Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial Disorders Children’s Hospital at Montefiore Bronx, New York February 2, 2006 Faculty Disclosure Information • In the past 12 months, I have not had a significant financial interest or other relationship with the manufacturer(s) of the product(s) or provider(s) of the service(s) that will be discussed in my presentation. • This presentation will not include discussion of pharmaceuticals or devices that have not been approved by the FDA or of “off-label” uses of pharmaceuticals or devices. Congenital Hearing Loss Epidemiology 1/1000 infants affected Etiology 50% genetic 70% non-syndromic sensorineural hearing loss (SNHL) 77% autosomal recessive 52 loci known; 34 identified 22% autosomal dominant Remainder are mitochondrial or X-linked Clinical evaluation of hearing loss History Prenatal Neonatal Prematurity, hyperbilirubinemia, infections, medications Childhood Infections, medication exposure Ear infections, antibiotics, medical problems Family history Clinical evaluation of hearing loss Physical exam Dysmorphic features Ear malformations or effusions Skin (NF2) Hair and eyes (Waardenburg) Testing EKG (Jervell and Lange-Nielsen syndrome) +/- urinalysis CT scan of temporal bones Genetic testing GJB2 Encodes connexin 26 (Cx26) Gap junction protein in the cochlea Maps to 13q12 2263 nucleotides, 680 amino acids Two exons; one coding exon CpG island near Exon 1 GJB2 AR mutations account for 15 – 40% of inherited SNHL in North America Carrier rate of 1:33 in Europeans Most common mutation in Caucasians: 35delG Mutation spectrum is known to differ by ethnic group Gap Junction Channels From Rabionet et al in TRENDS in Molecular Medicine Vol.8 No.5 May 2002 Expression of Cx26, Cx30 and Cx31 in the Cochlea From Rabionet et al in TRENDS in Molecular Medicine Vol.8 No.5 May 2002 Preliminary Study Chart review of 107 patients Referred to CHAM for genetic evaluation of SNHL Data collected: Ethnicity Cx26 mutation status mtDNA DNA analysis (nt 1555, 7445, 3243, sequencing of 12s rRNA) CT scan of temporal bones Available Samples 107 Samples obtained from IRB approved research project looking for mtDNA point mutations in SNHL 192 Controls provided by Dr. Robert Burk from HPV study mtDNA and CT Results one Puerto Rican patient: A503G variant + mtDNA mutation at nt 1465 no patient had A1555G or T7445C associated with SNHL 31 patients had CT scan results: 2 had EVA, one of which carries G79A 1 had ? Mondini’s, 1 had prominence of cochlear aqueducts, 1 had diffuse atrophy Project design 1. Designing primers for PCR 1. 2. 2. 3. 4. 5. Overcoming the GC content Primers for Exons 1&2, and CpG island Sequencing PCR products Identifying sequence variants with Sequencher Examine for known SNPs Screening controls with Pyrosequencing CpG Island Primers CGCCAGGTTCCTGGCCGGGCAGTCCGGGGCCGGCGG GCTCACCTGCGTCGGGAGGAAGCGCGGCGGGGCCGG GGCGGGGGTCTCGGCGTTGGGGTCTCTGCGCTGGGG CTCCTGCGCTCCTAGGCGGGTCCTGGGCCGGGCGCC GCCGAGGGGCTCCGAGTCGGGGAGAGGAGCGCGCGG GCGCTGCGGGGCCGCAACACCTGTCTCCCGCCGTGG CGCCTTTTAACCGCACCCCACACCCCGCCTCTTCCC TCGGAGACTGGGAAAGTTACGGAGGGGGCGGCGCCG CGGGCGGAGCGCGCCCGGCCTCTGGGTCCTCAGAGC TTCCCGGGTCCGCGAACCCCCGACCGCCCCCGAAAG CCCCGAACCCCCCAAGTCCCCTTCGAGGTCCCGATC TCCTAGTTCCTTTGAGCC Exon 1 Primers CCCAAGGACGTGTGTTGGTCCAGCCCCCCGGTTCCC CGAGACCCACGCGGCCGGGCAACCGCTCTGGGTCTC GCGGTCCCTCCCCGCGCCAGGTTCCTGGCCGGGCAG TCCGGGGCCGGCGGGCTCACCTGCGTCGGGAGGAAG CGCGGCGGGGCCGGGGCGGGGGTCTCGGCGTTGGGG TCTCTGCGCTGGGGCTCCTGCGCTCCTAGGCGGGTC CTGGGCCGGGCGCCGCCGAGGGGCTCCGAGTCGGGG AGAGGAGCGCGCGGGCGCTGCGGGGCCGCAACACCT GTCTCCCGCCGTGGCGCCTTTTAACCGCACCCCACA CCCCGCCTCTTCCCTCGGAGACTGGGAAAGTTACGG A TTATTATAGAGATTATATTTTAATGTTTTAAATGTATTTGATACATTACAAAATTATTTTAGTTACA AGCATATCATTAAAGCTATTCTTTATTATTACAAAATGCTTTTACAATGCTATTCTTGACAACAGG AAAATACTTACCCTCACTGAAATATGTGGAGTACCATTTTTTGGAAACCATGTCAAGCATAATGGC AATATTCAGGTTCAATCTTCCTATAGATCTGCTCAATATTTATCTAAACCTTAGCTTCTATTCTTTT CACATGTTATTAGCTATATTTTCACTTAAAAAATTGGAGGCTGAAGGGGTAAGCAAACAAACTTT TGAAGTAGACAAAGCTCATCTTTAATCAACAGACTTTAGAGTCCAGTCTTTCCAAATCTGTTTTTA ACGACAGAAACTTCTCCCTCCCCTGCCCCATTTTGTCCTCCCCATTAAATGGTACTGTGTCAATAAA ATTCCCAAGCGACCTCTTTAAATCAGCGTTCTTTCCGATGCTGGCTACCACAGTCATGGAAAAGG AGATGTGTTGGACAGGCCTGTCATTACAGGTAGTAGTTGGTGGTACATCCAGTCTGTATTTCTTA CACAAAATTACATCTAAATATTTGACATGAGGCCATTTGCTATCATAAGCCATCACTAGGAACTTC TAGTCTGTCTCACTCGATTGAGGCTACAATGTTGTTAGGTGCTATGACCACAATGAATACAACAG ACAGCCTCTCAGCTGTGCTGCAAAGTATTCATAACCAAAAGACCATATTTCAAATTAAATCATAGT AGCGAATGACATACCATTTACATATTACAATCTGAGCCTCTGAAACAGGGGGAACATATAATGGT ATCCAGAACATCTTTACATCAAAATAACCTATCATACTACAAAGTTTTCACTTCCAAAAAGTGTAAC AGAGTTTAAGGCACTGGTAACTTTGTCCACTGTTAGAGATTAAAACTTCCAAAGCAAATGAAAGA ACCAATGTTCACCTTTAACGTGGGGAAAGTTGGCAAAAAGAACCCCAGGAGGACACCCAAACCTT CTCTGTGTCCTCTGTGGAACCTGGCTTTTTTCTCTTGTCCTCAGAGAAAGAAACAAATGCCGATAT CCTCTGTTTAAAATATGAAAGTACCTTACACCAATAACCCCTAACAGCCTGGGGTCTCAGTGGAAC TAACTTAAGTGAAAGAAAATTAAGACAGGCATAGAATTAGGCCTTTGTTTTGAGGCTTTAGGGG AGCAGAGCTCCATTGTGGCATCTGGAGTTTCACCTGAGGC ____________________________________________________CTACAGGGGTTTCAAATGGTTGCA TTTAAGGTCAGAATCTTTGTGTTGGGAAATGCTAGCGACTGAGCCTTGACAGCTGAGCACGGGTT GCCTCATCCCTCTCATGCTGTCTATTTCTTAATCTAACAACTGGGCAATGCGTTAAACTGGCTTTT Exon 2 Coding Region Primers TTGACTTCCCAGAACAATATCTAATTAGCAAATAACACAATTCAGTGACATTCAGCAGGATGCAA ATTCCAGACACTGCAATCATGAACACTGTGAAGACAGTCTTCTCCGTGGGCCGGGACACAAAGC AGTCCACAGTGTTGGGACAAGGCCAGGCGTTGCACTTCACCAGCCGCTGCATGGAGAAGCCGTC GTACATGACATAGAAGACGTACATGAAGGCGGCTTCGAAGATGACCCGGAAGAAGATGCTGCTT GTGTAGGTCCACCACAGGGAGCCTTCGATGCGGACCTTCTGGGTTTTGATCTCCTCGATGTCCT TAAATTCACTCTTTATCTCCCCCTTGATGAACTTCCTCTTCTTCTCATGTCTCCGGTAGGCCACG TGCATGGCCACTAGGAGCGCTGGCGTGGACACGAAGATCAGCTGCAGGGCCCATAGCCGGATGT GGGAGATGGGGAAGTAGTGATCGTAGCACACGTTCTTGCAGCCTGGCTGCAGGGTGTTGCAGA CAAAGTCGGCCTGCTCATCTCCCCACACCTCCTTTGCAGCCACAACGAGGATCATAATGCGAAA AATGAAGAGGACGGTGAGCCAGATCTTTCCAATGCTGGTGGAGTGTTTGTTCACACCCCCCAGG ATCGTCTGCAGCGTGCCCCAATCCATCTTCTACTCTGGGCGGTTTGCTCTGGAAAAGACGAATGC ACACAACACAGGAATCACTAGCTAGGACAGAACAGGGAGACTTCTCTGAGTCTGGGTAAGC 35delG 167delT 35delG and 167delT compound heterozygote of mixed Jewish, Italian and Irish decent. Deletion alters chromatogram alignment, which is corrected with the deletion on the opposite chromosome. Both 35delG and 167delT lead to frameshift mutations. C-34T variant C-34T variant G79A polymorphism Patient with a C-34T variant and a G79A polymorphism. Is there significance to these changes when they co-occur? Start Codon G139T homozygous Patient from consanguineous Dominican family with a G139T homozygous mutation, leading to substitution of Valine for Glutamine at amino acid 47, initiating a premature STOP. 35delG common mutation in Caucasian population, found in two Puerto Rican patients and one of mixed Italian, Irish and Jewish decent. 35delG 35delG leads to a frameshift mutation, as seen on this chromatogram. GJB2 Mutations by Ethnicity for 107 Patients 30 25 Number of Patients 20 * 15 10 T101C (M34T)(AD vs. Polym) 35delG (AR) 167delT (AR) G139T (E47V)(AR) C-15T (Polym) G79A (V27I)(Polym) G380A (R127H)(Polym) A670C (K224Q)(Indeter) A503G (K168R)(novel) C684A (novel) Negative 5 0 Black Black/PR PR= Puerto Rico DR=Dominican Republic PR DR/PR DR Mexico Ethnicity Guyana India Pakistan Other * Compound Heterozygote: 35delG + 167delT K168R Extracellular Domain Schematic of Connexin 26 domains with mutations and polymorphisms included Mutations, polymorphisms and variants exhibited in our study are Transmembrane circled Domain Mutations are shown in Green V27I Polymorphisms are shown in Purple R127H Variants of unknown significance are shown in Orange K224Q Intracellular Domain http://ent.md.shinshuu.ac.jp/deafgene%25/nonsyndromic/ohtsuka.gif Also seen in our study were 9 patients with C-34T, in the 5’UTR, not previously described We noted sequence variations at nucleotide 765, with 65/35 C/T 12 10 8 6 4 2 Nucleotide Change HE= Heterozygote 35 de lG H E H E A5 0 3G H E T4 25 2T C 68 G C H E H E 1A 51 9A 10 G 79 A H E H E 0 G Number of Patients Control Data for 93 Hispanic Patients Number of Patients Control Data for 94 Black Patients 2.5 2 1.5 1 0.5 0 G A 79 HE G A 79 HO G A 1 34 HO C 1 0 T1 HE G 8A 7 4 Nucleotide Change HE = Heterozygote HO= Homozygote HE G 9A 9 4 HE Results • one Dominican patient was homozygous for a mutation in GJB2 (G139T) • GJB2 mutations occur in 1/33 European controls (35delG in 2-4%) • only one Hispanic 35delG carrier in our controls; all other nucleotide changes were polymorphisms or novel variants Conclusions • GJB2 mutations occur less frequently in our minority population • lower carrier frequencies may account for the lower rate of homozygous individuals in our population • possible synergistic interaction of heterozygous GJB2 mutations and a mutation in another gene such as GJB6 Future studies Patient recruitment JMC NICU and nursery JMC audiology clinic CHAM Craniofacial Center Controls Hope for: 50 cases/year + 300 controls/year Future Directions Cx30 Adjacent to GJB2 Mutations are rare May lead to AD late onset deafness Deletions Homozygous → deafness Heterozygous in trans with GJB2 mutation → deafness Future Directions SLC26A4 Encodes monovalent and divalent anion transporter related proteins (Pendrin) Involved in fluid homeostasis Mutations cause Pendred syndrome (AR; defects of thyroid, kidney and inner ear) Often also see Enlarged Vestibular Aqueduct (EVA) or Mondini dysplasia Reference List For more information on this topic, see the following publications: Marazita ML, et al., (1993) Genetic epidemiologic studies of early-onset deafness in the U.S. school-age population. Am J Med Genet 46:486-491). Kelsell DP, et al., (1997) Connexin 26 mutations in hereditary non-syndromal sensoineural deafness. Nature 387(6628):80-83. Morton, C (2002) Genetics, genomics and gene discovery in the auditory system. Human Molecular Genetics 11(10):1229-1240. Rabionet R, et al., (2002) Connexin mutations in hearing loss, dermatological and neurological disorders. Trends in Mol Med 8(5):205-212). Pandya, A, et al., (2003) Frequency and distribution of GJB2 (connexin 26) and GJB6 (connexin 30) mutations in a large North American repository of deaf probands. Genet Med 5(4):295-303. Additional information may be found at: http://davinci.crg.es/deafness/