* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Guided Exploration- (RI3) Learning Goal Three: Explain how DNA is
Bisulfite sequencing wikipedia , lookup
Transcription factor wikipedia , lookup
Genealogical DNA test wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Frameshift mutation wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Molecular cloning wikipedia , lookup
DNA vaccination wikipedia , lookup
Transfer RNA wikipedia , lookup
Epigenomics wikipedia , lookup
RNA silencing wikipedia , lookup
History of genetic engineering wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Polyadenylation wikipedia , lookup
DNA supercoil wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Helitron (biology) wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Non-coding DNA wikipedia , lookup
Point mutation wikipedia , lookup
History of RNA biology wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Non-coding RNA wikipedia , lookup
Expanded genetic code wikipedia , lookup
Messenger RNA wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Epitranscriptome wikipedia , lookup
Guided Exploration- (RI3) Learning Goal Three: Explain how DNA is related to proteins (RNA, transcription, translation). Part One: RNA-Transcription and Translation In Class: Follow powerpoint Out of Class: Out of Class: Go to Ms. Franzen’s Website (https://elin-franzen.diplomaplus.net/index/837300) and, under Biology Two- Student Resources find the Powerpoint-TranscriptionTranslation Objective: SWBAT recognize the differences between RNA and DNA. SWBAT demonstrate understanding of Transcription and Translation by decoding a sequence to create a protein. Use the PowerPoint to answer the following: 1. What are the differences between RNA and DNA? a. It has ____________________ strand instead of _________________. 2. 3. 4. 5. b. Instead of having a Thymine base, RNA replaces it with _______________________. - So, C still pairs with G (Cytosine with Guanine) BUT NOW, A pairs with _____. RNA is like a ______________________________ of DNA. It actually gets sent out to the ribosome to build proteins. ANALOGY: a. DNA is the ______________. It makes a photocopy (____________) of the DNA (the instructions) to send out to its workers (the _________________________). RNA is a copy of PART of the DNA strand, and is ____________________ to one protein. We call RNA ________________ or Messenger RNA because it carries instructions from the nucleus to the ribosome. Transcription is the process that creates __________ from ___________. Transcription creates a ___________________________ (__________) of the instructions (__________) that can be sent out of the nucleus to the ribosome to build _______________________. RNA is a ____________________________ instead of a double strand. The bases are also slightly different: C____ G_____ T_____ A______ Transcribe the following DNA strands into mRNA: GAATTACA CCAATTAG ATAGACAG CCAGTACA Draw a picture to show how GENES, CODONS, and BASES are related: What does a codon do? Replication Define the following: mRNA: tRNA: rRNA: Codon: Anticodon: Transcription Morse Code My Code A B C D E F G H I J K L M N O P Q R S T U V W X Y Z A B C D E F G H I J K L M N O P Q R S T U V W X Y Z .-... -.-. -.. . ..-. --. .... .. .---..-.. --. --.--. --..-. ... ......--..-.---.. What does this secret message say? .. .- .-.. --- ...- . -... --- ..- - .-.. . --. . Read my secret message below. -. .. .-. - .. -. .. -.-. -. ... ! --. TRANSLATION: Who is in charge of bringing the amino acids to the ribosomes? How does this work? How are amino acids and proteins related? Translating proteins: Use your codon chart to translate codons into amino acids. UAG: AAU: GCC: CGG: UAC: Transcribing and Translating: DNA: TCAAGCTACCTTCGCATGGCATGCATC RNA: Find the start codon. Now, read the mRNA one codon at a time left to right. What is your amino acid chain? Amino Acid Chain: Your Turn: DNA: TACGCCATGTGGACA RNA: Amino Acid Chain: Analogy Story: Read the 2 stories and then compare/contrast them by answering the questions below: Story of a Castle Once upon a time, there were directions to build a beautiful castle. The only problem was, these directions were locked in a library and couldn’t get out. One day, a person started to make copies of the directions. The copies left the library to be in the world outside of the library, otherwise known as the kingdom. The copies of the directions to build the castle couldn’t build the castle themselves, they needed workers to read their directions and build the castle. The workers arrived to build the castle. The workers had three jobs; they brought supplies to the castle, read the castle-building directions and put the supplies together to build different parts of the castle. The workers have assistants fetch the correct supplies in the kingdom. Then they read the instructions, and put the supplies together just like the instructions said. When the workers were finished, they had a beautiful castle before them and were happy that they had done such a good job. DNA, Transcription and Translation Story DNA is the directions to build our bodies. The only problem is, DNA is locked inside the nucleus of a cell and can’t get out. To solve this problem, copies of the DNA are made in a form called mRNA. The process of making mRNA from DNA is called transcription. After transcription, the mRNA copies leave the nucleus to be in the part of the cell outside the nucleus, otherwise known as the cytoplasm. mRNA can’t build a cell by itself; it needs workers to read the information coded on it and turn that information into proteins that will make up the cell. The workers that build a cell are called ribosomes. Ribosomes have three jobs; they bring amino acids to the mRNA, they read the mRNA code and use this code to build amino acid chains. The ribosomes have transfer molecules fetch the correct amino acids in the cytoplasm. Then they read the mRNA which contains different directions, and assemble the amino acids in the right order to create a protein. The process of turning mRNA into amino acid chains is called translation. When the workers are finished, a protein has been created. Questions: 1. The directions in Story 1 is like the ____________________ in Story 2. 2. The library in Story 1 is like the _______________________ in Story 2. 3. The copies of the original directions in Story 1 are like the __________________ in Story 2. 4. The workers in Story 1 are like the ____________________ in Story 2. 5. The castle in Story 1 is like the ______________________ in Story 2. 6. How were these stories alike? How were they different?