* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Chapter 12
DNA sequencing wikipedia , lookup
Transposable element wikipedia , lookup
Minimal genome wikipedia , lookup
Whole genome sequencing wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Genome (book) wikipedia , lookup
Metagenomics wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
DNA profiling wikipedia , lookup
SNP genotyping wikipedia , lookup
DNA polymerase wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Primary transcript wikipedia , lookup
Point mutation wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Designer baby wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
DNA vaccination wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Microevolution wikipedia , lookup
Genetic engineering wikipedia , lookup
Human genome wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Microsatellite wikipedia , lookup
Genome evolution wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Molecular cloning wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Epigenomics wikipedia , lookup
DNA supercoil wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Genomic library wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Non-coding DNA wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Genome editing wikipedia , lookup
Chapter 12 - DNA Technology and the Human Genome Genetically modify organisms and transgenic organisms Genetically modified organisms (GMO’s): -Organisms whose genes have been altered using genetic engineering techniques. Transgenic organisms - Most GMO’s are transgenic organisms… they have received genes from a different organism. Ex. A mouse is given a gene from a human. The mouse is a transgenic GMO. Chapter 12 - DNA Technology and the Human Genome Genetically modify organisms (GMO’s) and transgenic organisms GMO’s at home: Zebra danio GloFish 1. Zebra danio was genetically engineered with a gene from sea coral that causes the fish to glow in the presence of environmental toxins. 2. Gene was inserted into the embryo of the fish. 3. First GMO available as a pet. Chapter 12 - DNA Technology and the Human Genome Genetically modify organisms (GMO’s) and transgenic organisms GMO’s in research: GFP (green fluorescent prote GFP Mice 1. Gene from a jellyfish (Aequorea victoria) that codes for GFP was inserted into the embryos of mice. Aequorea victoria (jellyfish, phylum cnidaria) Chapter 12 - DNA Technology and the Human Genome Genetically modify organisms (GMO’s) and transgenic organisms GMO’s in research: GFP (green fluorescent protein) 1. GFP is used in cellular and molecular biology. 2. You can attach this protein to any other protein you want making it a reporter protein. - It “reports” to you where the protein is going (similar to radioactivity in that sense) Chapter 12 - DNA Technology and the Human Genome Genetically modify organisms (GMO’s) and transgenic organisms GMO’s in research: Ex. - GFP has been attached to a protein called MFD, which is found in peroxisomes. - Those little green dots are peroxisomes… - You can track any protein you want…in a single cell or an entire Chapter 12 - DNA Technology and the Human Genome Genetically modify organisms and transgenic organisms GMO food: Bt Corn European Corn Borer Larv 1. Corn plants containing Cry genes from a bacterium – Bacillus thurengensis. 2. The genes code for enzymes that produce a toxin (insecticide), Bt toxin, which will kill European corn borer larvae – most damaging insect to corn in US and canada. Chapter 12 - DNA Technology and the Human Genome Genetically modify organisms (GMO’s) and transgenic organisms GMO food: Ordinary rice“Golden” rice - “Golden” rice is genetically engineered with genes that code for enzymes that make beta-carotene, a precursor to Vitamin A for countries deficient in foods with Vit. A… - This rice has never been used because of environmental Chapter 12 - DNA Technology and the Human Genome Genetically modify organisms and transgenic organisms GMO medicine: AAT Sheep Genetically engineered sheep with the human gene for alpha-1antitrypsin (AAT). AAT is extracted from their milk and used to treat humans deficient in AAT, which is one cause of emphysema (a breathing disorder) in approximately 100,000 people in the western world. Chapter 12 - DNA Technology and the Human Genome Genetically modify organisms and transgenic organisms GMO medicine: E. Coli with the human insulin gen - Insulin is made using the bacterium E. coli. - The human gene coding for insulin is inserted into E. coli, which will then make insulin for us (we will see how this is done shortly)… Chapter 12 - DNA Technology and the Human Genome Genetically modify organisms and transgenic organisms Conclusion - We can basically move any gene(s) between members of a species or between any species. - We can also alter the genes to our liking (GFP tagged proteins) before inserting them into embryos. Is all of this genetic engineering positive, negative? Chapter 12 - DNA Technology and the Human Genome Genetically modify organisms and transgenic organisms Let’s look at some of the ways we genetically engineer organisms starting with how we can take a human insulin gene and put it into E. coli… Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? First we must understand bacteria and how they take up DNA… (it is more than mutation that give them their genetic diversity) Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? There are three methods by which bacteria take up DNA in n 1. Transformation Bacteria can take up a free piece of bacterial DNA Fig. 12.1A-C Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? There are three methods by which bacteria take up DNA in n 2. Transduction Bacteriophage is mistakenly packaged with bacterial DNA. Injects this DNA into another bacteria. Fig. 12.1A-C Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? There are three methods by which bacteria take up DNA in n 3. Conjugation “Male” (F+) bacteria extend sex pili (long tube) to “female” (F-) bacteria. Part of chromosome is replicated and transferred. Fig. 12.1A-C Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? Once the DNA is transferred, integration must occur: Fig. 12.1D Crossing over occurs (where do you think we got it from?) and the new DNA is integrated in place of the original DNA, which is degraded. Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? 1. Transformation 2. Transduction 3. Conjugation Where have we observed transformation before in this class? The Griffith experiment when he mixed the R strain with the heat-killed S strain… Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? 1. Transformation 2. Transduction 3. Conjugation We will focus mostly on transformation when we look at genetic Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? Transformation in the lab: Heat Shock Method 1. Take bacteria in a tube (in solution) 2. Add the DNA you want it to take up into the tube. 3. Let the tube chill on ice for a few 1. Transformation minutes 4. Then quickly heat the tube to 42°C (107°F) for 90 seconds. - This will open up “holes” in the bacterial membrane for the DNA to slip in. 5. Cool on ice for 10 minutes…done The bacterium now has the DNA…simple. Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? Bacteria can have more than just a single circular chromosome… (They may have little circular extra-chromosomal DNA called Plasmids) extra-chromosomal = outside of the chromosome like extraterrestrial means coming from outside Earth (E. T.) Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? The majority of the DNA above is chromosomal, but you can see the small circular pieces not part of the chromosome…plasmids. Fig. 12.2C Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? Plasmid - Small, circular piece of DNA distinct from bacterial chromosome - has own origin of replication (ori) - carries genes/insert genes at the polylinker region - called vectors when used in genetic engineering… Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? Recall how a bacterium defends itself when a bacteriophage injects its DNA into a bacterium… The bacterium has enzymes called restriction enzymes that attempt to cut up the bacteriophage DNA before it can take over the cell. Different species have different restriction enzymes… Aside: Why do these enzymes not cut the bacterial chromosome? The bacterial chromosome is methylated (modified by adding – CH3 groups so the enzymes can’t bind to it) Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? Restriction enzymes 1. molecular DNA scissors (enzymes that cut DNA) 2. Different restriction enzymes cut different sequences. 3. Scientists have isolated hundreds of different restriction enzymes from many different bacteria – EcoRI, BamHI, NcoI, etc… Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? Restriction enzymes Ex. EcoRI Notice anything interesting about this sequence? - It is palindromic, read the same way forward and backward. - Majority of restriction sites are palindromic… Fig. 12.4 Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? Restriction enzymes Ex. EcoRI EcoRI Notice that is doesn’t cut straight through like paper scissors. The enzyme cuts each strand after the G nucleotide generating single-strand regions called sticky Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? Restriction enzymes Ex. EcoRI EcoRI Why do you think we call them sticky ends? Because they can base pair to a complementary strand…they are “sticky”. If it cut straight through then it could no base pair. Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? Restriction enzymes More examples of restriction enzymes Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? Subcloning Now that we understand transformation, plasmids and restriction enzymes, we are ready to take the next step and learn how to take a gene from an organism of choice (ex. Human insulin) and put it into a bacterium so that the bacterium can make the polypeptide (insulin) for us. This process is called subcloning. Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? Subcloning Ex. EcoRI plasmid (vector) Now imagine this restriction site was in a plasmid (vector). Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? Subcloning Ex. EcoRI BamHI What happens if you treat it with the restriction enzyme BamHI? Nothing, BamHI does not cut that sequence. Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? Subcloning Ex. EcoRI EcoRI What happens if you treat it with the restriction enzyme EcoRI? Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? Subcloning Ex. EcoRI EcoRI EcoRI cuts the vector leaving two sticky ends… Now what? We need to insert our gene of choice into the plasmid. Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? Subcloning 1. You can isolate the DNA from the organism of interest, which has the gene you want to put into the vector. Fig. 12.3 Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? Subcloning Zoom in …CGATTAGAATCCCGCC Insulin gene …GCTAATCTTAGGGCGG CGGATTGAATCCCGAA… GCCTAACTTAGGGCTT… What do we need to do? Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? Subcloning Zoom in …CGATTAGAATTCCGCC Insulin gene …GCTAATCTTAAGGCGG CGGATTGAATTCCGAA… GCCTAACTTAAGGCTT… 2. Cut the gene out with the same restriction enzyme that you cut the plasmid/vector with. Fig. 12.3 Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? Subcloning Zoom in …CGATTAG AATTCCGAA… …GCTAATCTTAA What now? AATTCCGCCInsulin gene GGCGG CGGATTG GCCTAACTTAA Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? Subcloning + AATTCCGCC Insulin gene GGCGG CGG GCC 3. Mix the cut vector with the cut gene…what should happen? Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? Subcloning The sticky ends should base pair (the two pieces anneal). However, you still have gaps between the nucleotides in each strand…what should we do? Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? Subcloning DNA ligase Use DNA ligase to ligate the strands together Every enzyme/protein we discover is a new tool for scientists to use in the lab to manipulate DNA. DNA ligase was discovered when investigating DNA replication, but now we use it as a “glue” when subcloning genes into vectors. Now what should we do with this vector containing our gene or inte Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? Subcloning Put it into bacteria like E. coli by transformation using the heatshock method. Since the vector has an origin of replication, it will be replicated by DNA polymerase inside the bacterium when the chromosome is replicated during binary fission. Now our gene is inside the bacteria. How does this help us? Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? Subcloning 1. We can take the bacteria after many round of binary fission and isolate the plasmid/vector, and take back the gene. In essence, the bacteria replicated it for us… 2. Or we can have the bacterium make the protein for us and then we can take the protein and use it. Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? Review Slide Fig. 12.3 Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? Review Slide What is the problem with this if we were subcloning a eukaryotic gene? INTRONS!! If you take a eukaryotic gene and insert it straight into a vector, the introns are still there and bacteria cannot splice out How do weintrons. fix this? Fig. 12.5 Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? Let the eukaryotic cell take out the introns for you… Instead of taking the gene from the eukaryotic cell, take the processed mRNA. But this leads to another problem, we can’t put RNA into a DNA plasmid… Fig. 12.7 Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? Make cDNA (complementary DNA) from the mRNA: 1. Isolate mRNA from gene of interest 2. use reverse transcriptase to make a dsDNA copy 3. cut with restriction enzyme and ligate into a vector Advantages to cDNA 1. No introns 2. No junk DNA Fig. 12.7 Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? Summary 1. Isolate plasmid 2. Isolate gene of interest (straight from genome if bacterial or via mRNA if eukaryotic) 3. Cut both with same restriction enzyme 4. Mix together to allow sticky ends to ANNEAL forming recombinant DNA 5. Ligate using DNA ligase 6. Transform bacteria with vector (plasmid) 7. Bacteria will express (make) the protein and divide making more copies of the gene (gene Chapter 12 - DNA Technology and the Human Genome How can we use bacteria to manipulate DNA and protein? Conclusion We can make any protein we want or more of any gene (gene cloning) by putting it into a plasmid and transforming a bacterium. Chapter 12 - DNA Technology and the Human Genome AIM: What are some other tools of DNA technology? There is another, more efficient way of making more of any gene or DNA segment we want…using a method called: PCR (Polymerase Chain Reaction) Technique used to amplify (make more of) a specific piece of DNA. Can be a gene or any other segment. It is essentially DNA replication in a test tube… http://www.maxanim.com/genetics/PCR/PCR.htm Chapter 12 - DNA Technology and the Human Genome AIM: What are some other tools of DNA technology? http://www.youtube.com/watch?v=x5yPkxCLads Chapter 12 - DNA Technology and the Human Genome AIM: What are some other tools of DNA technology? A crime has been committed and you have a suspect as well as a tiny bit of DNA sample from the scene of the crime. What do you do? The first thing you do is PCR the DNA to make more copies of it… Chapter 12 - DNA Technology and the Human Genome AIM: What are some other tools of DNA technology? Fig. 12.11A **Everyone’s DNA (genes) have a slightly different sequence, so we all have different restriction sites. The allele of this person has two restriction sites. How many restriction fragments (DNA pieces) would there be after three cutting with the restriction enzyme? Amplified section of the DNA from the crime scene Chapter 12 - DNA Technology and the Human Genome AIM: What are some other tools of DNA technology? You have a suspect. What should you do? Use PCR to amplify the same segment of the subjects DNA and cut it with the same restriction enzyme. Chapter 12 - DNA Technology and the Human Genome AIM: What are some other tools of DNA technology? Fig. 12.11A How many restriction fragments will two the suspects DNA yield? The suspect has a different allele with a mutation in the first restriction site. The restriction enzyme will not cut this sequence. Conclusion: The suspect did not commit the crime. Amplified section of the Amplified section of the DNA from the crime scene same DNA segment from the Chapter 12 - DNA Technology and the Human Genome AIM: What are some other tools of DNA technology? Fig. 12.11A This is great, but you can’t see DNA like this… How can we OBSERVE the DNA and count the number of fragments? Amplified section of the Amplified section of the DNA from the crime scene same DNA segment from the Chapter 12 - DNA Technology and the Human Genome AIM: What are some other tools of DNA technology? Gel Electrophoresis This technique allows one to not only indirectly view the DNA, but also to separate and view the DNA fragments. Fig. 12.10 Chapter 12 - DNA Technology and the Human Genome AIM: What are some other tools of DNA technology? Gel Electrophoresis Gel (like jell-o) The gel is made of either agarose or polyacrylamide. It has tiny, microscopic pores that DNA can fit through. Fig. 12.10 Chapter 12 - DNA Technology and the Human Genome AIM: What are some other tools of DNA technology? Gel Electrophoresis Gel (like jell-o) The DNA sample is loaded in the wells at the top of the gel. One sample per well. Fig. 12.10 Chapter 12 - DNA Technology and the Human Genome AIM: What are some other tools of DNA technology? Gel Electrophoresis Electricity (electrons flow from top of gel by the samples to the bottom of the gel) Electricity is then run through the gel. Why do you think the negative end is on the sample side and the positive end is on the other end gel?because the phosphates are negative. The DNAofis the negative Fig. 12.10 negative electrons moving down push the DNA down with them. Chapter 12 - DNA Technology and the Human Genome AIM: What are some other tools of DNA technology? Gel Electrophoresis Which will move faster through the micro-porous gel, the longer DNA fragments or the shorter DNA fragments? The small fragments (fewer nucleotides) will move more easily through the gel and hence go faster than the large ones. Chapter 12 - DNA Technology and the Human Genome AIM: What are some other tools of DNA technology? Gel Electrophoresis The gel is soaked with a a compound called ethidium bromide, which sticks to DNA and lights up when you hit the gel with UV light… Fig. 12.10 Chapter 12 - DNA Technology and the Human Genome AIM: What are some other tools of DNA technology? Gel Electrophoresis You are not observing the DNA move. You are seeing a blue dye added to the sample move through the gel. You cannot see the DNA until you put the gel under a UV lamp. http://www.youtube.com/watch?v=Wwgs-FjvWlw&feature=related Chapter 12 - DNA Technology and the Human Genome AIM: What are some other tools of DNA technology? Gel Electrophoresis AIM: What are some of the other tools of DNA technology? Virtual Lab (http://www.vivo.colostate.edu/hbooks/genetics/biotech/gels/virgel.html) Chapter 12 - DNA Technology and the Human Genome AIM: What are some other tools of DNA technology? Draw what the gel would look like for the restriction digest of the criminal and the suspect. Amplified section of the Amplified section of the DNA from the crime scene same DNA segment from the Chapter 12 - DNA Technology and the Human Genome AIM: What are some other tools of DNA technology? Criminal’s DNA fingerprint criminal suspect Suspect’s DNA fingerprint Fig. 12.11A Chapter 12 - DNA Technology and the Human Genome AIM: What are some other tools of DNA technology? Can also be used to detect disease or determine paternity. Chapter 12 - DNA Technology and the Human Genome AIM: What are some other tools of DNA technology? Review: 1. Use PCR to get more of the desired 2. Digest DNA with restriction enzymes DNA 3. Run restriction fragments on a gel (gel electrophoresis) 4. Compare fragments Chapter 12 - DNA Technology and the Human Genome AIM: What are some other tools of DNA technology? Question: You have been given two DNA samples that have gone through PCR. Both samples are of the same DNA segment with a size of 1kb (1 kilobase = 1000bp). Sample 1 has four restriction sites at 100bp, 300bp, 350bp, and 700bp. The second piece has the same sites in addition to a fifth site at 725bp. Draw how the gel should look for these two pieces. Chapter 12 - DNA Technology and the Human Genome AIM: What are some other tools of DNA technology? 100bp 300bp350bp 700bp Sample 1 Segments of DNA: Five segments in total 50bp, 100bp, 200bp, 300bp, 350bp 100bp 300bp350bp 700bp Sample 2 725bp Six segments in total 25bp, 50bp, 100bp, 200bp, 275bp, 350bp Chapter 12 - DNA Technology and the Human Genome AIM: What are some other tools of DNA technology? - Sample 1 350bp Sample 2 350bp 300bp e 275bp 200bp 200bp 100bp 100bp 50bp 50bp 25bp + Do not forget to label the charges on the gel and show the flow of electrons (the current). Chapter 12 - DNA Technology and the Human Genome AIM: What are some other tools of DNA technology? Gel electrophoresis can be done using proteins as well. In this case the gel is made of polyacrylamide and the proteins are coated with negatively charged molecules since they are not always negative like DNA. It is a little more complicated, but not much… Chapter 12 - DNA Technology and the Human Genome NEW AIM: Understanding the human genome. Humans - 3 billion nucleotides in a haploid set of chromosomes (775 of your textbooks) 1000X more DNA than E. coli E. coli H. sapiens ~2000 genes ~35000 genes Protein coding genes tRNA coding genes rRNA coding genes 97% of our genome is non-coding (typical of eukaryotes) -gene control seqeunces (promoters, enhancers, etc…) -mostly “junk DNA” (unknown function) -includes introns (which can be 10X the length of the neighboring exon and DNA between genes Chapter 12 - DNA Technology and the Human Genome NEW AIM: Understanding the human genome. DNA between genes -much is repetitive DNA (2 types) 1. Short repeats (few nucleotides repeated over and over) - Ex) …CATGCATGCATGCATGCATGCATG… - Found at centromeres and telomeres (ends of chromosomes) Chapter 12 - DNA Technology and the Human Genome NEW AIM: Understanding the human genome. 2. Long repeats - Repeats are hundreds of nucleotide pairs long - Blocks of repeats are scattered around the genome - Function unknown - Associated with “jumping genes” known as Transposons Chapter 12 - DNA Technology and the Human Genome AIM: Understanding the human genome. Chapter 12 - DNA Technology and the Human Genome AIM: Understanding the human genome. Fig. 12.13B Chapter 12 - DNA Technology and the Human Genome AIM: Understanding the human genome. Fig. 12.14 Chapter 12 - DNA Technology and the Human Genome NEW AIM: Making transgenic organisms. “Pharm” animals Fig. 12.16 Chapter 12 - DNA Technology and the Human Genome AIM: Making transgenic organisms. Fig. 12.18AB Chapter 12 - DNA Technology and the Human Genome AIM: Making transgenic organisms. Chapter 12 - DNA Technology and the Human Genome AIM: Making transgenic organisms. Gene Therapy - Replacing a defective gene with a normal gene. Fig. 12.19 Fig. 12.20AB Fig. 12.21ABC AIM: How can bacteria be used as tools to manipulate DNA? Fig. 12.2AB Chapter 12 - DNA Technology and the Human Genome AIM: What are some other tools of DNA technology? 1. We need more of the DNA Fig. 12.12 Chapter 12 - DNA Technology and the Human Genome AIM: What are some other tools of DNA technology? PCR - Polymerase Chain Reaction -DNA polymerase -nucleotides (A,T,C,G) -Primers -PCR machine (Heat Cycler) Fig. 12.12 AIM: What are some of the other tools of DNA technology? Fig. 12.12 AIM: What are some of the other tools of DNA technology? Fig. 12.12 AIM: What are some of the other tools of DNA technology? Fig. 12.12