Download 10DNAtoProt

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Genomics wikipedia , lookup

Protein moonlighting wikipedia , lookup

Polycomb Group Proteins and Cancer wikipedia , lookup

History of genetic engineering wikipedia , lookup

DNA vaccination wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Replisome wikipedia , lookup

Frameshift mutation wikipedia , lookup

Microevolution wikipedia , lookup

Expanded genetic code wikipedia , lookup

Short interspersed nuclear elements (SINEs) wikipedia , lookup

Non-coding DNA wikipedia , lookup

RNA interference wikipedia , lookup

Epigenetics of human development wikipedia , lookup

RNA world wikipedia , lookup

Transfer RNA wikipedia , lookup

Gene wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

NEDD9 wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Polyadenylation wikipedia , lookup

Point mutation wikipedia , lookup

Genetic code wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

RNA silencing wikipedia , lookup

Nucleic acid tertiary structure wikipedia , lookup

Messenger RNA wikipedia , lookup

RNA wikipedia , lookup

Therapeutic gene modulation wikipedia , lookup

Deoxyribozyme wikipedia , lookup

RNA-Seq wikipedia , lookup

History of RNA biology wikipedia , lookup

RNA-binding protein wikipedia , lookup

Non-coding RNA wikipedia , lookup

Primary transcript wikipedia , lookup

Epitranscriptome wikipedia , lookup

Transcript
Biol 309
Question Bank
From DNA to Protein
Multiple Choice
1. During the process of translation:
A. the peptide is ‘passed’ from the tRNA in the P-site to the tRNA in the A-site.
B. incoming tRNAs must first bind to the E-site.
C. initiation begins with the binding of the ribosomal SSU to the poly-A tail of the mRNA.
D. the mRNA is translated by one ribosome at a time.
2. The presence of a poly-A tail on a RNA molecule indicates that:
A. there are exons present that must be removed.
B. this RNA molecule does not contain introns.
C. the transcript should be immediately degraded.
D. this is a rRNA molecule.
E. None of the above answers is correct
3. A ‘proteasome’ is a large structure in the cytoplasm that:
A. translates mRNA into protein
C. supercoils DNA
B. processes RNA
D. enzymatically degrades proteins
4. During the processing of introns, a single snRNP complex catalyzes both the cleavage of the RNA
and the joining of the cut ends. What would be the consequence if these two processes were catalyzed
by separate enzymes not associated in a single complex?
A. the rate of RNA processing would be much faster.
B. the cell would be unable to identify the correct cleavage sites.
C. the exons might not be joined in the correct sequence.
D. exons instead of introns would be cleaved from the RNA molecule.
5. The nucleolus of the nucleus is the site where:
A. RNA processing occurs
B. rRNA is transcribed and ribosomal subunits are assembled
C. tRNA are charged with amino acids
D. mRNA is translated into protein
6. During "RNA processing"
A. all of the exons are removed and discarded
B. the RNA molecule is made from a DNA template.
C. introns are cut from the RNA and the exons are spliced together.
D. the RNA molecule is translated into a protein molecule.
7. How does the cell ‘mark’ the positions of introns in an immature RNA?
A. There is a special snRNP for each type of intron.
B. Codons called ‘cut’ and ‘paste’ (copyrighted by Microsoft) are present within the RNA.
C. It doesn’t need to, since the boundary between an intron and exon alternates frequently.
D. Special sequences are located near the splicing sites which are recognized by ribozymes.
Biol 309
Question Bank
DNA to Protein
Page 1
8. “Alternative splicing” refers to:
A. the use of introns as exons, or vice versa, during RNA processing
B. splicing out of damaged DNA by DNA repair enzymes.
C. joining of RNA from two different genes to form a new mRNA.
D. the use of alternative reading frames when translating an mRNA.
E. a new dance for people with alternative life styles.
9. During transcription of DNA to RNA:
A. an RNA polymerase moves along the DNA in the 5’ to the 3’ direction .
B. the 3’ end of the RNA molecule is produced first.
C. an RNA polymerase must first bind to a promoter sequence.
D. transcription is always initiated at a “start codon.”
10. During the ‘elongation’ stage of translation, after the arrival of each new tRNA:
A. the amino acid is ‘passed’ from the tRNA in the A-site to the tRNA in the P-site.
B. newly arriving tRNAs must first bind to the E-site.
C. the peptide is ‘passed’ from the tRNA in the P-site to the tRNA in the A-site.
D. the new tRNA must first bind to the P-site of the ribozome.
11. During transcription of a particular gene, the RNA polymerase will transcribe:
A. both strands, but only one of RNA molecule will be used.
B. only one of the DNA strands, moving in a 3’ to 5’ direction along the template.
C. both strands, but moving 3’ to 5’ for one and 5’ to 3’ along the other.
D. only the exons of the gene while skipping over the introns.
12. Since the two strands of the DNA molecule are complementary, for any given gene:
A. The RNA polymerase can bind to either strand.
B. Only one strand actually carries the genetic code for a particular gene.
C. Each gene possesses an exact replica that can be used should a mutation occur.
D. A gene transcribed in the 5’ to 3’ direction on one strand can be transcribed in the 3’ to 5’
direction on the other strand.
13. In the genetic code there are:
A. more tRNAs than codons.
B. more codons than amino acids.
C. more nucleotides than codons.
D. the same number of codons and amino acids
14. Initiation of translation begins when the:
A. large and small subunits link together, then bind to the mRNA.
B. ribosomal small subunit holding an initiator tRNA binds to the 5’ end of the mRNA.
C. ribosome binds to the start codon and an initiator tRNA enters the ribosome.
D. initiator tRNA binds to the start codon, followed by binding of the ribosome large subunit.
Biol 309
Question Bank
DNA to Protein
Page 2
15. A “TATA box” is
A. the translation termination sequence.
B. an important base sequence in the promoters of bacteria.
C. the site where the RNA polymerase II binding complex is assembled.
D. an example of one of the translation stop codons.
16. According to the RNA-world theory:
A. RNA molecules were the first organic molecules formed on earth.
B. Life evolved on another planet called the “RNA World.”
C. All RNA molecules in cells are “ribozymes.”
D. Primitive RNA molecules evolved before protein and DNA
17. It seems probable that DNA contains thymine instead of uracil because:
A. thymine is chemically much more stable than uracil.
B. when uracil is chemically deaminated, thymine is produced.
C. thymine was one of the first four nucleotides in primitive RNA molecules.
D. if cytosine is deaminated, the altered base can be detected and removed.
True or False
1. Each of the 3 potential reading frames of an mRNA can produce a functional, but different, protein.
2. Transcription is terminated when the RNA polymerase encounters a poly-U sequence.
3. Translation ends when a ‘release factor’ protein binds to a stop codon.
4. Initiation of translation in prokaryotes involves binding of the sigma factor to a promoter.
5. Only rRNAs are polyadenylated.
6. Because genes can be coded on either strand of the DNA double helix, the coding regions of
different genes can overlap.
7. Some antibiotics have selective effects upon prokaryotic ribosomes.
8. The promoter is located downstream from the coding region of a gene.
9. RNA processing, common in eukaryotes, does not occur in prokaryotes.
10. General transcription factors are regulatory proteins that bind to eukaryotic RNA polymerases.
11. Ribozymes are primitive forms of RNA molecules that no longer exist in cells.
Biol 309
Question Bank
DNA to Protein
Page 3
Fill in, etc
1. In a ribosome, the formation of the peptide bonds of the new peptide chain occurs in the
__________________ subunit, whereas matching the codons of the mRNA are exposed on the
surface of the _______________ subunit. During the peptide elongation stage of translation,
each in-coming aminoacyl-tRNA binds to the ___-site of the ribosome, where as the growing
peptide chain is held on the tRNA in the ___-site.
2. The end of translation is signaled by a ________ codon, which binds a protein called the
_____________________.
3. In bacteria, the protein called the __________________ associated with the RNA
polymerase is principally responsible for binding to the promoter.
4. Place the following events in their correct sequence:
___ Translation
___ Transcription
Note: A sufficient understanding of transcription in
___ Polyadenylation
eukaryotes will allow a logical ordering of RNA
___ Capping
polyadenylation, capping and processing.
___ RNA processing
___ Nuclear export
5. Identify and explain 3 lines of evidence that support the RNA World theory.
6. RNA molecules possess both genotype and phenotype:
A. The genotype of an RNA molecule is held in its ________________________.
B. What are two examples of phenotype properties of an RNA molecule?
7. Show and briefly explain how complementary base pairing can lead to replication of a
strand of RNA with the following sequence: AUCGCGUUAACCGUA
8. ‘Wobble base pairing’ will occur for which one of the following pairs codons?
A. AUG and UGG
C. GGA and GGC
B. AAA and UUU
D. UAG and UGA
9. The codon for methionine is _____, the anticodon is _____, and the DNA code is ______.
Biol 309
Question Bank
DNA to Protein
Page 4
10. Based upon the results of DNA sequencing for the Human Genome Project, the number of
promoters suggests that there are around 25,000 genes in the human genome. However, the number of
different types of proteins may actually be much higher than this. Why?
11. Introns are ‘junk’ DNA that create a burden on the species. Give at least two reasons why this
statement is incorrect?
12. A research lab purified the messenger RNA for a mouse protein called ‘GFI’ and reverse
transcribed it into cDNA. They then used the cDNA as a probe to locate the gene on the
mouse chromosome, which they isolated and cloned. To their surprise the coding region of the
GFI gene was 5500 bases longer than that of the cDNA. In an attempt to mass-produce the
GFI protein, they transfected E. coli with double-stranded DNA derived from the cDNA,
hoping that it could be produced in the bacteria, but the gene was not transcribed.
A. How would you explain the difference in size between the cDNA and genomic forms of the
GFI gene?
B. How else does the cDNA differ from the original gene? (what are the different regions of a
gene?)
C. What would you do differently to achieve transcription of the GFI gene in bacteria?
13. In the diagram to the right, label the three tRNA sites,
codons and anticodons, peptide and mRNA. List the
sequence of events that will occur when the in-coming
tRNA sets into its binding site. Redraw the diagram as it
will appear immediately after the next peptide bond is
formed.
14. A particular gene codes for a mature mRNA containing 900 bases which is translated into a 40 Kd
protein. A mutant form of the gene created by a single point mutation also yields an 830-base mature
mRNA yielding a 37 Kd protein with somewhat modified enzymatic activity. Analysis shows that the
mutation has resulted in a 22 amino acid deletion within the protein. What is the most likely effect of
the mutation? Explain.
Suppose a different point mutation also yields an 830-base mRNA and a 37 Kd protein, but the protein
is nonfunctional and is quickly degraded in the cytosol. What is the most likely effect of this mutation?
Explain.
Biol 309
Question Bank
DNA to Protein
Page 5
Use this table of codons to answer
questions as needed
15. Working with an animal cell culture system, a researcher created random point mutations in the
genes for the RNA polymerases. Individual cells with RNA polymerase mutations were isolated and
used to generate a cell line that expressed that particular mutation. There was only one problem; she
did not know which RNA polymerase was affected in each of the cell lines. To help resolve this
question, she analyzed the levels of different RNAs expressed in each of the cell lines. The results she
obtained are presented below.
Cell Line
Unmutated cells
Cell line A
Cell line B
Cell line C
RNA expression (%) relative to unmutated cells
Hexose kinase
U4 snRNA
18S rRNA
Tyrosine tRNA
100
100
100
100
100
30
98
40
20
90
100
95
98
96
43
100
Which type of RNA polymerase (I, II, or II) appears to be mutated in each one of the cell lines.
Explain.
16. The following is a segment of DNA containing the beginning of a gene
3- GGCATACTTCAGTCAAGAGACATAG -5
5- CCGTATGAAGTCAGTTCTCTGTATC -3
A. If an RNA polymerase were to transcribe the gene from left to right, is the top or the bottom
strand serving as the template?
B. What will be the sequence of the mRNA produced (be sure to label the 5 and 3 ends of your
RNA molecule)?
C. What is the amino acid sequence of the peptide that would be translated from the mRNA. Label
the N- and the C-terminus amino acids.
D. Which one of the following mutations would have the greatest effect on the structure of the
protein? Explain.
a. deletion of the underlined ‘GC’ pair
b. substitution of TA pair for the underlined GC pair
Biol 309
Question Bank
DNA to Protein
Page 6
17. A researcher studied the rate of synthesis for 3 proteins with molecular weights of 53 Kd ‘A’, 45
Kd ‘B’ and 25 Kd ‘C’ in cultured cells. To do so, they incubated the cells in culture medium
containing 35S-methionine, which will become incorporated into and thereby label newly synthesized
proteins. Separate cultures were incubated with the 35S-Met for 0, 2, 4, 6, and 8 minutes. After the
incubation period, the cells were washed free of excess 35S-Met and homogenized to extract the
protein, which was then separated by gel electrophoresis. Autoradiography was performed of the
electrophoresed samples to show the amount of 35S-Met in the protein bands, and then the gel was
stained with Coomassie Blue to determine the total amount of protein in the bands. The results of the
autoradiagraphy and Coomassie Blue staining for the three proteins are shown in Figure 1. The
amount of 35S-Met in the bands as calculated from the intensity of the bands in autoradiogram is
graphed in Figure 2.
35
0
2
4
6
8 min
0
2
4
6
Figure 2
35
S-Met labeled protein in gel
8 min
Measured 35S-Met
35
Time with S-Met:
Gel stained for
total protein
Autoradiograph of S-Met
labeled protein in gel
Figure 1.
A: 53 Kd
B: 45 Kd
C
B
C: 25 Kd
X
X
X
X
A
X
Incubation Time
In a follow-up experiment, ‘pulse-chase’ labeling was performed. In this methodology, the cells are
incubated for a brief time period with 35S-Met, and then incubated in medium with unlabeled
methionine. Cultures were harvested at different times and analyzed as described above. The results
of the autoradiography are shown in Figure 3.
Figure 3.
35
S-Met labeled protein in gel
Measured 35S-Met
A. Why does the labeling of proteins B and C increase in
the first experiment?
B. Why does the labeling of the two proteins decrease in
the second experiment? Would you expect this
change to be most associated with spliceosomes,
ribosomes, lysosomes or proteasomes? Explain.
C. How would you explain that the total amount of each
protein remains the same?
D. What does the steady amount but absence of labeling
of ‘A’ indicate about this protein?
B
C
X
X
A
X
X
X
Incubation Time
Biol 309
Question Bank
DNA to Protein
Page 7
18. The diagram below shows a mRNA molecule with various regions labeled:
AAAAAAAAAAAAAA
1
PPP-GT
2
3
4
5
6
7
A. What’s wrong with this diagram? Make a change that would fix it.
A. On the corrected diagram, identify by number the region(s) that is/are:
A. coding (i.e. contains codons that are part of the peptide) ____
B. non-coding ____
E. start codon ____
C. 3’ end ___
F. stop codon ____
D. 5’ end ___
G. ribosome binding site ____
B. Is this a prokaryotic or eukaryotic mRNA? Explain.
Biol 309
Question Bank
DNA to Protein
Page 8