Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Practice with Transcription & Translation Directions: 1. Fill in the complementary DNA strand using DNA base pairing rules. 2. Transcribe the correct mRNA sequence using the BOTTOM DNA template (the one that you just wrote) 3. Write the corresponding tRNA anticodons that match the mRNA codons. 4. Write the correct amino acid sequence by translating the mRNA codons using Figure 12-17 on page 303 in your textbook. Example: DNA: TACTTCAAGTTTAGGCGCAGTGTTCCATTTCGCATC Comp. DNA: mRNA: tRNA(anticodons): Amino Acids: DNA: Comp. DNA: TACCGCAGCCGTCCAGTTTTCCGCCTGCGCCCC ATC mRNA: tRNA(anticodons): Amino Acids: 1 modified 6/26/2017 DNA: Comp. DNA: TACAGTAGGTTTCCATTCCTGCGTAAAGCGCCGACT mRNA: tRNA(anticodons): Amino Acids: DNA: Comp. DNA: TACCTGTCCCCAGACAGGTTCAGTGCGAAACGTA CT mRNA: tRNA(anticodons): Amino Acids: DNA: Comp. DNA: TACTAGGTTTTCCATTCCTGCGTCTCCAGTGGCATC mRNA: tRNA(anticodons): Amino Acids: 2 modified 6/26/2017