function of the promoter region. Describe and explain the funct ...
grade: / 125
... False. Even if you observe phenotypic variability, you still don’t know whether that variability is due to environmental or genetic factors. ...
... False. Even if you observe phenotypic variability, you still don’t know whether that variability is due to environmental or genetic factors. ...
Lesson Overview
... The Molecular Basis of Heredity One of the most interesting discoveries of molecular biology is the nearuniversal nature of the genetic code. Although some organisms show slight variations in the amino acids assigned to particular codons, the code is always read three bases at a time and in the same ...
... The Molecular Basis of Heredity One of the most interesting discoveries of molecular biology is the nearuniversal nature of the genetic code. Although some organisms show slight variations in the amino acids assigned to particular codons, the code is always read three bases at a time and in the same ...
Nucleic Acids notes
... Nonsense mutations- a change that produces a stop codon resulting in a prematurely shortened protein. ex. CGA UGA gives Arg stop -The effects are variable depending upon how much truncated protein is present and ...
... Nonsense mutations- a change that produces a stop codon resulting in a prematurely shortened protein. ex. CGA UGA gives Arg stop -The effects are variable depending upon how much truncated protein is present and ...
Orphanet inventory of genes related to rare diseases
... genes are annotated as causative (from germline or somatic mutations), modifiers, major susceptibility factors or playing a role in the phenotype (for chromosomal anomalies). When causative mutations are of germline origin, loss or gain of the protein function are documented if available. Two relati ...
... genes are annotated as causative (from germline or somatic mutations), modifiers, major susceptibility factors or playing a role in the phenotype (for chromosomal anomalies). When causative mutations are of germline origin, loss or gain of the protein function are documented if available. Two relati ...
Frameshift mutation
A frameshift mutation (also called a framing error or a reading frame shift) is a genetic mutation caused by indels (insertions or deletions) of a number of nucleotides in a DNA sequence that is not divisible by three. Due to the triplet nature of gene expression by codons, the insertion or deletion can change the reading frame (the grouping of the codons), resulting in a completely different translation from the original. The earlier in the sequence the deletion or insertion occurs, the more altered the protein. A frameshift mutation is not the same as a single-nucleotide polymorphism in which a nucleotide is replaced, rather than inserted or deleted. A frameshift mutation will in general cause the reading of the codons after the mutation to code for different amino acids. The frameshift mutation will also alter the first stop codon (""UAA"", ""UGA"" or ""UAG"") encountered in the sequence. The polypeptide being created could be abnormally short or abnormally long, and will most likely not be functional.Frameshift mutations are apparent in severe genetic diseases such as Tay-Sachs disease and Cystic Fibrosis; they increase susceptibility to certain cancers and classes of familial hypercholesterolaemia; in 1997, a frameshift mutation was linked to resistance to infection by the HIV retrovirus. Frameshift mutations have been proposed as a source of biological novelty, as with the alleged creation of nylonase, however, this interpretation is controversial. A study by Negoro et al (2006) found that a frameshift mutation was unlikely to have been the cause and that rather a two amino acid substitution in the catalytic cleft of an ancestral esterase amplified Ald-hydrolytic activity.