* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download video slide
DNA sequencing wikipedia , lookup
List of types of proteins wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Maurice Wilkins wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Genome evolution wikipedia , lookup
Agarose gel electrophoresis wikipedia , lookup
Silencer (genetics) wikipedia , lookup
SNP genotyping wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Restriction enzyme wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
DNA vaccination wikipedia , lookup
Molecular evolution wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
DNA supercoil wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Non-coding DNA wikipedia , lookup
Molecular cloning wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Deoxyribozyme wikipedia , lookup
DNA Technology and Genomics Understanding and Manipulating Genomes • DNA technology has launched a revolution in the area of biotechnology - The manipulation of organisms or their genetic components to make useful products • One of the greatest achievements of modern science has been the sequencing of the human genome, which was largely completed by 2003 • DNA sequencing accomplishments have all depended on advances in DNA technology, starting with the invention of methods for making recombinant DNA Recombinant DNA • Formed by joining DNA from 2 different individuals into a single molecule. • Various natural mechanisms can combine DNA from 2 individuals of the same species • Scientists have also developed techniques to combine DNA from any 2 individuals. Recombinant DNA • Two key enzymes are used to make artificially recombined DNA. • • Restriction enzymes (also called restriction endonucleases) cut DNA into fragments – so called “molecular scissors” Each one recognizes and cuts DNA only where a specific sequence of base pairs occurs. Many do not cut straight through both strands, but make a jagged cut leaving unpaired bases at both ends. Because these unpaired bases can pair with complimentary bases, they are called “sticky ends”. DNA ligase is used to join DNA fragments together. This is the “molecular glue” Restriction Enzymes and Recombinant DNA • Bacterial restriction enzymes cut DNA molecules at a limited number of specific DNA sequences, called restriction sites • A restriction enzyme will usually make many cuts in a DNA molecule yielding a set of restriction fragments • The most useful restriction enzymes cut DNA in a staggered way producing fragments with “sticky ends” that can bond with complementary “sticky ends” of other fragments • DNA ligase is an enzyme that seals the bonds between restriction fragments Procedure for Recombining DNA Restriction site • Isolate DNA from 2 different sources DNA 5 3 • Cut the DNA from both sources into fragments using the same restriction enzyme. 1 Restriction enzyme cuts 3 5 GAATTC CTTAAG the sugar-phosphate backbones at each arrow G • • G Mix the DNA fragments together. Since they were cut with the same restriction enzyme, fragments from different sources will have the same “sticky ends” and can pair up. Use the enzyme DNA ligase to join the paired fragments together Sticky end 2 DNA fragment from another source is added. Base pairing of sticky ends produces various combinations. G AATT C C TTAA G G G Fragment from different DNA molecule cut by the same restriction enzyme G AATTC CTTAA G One possible combination 3 DNA ligase seals the strands. Recombinant DNA molecule Recombinant Plasmids • Recombinant DNA technology can be used to create recombinant plasmids (or other agents such as viruses) used to insert foreign genes into recipient cells. • Plasmids (or other recombinant agents) used to insert foreign DNA into recipient cells are called vectors • Recombinant plasmids can then be used to produce multiple copies of the DNA fragment Copying DNA Fragments • Why produce multiple copies of a DNA fragment? • Study its structure and function • Compare the fragment with DNA from other sources • If it codes for a useful protein, to produce large quantities of the protein Two Basic Copy Methods • Cloning – insert the gene into a living host cell and use the cell to replicate the gene along with its own DNA whenever it divides • Polymerase Chain Reaction (PCR) – create the conditions needed for replication inside a test tube that contains a copy of the gene DNA Cloning • DNA cloning permits production of multiple copies of a specific gene or other DNA segment Bacterium Bacterial chromosome • Most methods for cloning pieces of DNA in the laboratory involve • • • Use of bacteria and their plasmids Restriction Enzymes In gene cloning, the original plasmid is called a cloning vector a DNA molecule that can carry foreign DNA into a cell and replicate there Cell containing gene 1 Gene inserted of interest into plasmid Plasmid Recombinant DNA (plasmid) Gene of interest 2 Plasmid put into bacterial cell Recombinate bacterium 3 Host cell grown in culture, to form a clone of cells containing the “cloned” gene of interest Gene of interest Protein expressed by gene of interest Copies of gene Basic research on gene Gene for pest resistance inserted into plants DNA of chromosome Protein harvested 4 Basic research and various applications Gene used to alter bacteria for cleaning up toxic waste Protein dissolves blood clots in heart attack therapy Basic research on protein Human growth hormone treats stunted growth Gene Cloning Stage 1: DNA from two sources is isolated and cleaved with the same restriction endonuclease. Animal cell Restriction endonuclease cut sites E. coli Restriction Gene of site interest ampR gene DNA Stage 2: The two types of DNA can pair at their sticky ends when mixed together; DNA ligase joins the segments. Sticky ends Plasmid lacZ' gene Reclosed plasmid with functional lacZ' gene Recombinant plasmids with nonfunctional lacZ' genes Gene Cloning Stage 3: Plasmids are inserted into bacterial cells by transformation; bacterial cells reproduce and form clones. Clone 1 Clone 2 Clones with recombinant plasmids Clone 3 Can be screened for the gene of interest Amplifying DNA in Vitro • Polymerase chain reaction (PCR) • Can produce many copies of a specific target segment of DNA • Uses primers that bracket the desired sequence • Uses a heat-resistant DNA polymerase Polymerase Chain Reaction (PCR) 1. Denaturation – a solution containing RNA primers and the DNA fragment to be amplified is heated so that the DNA dissociates into single strands. 2. Annealing of primers – the solution is cooled, and the primers bind to complementary sequences on the DNA flanking the gene to be amplified. 3. Primer extension – DNA polymerase then copies the remainder of each strand, beginning at the primer. 4. Repeat steps 1 – 3 many times, each time doubling the number of copies, until a sufficient number of copies are produced. The Polymerase Chain Reaction (PCR) 5 3 Target sequence APPLICATION With PCR, any specific segment—the target sequence—within a DNA sample can be copied many times (amplified) completely in vitro. TECHNIQUE The starting materials for PCR are doublestranded DNA containing the target nucleotide sequence to be copied, a heat-resistant DNA polymerase, all four nucleotides, and two short, single-stranded DNA molecules that serve as primers. One primer is complementary to one strand at one end of the target sequence; the second is complementary to the other strand at the other end of the sequence. RESULTS During each PCR cycle, the target DNA sequence is doubled. By the end of the third cycle, one-fourth of the molecules correspond exactly to the target sequence, with both strands of the correct length. After 20 or so cycles, the target sequence molecules outnumber all others by a billionfold or more. 3 Genomic DNA 1 Denaturation: 5 5 3 3 5 Heat briefly to separate DNA strands 2 Annealing: Cycle 1 yields 2 molecules Cool to allow primers to hydrogen-bond. Primers 3 Extension: DNA polymerase adds nucleotides to the 3 end of each primer Cycle 2 yields 4 molecules Cycle 3 yields 8 molecules; 2 molecules (in white boxes) match target sequence New nucleotides Identifying Clones Carrying a Gene of Interest • Cloning is used to prepare many copies of a gene of interest for use in sequencing the gene, in producing its encoded protein, in gene therapy, or in basic research • A clone carrying the gene of interest can be identified with a radioactively labeled nucleic acid probe • The probe has a sequence complementary to the gene • The process is called nucleic acid probe hybridization Using a Genetic Probe to Screen for the Gene of Interest 5. A comparison with the original plate identifies the colony containing the gene. 1. Colonies of bacteria, each grown from cells taken from a white colony. 2. A replica of the plate is made by pressing a filter against the colonies. Some cells from each colony adhere to the filter. Filter Film 3. The filter is washed with a solution that denatures the DNA and contains the radioactively labeled probe. The probe contains nucleotide sequences complementary to the gene of interest and binds to cells containing the gene. 4. Only those colonies containing the gene will retain the probe and emit radioactivity on film placed over the filter. Nucleic Acid Probe Hybridization APPLICATION Hybridization with a complementary nucleic acid probe detects a specific DNA within a mixture of DNA molecules. In this example, a collection of bacterial clones (colonies) are screened to identify those carrying a plasmid with a gene of interest. TECHNIQUE Cells from each colony known to contain recombinant plasmids (white colonies in Figure 20.4, stap 5) are transferred to separate locations on a new agar plate and allowed to grow into visible colonies. This collection of bacterial colonies is the master plate. Master plate Master plate Colonies containing gene of interest Probe DNA Solution containing probe Radioactive single-stranded DNA Gene of interest Single-stranded DNA from cell Filter Film Filter lifted and flipped over 1 A special filter paper is pressed against the master plate, transferring cells to the bottom side of the filter. RESULTS 2 Hybridization on filter The filter is treated to break open the cells and denature their DNA; the resulting singlestranded DNA molecules are treated so that they stick to the filter. 3 The filter is laid under photographic film, allowing any radioactive areas to expose the film (autoradiography). 4 After the developed film is flipped over, the reference marks on the film and master plate are aligned to locate colonies carrying the gene of interest. Colonies of cells containing the gene of interest have been identified by nucleic acid hybridization. Cells from colonies tagged with the probe can be grown in large tanks of liquid growth medium. Large amounts of the DNA containing the gene of interest can be isolated from these cultures. By using probes with different nucleotide sequences, the collection of bacterial clones can be screened for different genes. DNA Library • A DNA library is a collection of DNA fragments representing all the DNA of an organism. • Two Types: • Genomic libraries • cDNA libraries Genomic Library • The simplest kind, the entire genome of an organism is fragmented. • The fragments are then inserted into a vector, such as a plasmid or phage, and introduced into a host: DNA fragments from source DNA DNA inserted into plasmid vector DNA inserted into phage vector Storing Cloned Genes in DNA Libraries • A genomic library made using bacteria is a collection of recombinant vector clones produced by cloning DNA fragments derived from an entire genome • A genomic library made using bacteriophages is stored as a collection of phage clones Foreign genome cut up with restriction enzyme or Recombinant plasmids Bacterial clones (a) Plasmid library Recombinant phage DNA Phage clones (b) Phage library cDNA Library • A complementary DNA (cDNA) library is made by cloning DNA made in vitro by reverse transcription of all the mRNA produced by a particular cell • Includes only the DNA fragments that code for proteins, introns not included. • To produce a cDNA library, scientists first isolate the mature mRNA from an organism. • An enzyme called reverse transcriptase is then used to make a complementary DNA copy of each mature mRNA molecule: Intron (noncoding region) Exon (coding region) Eukaryotic DNA Transcription Primary RNA transcript Introns are cut out and coding regions are spliced together Mature mRNA transcript Isolation of mRNA Addition of reverse transcriptase mRNA-cDNA hybrid Addition of mRNAdegrading enzymes DNA polymerase Double-stranded cDNA gene without introns Restriction Fragment Length Polymorphisms (RFLP) • Different DNA sequences on homologous chromosomes, result in restriction fragments of different lengths • Specific fragments can be detected and analyzed by Southern blotting • The thousands of RFLPs present throughout eukaryotic DNA can serve as genetic markers Restriction Fragment Analysis • Detects DNA differences that affect restriction sites • Can rapidly provide useful comparative information about DNA sequences • For example comparing two alleles for a gene • Gel electrophoresis separates DNA restriction fragments of different lengths Normal -globin allele 175 bp 201 bp DdeI DdeI Large fragment DdeI DdeI Sickle-cell mutant -globin allele 376 bp Large fragment DdeI DdeI DdeI (a) DdeI restriction sites in normal and sickle-cell alleles of -globin gene. Normal Sickle-cell allele allele Large fragment 376 bp 201 bp 175 bp (b) Electrophoresis of restriction fragments from normal and sickle-cell alleles. Gel Electrophoresis and Southern Blotting APPLICATION Gel electrophoresis is used for separating nucleic acids or proteins that differ in size, electrical charge, or other physical properties. DNA molecules are separated by gel electrophoresis in restriction fragment analysis of both cloned genes (see Figure 20.9) and genomic DNA (see Figure 20.10). 1 2 Cathode Each sample, a mixture of DNA molecules, is placed in a separate well near one end of a thin slab of gel. The gel is supported by glass plates, bathed in an aqueous solution, and has electrodes attached to each end. When the current is turned on, the negatively charged DNA molecules move toward the positive electrode, with shorter molecules moving faster than longer ones. Bands are shown here in blue, but on an actual gel, DNA bands are not visible until a DNA-binding dye is added. The shortest molecules, having traveled farthest, end up in bands at the bottom of the gel. TECHNIQUE Gel electrophoresis separates macromolecules on the basis of their rate of movement through a gel in an electric field. How far a DNA molecule travels while the current is on is inversely proportional to its length. A mixture of DNA molecules, usually fragments produced by restriction enzyme digestion, is separated into “bands”; each band contains thousands of molecules of the same length. RESULTS After the current is turned off, a DNA-binding dye is added. This dye fluoresces pink in ultraviolet light, revealing the separated bands to which it binds. In this actual gel, the pink bands correspond to DNA fragments of different lengths separated by electrophoresis. If all the samples were initially cut with the same restriction enzyme, then the different band patterns indicate that they came from different sources. Power source Mixture of DNA molecules of different sizes Gel Glass plates Anode Longer molecules Shorter molecules Southern Blotting • Specific DNA fragments can be identified by Southern blotting • Uses labeled probes that hybridize to the DNA immobilized on a “blot” of the gel APPLICATION Researchers can detect specific nucleotide sequences within a DNA sample with this method. In particular, Southern blotting is useful for comparing the restriction fragments produced from different samples of genomic DNA. TECHNIQUE In this example, we compare genomic DNA samples from three individuals: a homozygote for the normal -globin allele (I), a homozygote for the mutant sickle-cell allele (II), and a heterozygote (III). DNA + restriction enzyme Restriction fragments I II III Nitrocellulose paper (blot) Heavy weight Gel Sponge I Normal -globin allele Alkaline solution II Sickle-cell III Heterozygote allele 1 Preparation of restriction fragments. 2 Gel electrophoresis. 3 Blotting. Paper towels Stack of paper towels Nitrocellulose paper Sponge Gel Buffer 2. The gel is covered with a sheet of nitrocellulose and placed in a tray of buffer on top of a sponge. Alkaline chemicals in the buffer denature the DNA into single strands. The buffer wicks its way up through the gel and nitrocellulose into a stack of paper towels placed on top of the nitrocellulose. Nitrocellulose paper now contains nucleic acid "print" Gel 3. Pattern on gel is copied faithfully, or “blotted,” onto the nitrocellulose. Southern Blotting – Labeled Probes Radioactively labeled probe for -globin gene is added to solution in a plastic bag I II III Paper blot 1 Hybridization with radioactive probe. RESULTS Probe hydrogenbonds to fragments containing normal or mutant -globin Fragment from sickle-cell -globin allele Fragment from normal -globin allele I II III Film over paper blot 2 Autoradiography. Because the band patterns for the three samples are clearly different, this method can be used to identify heterozygous carriers of the sickle-cell allele (III), as well as those with the disease, who have two mutant alleles (II), and unaffected individuals, who have two normal alleles (I). The band patterns for samples I and II resemble those observed for the purified normal and mutant alleles, respectively, seen in Figure 20.9b. The band pattern for the sample from the heterozygote (III) is a combination of the patterns for the two homozygotes (I and II). Film Size markers Hybridized nucleic acids 5. Photographic film is laid over the paper and is exposed only in areas that contain radioactivity (autoradiography). Nitrocellulose is examined for radioactive bands, indicating hybridization of the original nucleic acids with the radioactively labeled ones. Restriction endonuclease cutting sites RFLP Analysis Larger fragments Smaller fragments – + – + – + Single base-pair change Sequence duplication Three different DNA duplexes Cut DNA Gel electrophoresis of restriction fragments Genomes • The complete set of genetic instructions for an organism is referred to as its genome. • Genomics – the science of mapping and studying the genomes of living organisms • Involves • Genetic (Linkage) maps • Physical maps • DNA Sequencing Genetic maps • Genetic maps are linkage maps show the relative location of genes on a chromosome, determined by recombination frequencies. • Distances on genetic maps are measured in centimorgans (cM). One cM represents 0.01% recombination frequency. I Y II X IV III Mutant phenotypes Short aristae Black body 0 Long aristae (appendages on head) Cinnabar eyes Vestigial wings 48.5 57.5 67.0 Gray body Red eyes Brown eyes 104.5 Normal wings Wild-type phenotypes Red eyes Physical maps • Show the distance between DNA landmarks, such as the recognition sites for restriction enzymes. • Distances between landmarks on a physical map are measured in base-pairs (1000 base-pairs equals 1 kilobase kb). • Created by cutting genomic DNA with different restriction enzymes, and then determining the size of the pieces and how they fit together, into a continuous segment of the genome • Such a map shows the distance between the different recognition sites of the restriction enzymes: 2. The fragments produced by enzyme A only, by enzyme B only, and by enzymes A and B simultaneously are run out sideby-side on a gel, which separates them according to size, smaller fragments running faster. DNA Molecular weight marker 14kb 10kb 6kb 2kb 3. The fragments are arranged so that the smaller ones produced by the simultaneous cut can be grouped to generate the larger ones produced by the individual enzymes 4. A physical map is constructed. enzyme B 1. Multiple copies of a segment of DNA are cut with restriction enzymes. 14kb 9kb 8kb 9kb 5kb 2kb 5kb 3kb 2kb 2kb 8kb 9kb A A 5kb 14kb B 2kb 3kb 5kb 9kb A B A A B A 2kb 5kb 10kb Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 19kb DNA Sequencing • Ultimate map - organism’s DNA base-pair sequence of the entire genome. • Sequencing an entire genome, which may contain billions of base pairs • DNA must be cut into small fragments and automated sequencers are used to determine the base-pair sequence of DNA • Only accurate on fragments of DNA up to about 500 base-pairs in length. DNA Sequencing • Starts with the sequencing of random DNA fragments • Powerful computer programs then assemble the resulting very large number of overlapping short sequences into a single continuous sequence 1 Cut the DNA from many copies of an entire chromosome into overlapping fragments short enough for sequencing. 2 Clone the fragments in plasmid or phage vectors 3 Sequence each fragment ACGATACTGGT CGCCATCAGT 4 Order the sequences into one overall sequence with computer software. ACGATACTGGT AGTCCGCTATACGA …ATCGCCATCAGTCCGCTATACGATACTGGTCAA… DNA Sequencing • Short DNA fragments can be sequenced by the dideoxy chain-termination method DNA (template strand) C 5 T APPLICATION TECHNIQUE RESULTS The sequence of nucleotides in any cloned DNA fragment up to about 800 base pairs in length can be determined rapidly with specialized machines that carry out sequencing reactions and separate the labeled reaction products by length. This method synthesizes a nested set of DNA strands complementary to the original DNA fragment. Each strand starts with the same primer and ends with a dideoxyribonucleotide (ddNTP), a modified nucleotide. Incorporation of a ddNTP terminates a growing DNA strand because it lacks a 3’—OH group, the site for attachment of the next nucleotide (see Figure 16.12). In the set of strands synthesized, each nucleotide position along the original sequence is represented by strands ending at that point with the complementary ddNT. Because each type of ddNTP is tagged with a distinct fluorescent label, the identity of the ending nucleotides of the new strands, and ultimately the entire original sequence, can be determined. The color of the fluorescent tag on each strand indicates the identity of the nucleotide at its end. The results can be printed out as a spectrogram, and the sequence, which is complementary to the template strand, can then be read from bottom to top. (Notice that the sequence here begins after the primer.) Figure 20.12 G A C T T C G A C 3 A A C 5 T G A C T T C G A C A 3 A Primer 3 T G T T Deoxyribonucleotides Dideoxyribonucleotides (fluorescently tagged) 5 DNA polymerase dATP ddATP dCTP dTTP ddCTP ddTTP dGTP ddGTP P P P P P P G OH ddC T G T T ddG C T G T T ddA G C T G T T ddA A G C T G T T ddG A A G C T G T T ddT G A A G C T G T T Direction of movement of strands Laser Detector G A C T G A A G C H Labeled strands DNA (template strand) G ddC T G A A G C T G T T ddA C T G A A G C T G T T ddG A C T G A A G C T G T T 3 Human Genome Project • Project to sequence the entire human genome is called the human genome project • Sequencing the human genome is a major step towards improving the diagnosis and treatment of disease in humans - practical applications of this information will be enormous. • Project has already led to some important findings: • Human genome is surprisingly similar to other genomes • Only about 1% of the human genome codes for proteins Human Genome • Eukaryotes tend to have many more genes than prokaryotes. • However -complexity of an organism is not directly related to the number of genes • For example, the human genome has around 30,000 genes, about the same number as in mice and far fewer than in rice. • Current estimates are that the human genome contains about 25,000 genes, but the number of human proteins is much larger Human Genome • Humans have only about 25,000 protein-encoding genes, these genes can code for at least 87,000 different proteins. • How? Alternative splicing of exons can produce several different mature mRNAs from a single gene Alternative Splicing of Exons DNA Introns Unmodified RNA transcript Processed RNAin brain Processed RNAin muscle Exons Genomics • Genome sequences provide clues to important biological questions • In genomics scientists study whole sets of genes and their interactions • Computer analysis of genome sequences helps researchers identify sequences that are likely to encode proteins • Comparison of the sequences of “new” genes with those of known genes in other species may help identify new genes • For a gene of unknown function experimental inactivation of the gene and observation of the resulting phenotypic effects can provide clues to its function DNA Micro-arrays • A DNA microarray, is a small square of glass that is covered with thousands of short pieces of single-stranded DNA arranged in a grid. • The short chains of DNA nucleotides, which are attached to the glass surface, are called oligonucleotides. • Can be used to screen a genome for the presence of thousands of specific alleles at once. • To screen a person’s genome, a DNA sample is obtained, cut into fragments, heated to separate the strands, and then flooded over the chip. • Specific alleles can be determined based on which oligonucleotides bind to the chip DNA Technology • The practical applications of DNA technology affect our lives in many ways • Numerous fields are benefiting from DNA technology and genetic engineering • One obvious benefit of DNA technology is the identification of human genes whose mutation plays a role in genetic diseases Future Directions in Genomics • Genomics is the study of entire genomes • Proteomics is the systematic study of all the proteins encoded by a genome • Single nucleotide polymorphisms (SNPs) single base-pair variations that provide useful markers for studying human genetic variation Practical Applications Of DNA • Numerous fields are benefiting from DNA technology and genetic engineering • One obvious benefit of DNA technology is the identification of human genes whose mutation plays a role in genetic diseases • Medical scientists can now diagnose hundreds of human genetic disorders • By using PCR and primers corresponding to cloned disease genes, then sequencing the amplified product to look for the disease-causing mutation Diagnosis of Diseases • Hundreds of human genetic disorders are diagnosed • using PCR and primers corresponding to cloned disease genes • sequencing the amplified product to look for the disease-causing mutation • Even when a disease gene has not yet been cloned the presence of an abnormal allele can be diagnosed with reasonable accuracy if a closely linked RFLP marker has been found RFLP marker DNA Restriction sites Disease-causing allele Normal allele Human Gene Therapy • Is the alteration of an afflicted individual’s genes • Holds great potential for treating disorders traceable to a single defective gene • Uses various vectors for delivery of genes into cells Cloned gene (normal allele, absent from patient’s cells) Retrovirus capsid 1 Insert RNA version of normal allele into retrovirus. Viral RNA 2 Let retrovirus infect bone marrow cells that have been removed from the patient and cultured. 3 Viral DNA carrying the normal allele inserts into chromosome. Bone marrow cell from patient 4 Inject engineered cells into patient. Pharmaceutical Products • Large-scale production of human hormones and other proteins with therapeutic uses • Production of safer vaccines 2. Surface protein gene is isolated. 1. DNA is extracted. Gene specifying herpes simplex surface protein Herpes simplex virus Human immune response Harmless vaccinia (cowpox) virus 6. Antibodies directed against herpes simplex viral coat are made. 5. Harmless engineered virus (the vaccine) with surface like herpes simplex is injected into the human body. 3. Vaccinia DNA is extracted and cleaved. 4. Fragment containing surface gene combines with cleaved vaccinia DNA. Construction of Vaccine for Herpes Simplex Forensic Evidence • A DNA fingerprint is a specific pattern of bands of RFLP markers on a gel • DNA “fingerprints” obtained by analysis of tissue or body fluids found at crime scenes • Can provide definitive evidence that a suspect is guilty or not • DNA fingerprinting can also be used in establishing paternity Defendant’s blood (D) Blood from defendant’s clothes 4 g D Jeans Victim’s blood (V) 8 g shirt V Manipulation of Microganisms • Genetic engineering can be used to modify the metabolism of microorganisms • Can be used to extract minerals from the environment • Degrade various types of potentially toxic waste materials • Improve agricultural productivity and food quality Animal Husbandry and “Pharm” Animals • Transgenic animals contain genes from other organisms • Have been engineered to be pharmaceutical “factories” Escherichia coli Plasmid 1. Plasmid is removed and cut open with restriction endonuclease. 2. Cow somatotropin gene is isolated from cow cell. Gene of interest 5. Bacteria producing bovine somatotropin are grown in fermentation tanks. 3. Somatotropin gene is inserted into bacterial plasmid. 4. Plasmid is reintroduced into bacterium. Cow DNA Production of Bovine Somatotropin 6. Somatotropin is removed from bacteria and purified. 7. Bovine somatotropin is administered to cow to enhance milk production. Genetic Engineering in Plants • Agricultural scientists have already endowed a number of crop plants with genes for desirable traits • The Ti plasmid is the most commonly used vector for introducing new genes into plant cells APPLICATION Genes conferring useful traits, such as pest resistance, herbicide resistance, delayed ripening, and increased nutritional value, can be transferred from one plant variety or species to another using the Ti plasmid as a vector. TECHNIQUE 1 2 3 The Ti plasmid is isolated from the bacterium Agrobacterium tumefaciens. The segment of the plasmid that integrates into the genome of host cells is called T DNA. Isolated plasmids and foreign DNA containing a gene of interest are incubated with a restriction enzyme that cuts in the middle of T DNA. After base pairing occurs between the sticky ends of the plasmids and foreign DNA fragments, DNA ligase is added. Some of the resulting stable recombinant plasmids contain the gene of interest. Agrobacterium tumefaciens Ti plasmid Site where restriction enzyme cuts DNA with the gene of interest Recombinant Ti plasmid Recombinant plasmids can be introduced into cultured plant cells by electroporation. Or plasmids can be returned to Agrobacterium, which is then applied as a liquid suspension to the leaves of susceptible plants, infecting them. Once a plasmid is taken into a plant cell, its T DNA integrates into the cell‘s chromosomal DNA. RESULTS Transformed cells carrying the transgene of interest can regenerate complete plants that exhibit the new trait conferred by the transgene. Plant with new trait T DNA Transgenic Rice Beans Ferritin gene is transferred into rice from beans. Fe Ferritin protein increases iron content of rice. Aspergillus fungus Wild rice Phytase gene is transferred into rice from a fungus. Metallothionin gene is transferred into rice from wild rice. Pt Rice chromosome Phytate, which inhibits iron reabsorption, is destroyed by the phytase enzyme. S Metallothionin protein supplies extra sulfur to increase iron uptake. Daffodil Enzymes for -carotene synthesis are transferred into rice from daffodils. A1 A2 A3 A4 -carotene, a precursor to vitamin A, is synthesized. Safety and Ethical Questions Raised by DNA Technology • The potential benefits of genetic engineering • Must be carefully weighed against the potential hazards of creating products or developing procedures that are harmful to humans or the environment • Today, most public concern about possible hazards is focused on genetically modified (GM) organisms used as food