Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Basic techniques --- Nucleic acid hybridization complementary strands will associate and form double stranded molecules --- Restriction Enzymes These enzymes recognize and cleave DNA at specific sequences --- Blotting Allows analysis of a single sequence in a mixture --- DNA cloning This allows the isolation and generation of a large number of copies of a given DNA sequence --- DNA sequencing Determining the array of nucleotides in a DNA molecule --- PCR amplification of known sequence --- Transformation Stably integrating a piece of DNA into the genome of an organism --- Genetic engineering Altering the DNA sequence of a given piece of DNA --- Genomics Analyzing changes in an entire genome 1 Nucleic acid hybridization Complementary strands of DNA or RNA will specifically associate DNA is heated to 100C, the hydrogen bonds linking the two strands are broken The double helix dissociates into single strands. As the solution is allowed to cool, strands with complementary sequences readily re-form double helixes. This is called Nucleic acid hybridization. 5’ AAAAAAAATTTTAAAAAAA 3’ Will associate with 3’ TTTTTTTTAAAATTTTTTT 5’ This occurs with complementary DNA/DNA, DNA/RNA, RNA/RNA 2 Li-Fraumeni syndrome This technique is very sensitive and specific. A single 200 nucleotide sequence when added to a solution of a million sequences will specifically hybridize with the ONE complementary sequence Usefulness Li-Fraumeni syndrome Individuals in a family have a propensity to develop tumors at an early age Often these families have a deletion in the p53 gene When this family has a child, they might want to know if their child has normal p53 or not Nucleic acid hybridization provides a means to rapidly determine whether the sequence is present or not 3 Sequencing Reference Genome- Number of donor DNAs are sequenced Consensus sequence is reference genome Pieces of DNA are sequenced many times Computers are used to overlap the pieces to generate contigs Sequences of individuals will vary from the reference genome 4 The method Isolate DNA Patient Isolate DNA normal individual (The probe) Fragment DNA, Heat to denature Add radiolabeled ssDNA(p53 probe) Gradually and slowly cool solution Radiolabeled p53 probe associates with DNA in normal individual p53 probe is unable to associates with DNA of patient (gene absent) Add enzyme (nuclease) that specifically degrades ssDNA molecules. dsDNA remains. Radiolabel present in dsDNA No radiolabel present in dsDNA (because p53 probe could not anneal) 5 Extremely sensitive: p53 is 3000bp, human genome is 3000,000,000 bp Technique detects one sequence of 3000bp from 1 million sequences of 3000bp The method Isolate DNA normal individual Patient Fragment DNA, Heat to denature Add radiolabeled ssDNA (p53 gene) (p53 probe) Gradually and slowly cool solution Radiolabeled p53 probe associates with DNA in normal individual If patient is deficient for p53 gene Radiolabeled p53 probe is unable to associates with DNA in patient Add enzyme (nuclease) that specifically degrades ssDNA molecules. dsDNA remains degraded Radiolabel present in dsDNA No radiolabel present in dsDNA (because p53 probe could not anneal) 6 THE GENE PROBE!!! How do we isolate the GENE? How did we get a pure copy of the gene? 7 Restriction Enzymes Enzymes which cut DNA at specific sequences SmaI | 5’ AAAACCCGGGAAAA3’ 3’ TTTTGGGCCCTTTT5’ | This sequence is symmetrical. If one rotates it about the axis It reads the same EcoRI | 5’ AAAAGAATTCAAAA3’ 3’ TTTTCTTAAGTTTT5’ | 8 Restriction enzyme digestion of DNA (linear genomic double stranded DNA) OR Restriction enzyme digestion of bacterial plasmid DNA (small double stranded circular DNA) No digestion of RNA No digestion of single stranded DNA Restriction enzymes Blunt Vs Sticky Blunt ends Sticky ends Restriction sites SmaI 5’AAAAAAAAAAGGGGGGGGTTTTTTTCCCGGGAAAAAAAAGGGGGGGGTTTTTT3’ 3’TTTTTTTTTTCCCCCCCCAAAAAAAGGGCCCTTTTTTTTCCCCCCCCAAAAAA5’ 5’AAAAAAAAAAGGGGGGGGTTTTTTTCCC 3’TTTTTTTTTTCCCCCCCCAAAAAAAGGG GGGAAAAAAAAGGGGGGGGTTTTTT3’ CCCTTTTTTTTCCCCCCCCAAAAAA5’ EcoRI is another commonly used restriction enzyme 5’AAAAAAAAAAGGGGGGGGTTTTTTTGAATTCAAAAAAAAGGGGGGGGTTTTTT3’ 3’TTTTTTTTTTCCCCCCCCAAAAAAACTTAAGTTTTTTTTCCCCCCCCAAAAAA5’ 5’AAAAAAAAAAGGGGGGGGTTTTTTTG 3’TTTTTTTTTTCCCCCCCCAAAAAAACTTAA AATTCAAAAAAAAGGGGGGGGTTTTTT3’ GTTTTTTTTCCCCCCCCAAAAAA5’ Unlike SmaI which produces a blunt end, EcoRI produces sticky or cohesive ends (SINGLE STRANDED) These cohesive ends facilitate formation of recombinant DNA molecules 11 Linear/Circular DNA A linear DNA molecule with ONE SmaI site will be cut into two fragments A circular DNA molecule with ONE SmaI site will generate one DNA fragment 12 5’AAAAAAAAAAGGGGGGGGTTTTTTTGAATTCAAAAAAAAGGGGGGGGTTTTTT3’ 3’TTTTTTTTTTCCCCCCCCAAAAAAACTTAAGTTTTTTTTCCCCCCCCAAAAAA5’ 5’AAAAAAAAAAGGGGGGGGTTTTTTTG AATTCAAAAAAAAGGGGGGGGTTTTTT3’ 3’TTTTTTTTTTCCCCCCCCAAAAAAACTTAA GTTTTTTTTCCCCCCCCAAAAAA5’ 5’AAAAAAAAAAGGGGTTTTTTTG AATTCAAAAAAAAAAAAAAGGGGGGGGTTTTTTTG AATTCAAAAAAAAGGGGGGGGTTTTTT3’ 3’TTTTTTTTTACCCCAAAAAAACTTAA GTTTTTTTTTTTTTTCCCCCCCCAAAAAAACTTAA GTTTTTTTTCCCCCCCCAAAAAA5’ 13 Complementary sticky ends AAAAAAGGGGGGGGTTTTTTTG TTTTTTCCCCCCCCAAAAAAACTTAA AATTCAAAAAAAAGGGGGGGGTTT3’ GTTTTTTTTCCCCCCCCAAA5’ AAAAAAGGGGGGGGTTTTTTTG AATTCAAAAAAAAGGGGGGGGTTT3’ TTTTTTCCCCCCCCAAAAAAACTTAA GTTTTTTTTCCCCCCCCAAA5’ GGCCCAAAAAAAAGGGGGGGGTTT3’ AAAAAAGGGGGGGGTTTTTTTG GTTTTTTTTCCCCCCCCAAA5’ TTTTTTCCCCCCCCAAAAAAACTTAA Enzyme compatibility SmaI AAACCCGGGAAA TTTGGGCCCTTT EcoRI KpnI AAAGAATTCAAA TTTCTTAAGTTT AAAGGTACCAAA TTTCCATGGTTT XmaI MfeI AAACCCGGGAAA TTTGGGCCCTTT AAACAATTGAAA TTTGTTAACTTT Asp718 AAAGGTACCAAA TTTCCATGGTTT Restriction maps Restriction maps are descriptions of the number, type and distances between Restriction sites on a piece of DNA. Very useful for molecular biologists. Previously we used specific genes as markers on chromosome and Map units to indicate distance between the markers. Its like using specific landmarks to identify your location along a road. Restriction sites are also used as landmarks along a piece of DNA. pr 11Mu vg 5Mu cy 300kb PstI 205kb HindIII EcoRI BamHI 3kb 4kb SmaI Vg Pr AAAAAAAAAAAAGAATTCTTTTTT//TTTTTTTTAAGCTTCCCCCC//CCCCCCCTGCAGGGGGGGGGCCCGGGAAAAAAAA TTTTTTTTTTTTCTTAAGAAAAAA//AAAAAAAATTCGAAGGGGGG//GGGGGGGACGTCCCCCCCCCGGGCCCTTTTTTTT Restriction sites CAN serve as MARKERS ALONG the DNA. They can be used to generate a physical map of a specific DNA sequence can be created. 16 Drosophila Genome is 123 million bp long There are 15,000 genes (markers) Every gene marker is on average approximately 8000bp apart EcoRI sites are on average 4000bp apart HinDIII sites are on average 4000bp apart Etc etc There are many more landmarks on any one piece of DNA 17 Sequence Divergence The restriction map is a partial picture of the nucleotide sequence of a gene By comparing restriction maps we can surmise differences in the sequence between species NNNNNNNNGAATTCNNNNNNNN//NNNNNNNNAAGCTTNNNNNNNNNNNNNNCTGCAGNNNNNNNNNNNNNNN NNNNNNNNCTTAAGNNNNNNNN//NNNNNNNNTTCGAANNNNNNNNNNNNNNGACGTCNNNNNNNNNNNNNNN GeneA Mai California may rahta hu aur UCSC may padhata hu. Human Chimp Gibbon 18 Deletions and additions Normal Globin gene HindIII EcoRI 4 Globin gene from a thallesimia patient 4 HindIII 3 EcoRI 5 HindIII EcoRI EcoRI 3 8 HindIII 5 EcoRI EcoRI 3 With restriction maps, the relationship between a gene from two different individuals can be determined without having to actually sequence the gene from both individuals. 19 Very Large deletions or insertions can be studied using microscopy Small to large deletions/insertions (100 bp to several kb) can be studied using restriction maps 20 Describing a DNA piece based on the pattern of restriction sites Restriction map of a cloned piece of DNA Linear or circular B K S Restriction map B E H E B K S B How do I do this for an unknown piece of DNA? Analogy 1 2 Identify the parts for this blob and describe the spatial relationship between the parts a c a 3 c 4 b b Break the blob apart into its separate parts Look at the shapes and numbers of the parts Fit the parts together Restriction map of piece of DNA Large amount of pure DNA (many copies of the same DNA is required) (Cloned) Then you digest the DNA Take (cloned) DNA in a tube, Add restriction enzyme, Allow enzyme to cut DNA at its binding sites Run the digested DNA on a gel to resolve the DNA fragments based on size Piece the fragments together to determine the linear order of the fragments (build the map) Method - DNA is an anion (-ve charged) and moves towards the Positive anode. 7 The rate of migration of a DNA fragment is inversely proportional to its size. Larger the size, slower its movement. 3 4 2 + 1 2 HindIII 5 EcoRI 3 HindIII EcoRI EcoRI 1 5 24 EcoRI/HindIII The length of the DNA can be accurately determined by allowing the charged DNA to run through an agarose gel. HindIII Agarose gel electrophoresis Marker EcoRI Marker EcoRI HindIII EcoRI/HindIII Gel electrophoresis Mapping 20 14 HindIII Marker uncut EcoRI You are given a 20 kb fragment of DNA After trying many enzymes you find that EcoRI and HindIII cut the fragment HindIII 14kb and 6kb EcoRI 12kb 6kb and 2kb Solve the map 6 H 14 12 6 4 2 1 6 14 Or its mirror image 14 6 They are the same What about EcoRI? 12 2 E 6 E 25 How do you arrange these three fragments wrt one another Mapping Since HindIII cut the 20kb fragment once, in which of the three EcoRI fragment does it cut? Marker EcoRI HindIII EcoRI+HindIII A double digest with both enzymes will provide the answer Fragments of 8kb, 6kb, 4kb and 2kb The double digest does not alter the size of the 6kb and 2kb fragments The 12kb fragment is lost. Also 8+4=12 14 12 6 4 8 4 2 6 12 2 1 8 H 4 E 6 E Partial Map only!!!! Not enough information 26 2 New Mapping How are these fragments ordered? Marker EcoRI HindIII EcoRI+ HindIII The HindIII single digest tells us that they must be ordered so that One side adds up to 6kb and the other side adds up to 14kb 14 12 6 4 2 1 27 Mapping HindIII 14 6 EcoRI 12 6 2 HindIII/EcoRI 8 6 4 2 28 Mapping HindIII 14 6 EcoRI 12 6 HindIII/EcoRI 8 6 4 2 2 4 6 2 4 2 6 8 6 4 16 & 4 12 4 8 6 2 12 4 8 6 12 & 8 12 8 2 16 & 4 12 4 2 12 & 8 12 8 6 HindIII 8 12 10 & 10 14 & 6 2 29 Different Mapping example Hi 12 8 Ec 12 6 2 Hi/Ec 8 6 4 2 Ps 13 7 Ps/Ec 12 5 2 1 Three different enzymes Hi Ec Ps 30 Mapping HindIII 12 8 EcoRI 12 6 2 HindIII/EcoRI 8 6 4 2 HindIII 12 & 8 12 & 8 31 Mapping HindIII 12 8 EcoRI 12 6 HindIII/EcoRI 8 6 4 2 HindIII 2 4 6 2 8 12 4 2 6 12 & 8 8 12 & 8 12 32 Mapping EcoRI 12 6 2 PstI 13 7 PstI/EcoRI 12 5 2 1 33 Mapping EcoRI 12 6 2 6 2 5 & 15 12 5 1 & 19 6 2 2 12 5 6 5 2 12 6 1 2 PstI/EcoRI 12 5 2 1 Pst I 1 5 1 PstI 13 7 3 & 17 12 1 6 7 & 13 12 4 8 34 Final Map P 5 2 Hi 12 8 1 8 4 E E Ec 12 6 2 H Hi/Ec 8 6 4 2 Ps 13 7 Ps/Ec 12 5 2 1 35 Mapping deletions Say you isolated this DNA from a region coding for GeneA, from a normal Patient and one suffering from a syndrome. The fragment was 17kb in the affected individual rather than 20kb in the normal patient You draws restriction maps for the normal patient 6 E 8 H 4 E 2 You draws restriction maps for the affected individual 6 E 8 H1 E 2 There is a 3kb deletion in the 4kb HindIII/EcoRI fragment 36 Complex Mapping Marker 2kb 2kb+HindIII Marker 6kb 6kb+HindIII Marker EcoRI HindIII EcoRI+ HindIII Marker 12kb 12kb+HindIII Often maps are more complex and difficult to analyze using single and double digests alone. To simplify the analyses, you can isolate each EcoRI band from the gel and then digest with HindIII 14 14 14 14 12 12 12 12 6 6 6 6 4 4 4 4 2 2 2 2 1 1 1 1 37 Mt DNA Y chromosomes can be used to study paternal lineage mtDNA can be used to follow maternal lineage Cells contain organelles- Mitochondria are organelles that produce Energy. They contain a small 17,000 bp circular DNA. It encodes for 13 proteins in human cells and some tRNA’s Hypervariable region (150 bp) tRNA CytochromeB NADH dehydrogenase cytochromeC oxidase ATP synthase Mitochondrial DNA inheritance is not mendelian It is inherited maternally 38 Argentina 1976-1983 Military rule in Argentina-10,000 deaths Grandmothers of the plaza de Mayo: contacted AAAS about missing grandchildren Mary Claire King/ Allan Wilson- UC-Berkeley (Human lymphocyte antigen-HLA) Mapping mitochondria made it possible to match Child with maternal grandmother! 39 Additional mutations generate diversity. You have individuals With A, B, C and D DNAs Eve Geographic region DNA A Mutation generates B from A. Now you have individuals With A and B DNA in population. C B A B A D 40 Out of Africa C C B C F A D E B A D G C migrates to form a separate population. Additional mutations diversify DNAs in populations. Original population more diverse than newer population Compared sequences of mtDNA There are greater sequence differences among Africans than any other group (Europeans, American Indians, Asians, etc etc) The african population had the longest time to evolve variation And thus humans originated in Africa. 41 Using DNA to study History This hypothesis was initially derived from restriction maps of mitochondrial DNA America Australia Europe Asia Africa “Eve’s DNA” 42 All humans are derived from a small African population about 170K yrs ago Cloning DNA A reasonable question is how did we get the 20kb fragment in the first place? Or how do we obtain the gene To understand the origin of the fragment we must address the issue of: The construction of Recombinant DNA molecules or cloning of DNA molecules Recombinant DNA is generated through cutting and pasting of DNA to produce novel sequence arrangements Restriction enzymes such as EcoRI produce staggered cuts leaving short single-stranded tails at the ends of the fragment. These “cohesive or sticky” ends allow joining of different DNA fragments When a piece of DNA is cut with EcoRI, you get nnnG nnnCTTAA | nnnGAATTCnnn nnnCTTAAGnnn | AATTCnnn Gnnn 43 Cloning DNA A reasonable question is how did we get the 20kb fragment of DNA in the first place? To understand the origin of the fragment we must address the issue of: The construction of Recombinant DNA molecules or cloning of DNA molecules Recombinant DNA is generated through cutting and pasting of DNA to produce novel sequence arrangements 44 Recombinant DNA Restriction enzymes such as EcoRI produce staggered cuts leaving short single-stranded tails at the ends of the fragment. These “cohesive or sticky” ends allow joining of different DNA fragments When a piece of DNA is cut with EcoRI, you get | GAATTC CTTAAG | AATTC-----------------G G-----------------CTTAA AATTC-----------------G G-----------------CTTAA 5’AAAAAAAAAAGGGGTTTTTTTG AATTCAAAAAAAAAAAAAAGGGGGGGGTTTTTTTG AATTCAAAAAAAAGGGGGGGGTTTTTT3’ 3’TTTTTTTTTACCCCAAAAAAACTTAA GTTTTTTTTTTTTTTCCCCCCCCAAAAAAACTTAA GTTTTTTTTCCCCCCCCAAAAAA5’ 45 Plasmids Plasmids are naturally occurring circular pieces of DNA in E. coli The plasmid DNA is circular and usually has one EcoRI site. It is cut with EcoRI to give a linear plasmid DNA molecule AATT 46 Plasmids Small circular autonomously replicating extrachromosomal DNA Modified plasmids, called cloning vectors Are used by molecular biologists to isolate Large quantities of a given DNA fragment Plasmids used for cloning share three properties Unique restriction site Antibiotic resistance Origin of replication E B Bacterial genome Plasmid DNA (5000kb) (3kb) Origin 47 Antibiotic resistance gene Plasmid elements Origin of replication: This is a DNA element that allows the plasmid to be replicated and duplicated in bacteria. Each time the bacterium divides, the plasmid also needs to divide and go with the daughter cells. If a plasmid cannot replicate in bacteria, then it will be lost. 48 Plasmid elements Antibiotic resistance: This allows for the presence of the plasmid to be selectively maintained in a given strain of bacteria Lab bacterial strains are sensitive to antibiotics. When grown on plates with antibiotics, they die. The presence of a plasmid with the antibiotics resistance gene allows these lab strains to grow on plates with the antibiotic. You are therefore selecting for bacterial colonies with the Plasmid 49 Plasmid elements Unique restriction sites: For cloning the plasmid needs too be linearized. Most cloning vectors have unique restriction sites. If the plasmid contains more than one site for a given restriction enzyme, this results in fragmentation of the plasmid Why does this matter? Ori Antibiotic resistance gene 50 pUC18 pUC18 is a commonly used plasmid: pUC= plasmid University of California Plasmid pBR322 pUC18 pACYC pSC101 replicon pMB1 pMB1 p15A pSC101 copy No 15 500 10 5 51 Cloning DNA When a piece of DNA is cut with EcoRI, you get | GAATTC CTTAAG | AATTC-----------------G G-----------------CTTAA AATTC-----------------G G-----------------CTTAA When tow pieces of DNA cut with EcoRI are ligated back together you get back an EcoRI site -----------------G AATTC---------------------------------CTTAA G----------------- 52 53 Ligation PLASMID GENOMIC DNA AATT The EcoRI linearized PLASMID DNA is mixed with HUMAN DNA digested with EcoRI The sticky ends will hybridize/anneal specifically and a recombinant plasmid will be generated 54 Cloning The genomic DNA fragments is mixed with a plasmid that has been linearized at a single EcoRI site (say pUC18) E F G h Ampr d Ori Both the plasmid and genomic DNA have been cut with EcoRI, they have complementary sticky ends | G A A T T C C T T A A G | ________________________ AATT----------------------------- AATT ________________________TTAA -----------------------------TTAA Plasmid Genomic DNA 55 Recombinant plasmid This process where foreign genomic DNA is joined to plasmid DNA is called ligation It results in recombinant plasmid (foreign DNA+plasmid) Each plasmid has one foreign EcoRI fragment Each foreign fragment is still present as only one copy! This is not useful. 56 Incompatibility of sticky ends | Plasmid cut with EcoRI G A A T T C C T T A A G | _____________________ _____________________TTAA AATT Plasmid Genomic DNA cut with HinDIII | A A G C T T T T C G A A | AGCT-----------------------------------------------------TCGA Genomic DNA Won’t work!! __________________ AGCT----------------------------AATT __________________TTAA -----------------------------TCGA 57 Transformation Ampr The entire collection of these plasmids bearing genomic DNA inserts is called a Genomic Library! These plasmids are added back into bacteria by a process called transformation Ori The bacteria are selected for the presence of the Plasmid by growth on media containing antibiotics dE F G h Petri dish + antibiotic Each colony of E. coli will harbor one plasmid with one piece of genomic DNA. Only cells with plasmid will grow on plates with antibiotics (the antibiotic resistance gene on plasmid allows these 58 cells to grow). Cells that did not take up a plasmid will not grow. Plasmid propagation The plasmid DNA can replicate in bacteria and therefore many copies of the plasmid will be made. The human DNA fragment in the plasmid will also multiply along with the plasmid DNA. THE DNA IS CLONED Normally a gene is present as 2 copies in a cell. If the gene is 3000bp long there are 6x103 bp in a total of 6x109 bp of the human genome Once ligated into a plasmid, unlimited copies of a single gene can be produced.The process of amplifying and isolating the human DNA fragment is called DNA cloning. 59 Why are plasmids important? Most genes are present as two copies in the entire genome. Plasmids allow us to obtain 1000’s of copies of a gene in a pure form 60 Cloning genes Cloning and Expression of genes in cells Coding region of protein Enhancer, Promoter, Ribosome binding site E B No cloning of RNA into double stranded plasmid DNA No cloning of single stranded DNA into double stranded plasmid DNA E B E E H Coding region cloning E H E B B E H E B B K S B Promoter cloning E H E B K S B Isolate the plasmid To isolate the gene fragment, we grow up a large population of E. coli containing the plasmid with the gene insert. A simple procedure allows us to isolate the plasmid (which is smaller than Chromosomal DNA) Once we have purified the plasmid we have 1000’s of copies of Gene in a plasmid We can take the plasmid and cut it with EcoRI. When the digest is run on an agarose gel, we get two bands- one corresponding to the plasmid and one to the insert. EcoRI Uncut Marker The DNA present in the band corresponding to the insert can be isolated from the gel PURE GENE !!!!! Gene C plasmid 64 Foreign gene expression What if you want to express Influenza antigen in chicken cells? Influenza virus regulatory sequences do not work in chicken cells Connect Influenza antigen gene to a chicken enhancer/promoter Splicing regulatory sites, translation regulatory sites will also have to be Chicken specific Chicken Enhancer Chicken Promoter Influenza Gene 65 Mixing and matching HinD Blood specific promoter 5’UT R HinD Coding region GLOBIN gene 3’UT R ori Kanr HinD Liver specific promoter ori Kanr HinD HinD Globin Expression in liver 66 Inter-species Gene transfer CF gene on a plasmid CF+ Isolate Plasmid Transfect human cell with CF+ plasmid Human Cell is cf-/cfIt becomes CF+ after transfection 67 Definition of Key Terms Cisgenics Genetic modification of a recipient plant/animal with a gene from a sexually compatible plant/animal species Transgenics Genetic modification of a recipient plant with a gene from a sexually incompatible plant/animal or other organism Traditional breeding Conventional cross breeding of two species of plants to transfer a gene from one species to the other Are cisgenics acceptable? Are transgenics acceptable? 68 69 Genetically modified organisms GMO Attempts to cross wheat and rye produce sterile offspring. New techniques were developed that allowed production of fertile hybrid. The two plants were treated with a potent toxin colchicine and the genomes were severely MUTAGENIZED The mutagenesis allowed the genome of wheat and rye (these are different species) to overcome the species barriers, fuse and form a NEW SPECIES !! These plants were used to develop genetically novel plants with traits from wheat and rye parents producing a “SuperFood” GOOD IDEA? BAD IDEA? 70 Genetically modified plants Ethylene gas released by fruit accelerates the ripening process. Prevention of ethylene production would block the fruit from ripening prematurely and spoiling on the way to the market. The ethylene biosynthetic pathway is as follows: Precursor----->ACC------>ethylene ACC ACC synthase oxidase Genetic technology was used to generate mutants in the plant so that they could not synthesize the enzymes required for ethylene gas production. Generated and marketed the “SUPER SAVR TOMATO” GOOD IDEA? BAD IDEA? 71 Genetically modified plants A species of bacteria produces a potent natural pesticide This toxin is used in organic farming The gene necessary for producing the toxin was identified and cloned. It was then modified and inserted into the genome of cotton plants. This bacterial gene was now able to replicate in cotton and the plant made and secreted the toxin. The plant now produced the toxin thus eliminating the need for pesticide spraying. This would reduce the harmful effects of pesticides on humans GOOD IDEA? BAD IDEA? 72 CORN Ancient corn roots emit a volatile substance, b-caryophyllene, when attacked by insects. The substance attracts nematodes to the roots. These worms eat the insects protecting the corn. Commercial corn has a mutation and cannot produce bcaryophyllene. The wild type gene b-caryophyllene synthase was cloned. A commercial corn plant was transformed with the wild type gene -b-caryophyllene synthase. The plant could now produce b-caryophyllene and was resistant to insects. Good Idea Bad Idea? Ancient corn Small cob Large height Insect resistant Slow growth Easily stressed x commercial corn large cob short height insect sensitive rapid growth stress resistant 73 Genetically modified plants Trititcale- created in the 1880’s-1930’s by the Edinburgh Botanical Society. Using chemical mutagenesis combined with Mendelian crosses. It is currently sold primarily in organic health food stores. Is it a good idea to mutate crops using chemical mutagens? Flavor Savr tomato helps transport fragile food preventing waste. Labeled a Frankenfood. It has a single mutation in one gene. Is it a good idea to mutate crops using recombinant DNA methods? What if you made the same mutation by classical genetics? Bt cotton created in the 1990’s using recombinant DNA and transgenic technology. What if you inserted a gene from one species in to another species using classical genetics? Reinserting Caryophyllene synthase into corn restores its natural insect resistance which was lost when commercial corn varieties were generated by classic breeding techniques. What if you inserted this gene back by genetic crosses? Gene blocking may produce tea, coffee without the caffeine Tomatoes with a higher antioxidant (lycopene) content Fungal resistant bananas Smaller, seedless melons for use as single servings Bananas and pineapples with delayed ripening qualities Message: Understand the differences (GM-foods) pre- and post-1990 74 75 Genomic clones What are genomic clones What are cDNA clone What is a PCR clone of a specific gene A Gene1 Gene2 B C Gene3 D E F Each fragment is ligated into the plasmid Each plasmid is put (transformed) into E.coli Each E. coli colony on a plate has one specific plasmid C D A B 78 Genomic clone libraries Species Genome size average insert size #plasmids E. Coli Drosophila Human 5000kb 150,000kb 3000,000kb 16 kb 16 kb 16 kb 1300 46,000 >100,000 An entire genome of any organism can be cloned as small fragments in plasmids The larger the genome, the more difficult the task At present, genomic DNA libraries exist for a large number of organisms including Yeast, C.elegans, Drosophila, Zebrafish, Xenopus, Chickens, Mouse, Humans etc 79 cDNA clone RNA Cannot be cloned Reverse transcriptase copies RNA into DNA So to clone RNA, you first convert RNA into DNA using reverse transcriptase This DNA (cDNA) is an complementary copy of the RNA (RNA was the template) The cDNA is then cloned into plasmids cDNA Often we have RNA rather than DNA as the starting material For instance in the case of the human hemoglobin gene, we started with globin mRNA RNA is difficult to work with. In contrast to DNA, RNA breaks down and degrades very easily. There are no restriction enzymes that cut RNA at specific sites. RNA cannot be cloned. It cannot be inserted into a plasmid and amplified since all Plasmids are DNA. The enzyme reverse transcriptase has proven very useful to molecular biologists. This enzyme catalyzes the synthesis of DNA from a RNA template. It is normally found in a large class of viruses. The genome of these viruses is RNA!! These viruses are called retroviruses.They infect eukaryotic cells and use these cells to grow/replicate Retroviruses carry an RNA genome. Interestingly they will integrate into the DNA of the host. For RNA to integrate into DNA, first the RNA has to be converted to DNA Remember the central dogma of molecular biology Information flows from DNA to RNA to protein! DNA---->RNA---->protein Reverse Transcriptase reverses this dogma (partially) 81 cDNA synthesis Protein coat RNA genome Reverse transcriptase mRNA mRNA DNA RT DNA cDNA 82 cDNA/splicing So from globin mRNA, a complementary DNA molecule can be created using reverse Transcriptase. This complementary DNA is called cDNA. The cDNA can now be inserted into a plasmid and cloned. What is the relationship between a cDNA clone and a genomic clone? Splicing In eukaryotes, the coding sequences are interrupted by introns 1 2 3 4 5 Gene 7700 nt 6 7 Ovalbumin Primary transcript Splicing mRNA 1872 nt 83 Genomic Vs cDNA Genomic clones represent the organization of the DNA in the nucleus! cDNA clones represents the organization of mRNA sequences after the gene has been transcribed, processed and exported to the cytoplasm. cDNA clones contain the sequence of nucleotides that code for the mRNA--protein! cDNA clones do not contain the sequence of the promoter of the gene or the intron. The starting material for cDNA clones is different from material used to make genomic clones Genomic clone cDNA clone Source Nucleii (any cell) cytoplasmic RNA (specific cell type) Use Studies on gene organization & Studies directed towards coding regions structure 84 85 Sequencing Reference Genome- Number of donor DNAs are sequenced Consensus sequence is reference genome Pieces of DNA are sequenced many times Computers are used to overlap the pieces to generate contigs Sequences of individuals will vary from the reference genome UCSC Genome Browser: 86 PCR It’s a method that can be used to make many copies of a particular DNA sequence from a particular individual You have to know the DNA sequence before you can amplify that sequence (it does not have to be cloned) The sequence will not propagate (replicate) in living organisms 87 PCR clone PCR cloning IF YOU KNOW THE SEQUENCE OF THE GENE YOU WANT TO CLONE You can use PCR to first make many copies of your gene Then you can clone those copies into a plasmid. 89 Blotting You can Restriction map a cloned piece of DNA Can you restriction map a piece of DNA in the genome without first cloning it? 90 Southern blotting Rapid method of identifying a specific DNA fragment from a mixture of fragments plasmid EcoRI EcoRI Uncut Marker Insert Gene How do you determine which band corresponds to insert and which to the plasmid 91 Marker Uncut EcoRI EcoRI Uncut Marker A probe is used to identify genomic DNA? DNA is transferred from the gel to a paper filter The DNA (plasmid and chromosomal) on the paper is denatured (converted from ds to ss) Then you take the filter and to it add radiolabeled probe (small part of Gene). 92 Southern blotting with a probe TTTTTTT AAAAAAA Marker Uncut A probe with this specific sequence is generated and made radioactive EcoRI The probe AAAAAAA will bind the single stranded DNA that has a complementary sequence (TTTTTT). It will specifically hybridize with the insert (genomic DNA) Incubate the filter with the radiolabeled probe A specific probe enabled us to identify a DNA fragment that corresponds to a specific gene of interest. 93 PROBES Probes are obtained in a number of ways RNA as a source The probe for hemoglobin can be obtained from mRNA of immature red blood cells. The major transcript of these cells is from the hemoglobin gene. So isolating RNA from these cells, we can obtain a relatively pure probe for the hemoglobin gene Protein If you have a purified protein, the amino acid sequence can be determined. From the amino acid sequence, using the genetic code a corresponding DNA sequence can be synthesized and this small DNA piece can be used as a probe Homology Probes from conserved genes-Many genes are conserved from one species to another Chimpanzee and human DNA are 97% identical. If you know the sequence of a gene in chimps, then you will be able to know the sequence for the gene in humans! The histone genes are highly conserved across phyla. Histone proteins have three Amino acid differences between humans and peas Histone genes have been isolated in yeast, they can serve as probes for screening a Human genomic library- cloning by phone The computer databases PCR 94 What about a genome? What if Gene C was in a large genome. Could we identify the fragment by Southern blotting EcoRI 2kb 4kb 5kb GeneC GeneX Marker Marker GeneR 3kb Transfer to membrane 4.5kb 0.5kb GeneA Marker 1kb Hybridize with Probe C Based on the blot what is the restriction map for gene C? 95 Map by Blotting Actual Map 2kb E E 3kb 4kb GeneR 5kb GeneC Marker H EcoRI E 4.5kb GeneX 8kb H Marker 3kb E 0.5kb GeneA 9kb Marker 1kb E Marker E HindIII Southern Blot inferred Map E E 4kb GeneC 96 H 8kb H E E E 1kb E E 2kb 4kb 3kb GeneC ProbeA ProbeB ProbeC Mapping chromosomal DNA with different probes Probe A 2Kb fragment Probe B 2Kb and 4Kb fragment ProbeC 4Kb fragment 97 You can build a genomic restriction map If we digest the DNA with HindIII instead of EcoRI what will happen? E 1 E 2 4 E E GeneC EcoRI H H 1.5 H 0.5 3.5 Marker Marker Marker H HindIII EcoRI+ HindIII 98 E E 1 E E 2 4 Gene A E E 1 B E E 1 4 Gene Marker Marker B Marker Marker A Mapping deletion with probe A. Mapping deletion with probe B. 99 Rapid analysis of globin gene (large deletion) M HM 0.2kb M H 1.1kb Exon1 Exon2 D 0.3kb deletion 1.1 1 Del WT Marker HindIII Del WT Marker MstII 1.35 1.05 0.2 100 Map by Blotting Actual Map 2kb E E 3kb 4kb GeneR 5kb GeneC Marker H EcoRI E 4.5kb GeneX 8kb H Marker 3kb E 0.5kb GeneA 9kb Marker 1kb E Marker E HindIII Southern Blot inferred Map E E 4kb GeneC 101 H 8kb H Very small Deletion of restriction site 2kb E 3kb GeneR 8kb Marker H EcoRI E 4kb GeneC Marker 3kb E 5kb GeneX H E 4.5kb 0.5kb GeneA 9kb Marker 1kb E Marker E EcoRI 102 103 Northern blot This is a rapid method that allows you to determine the cell type in which a specific gene is active and being transcribed. Brain Bone Embryo Blood Lung liver These tissues differ because each is transcribing a unique subset of genes. Each tissue contains a unique and distinct mRNA population Presence of RNA is a reflection of gene activity 104 Northern blot Method is analogous to Southern blots Instead of DNA as the starting material, you use RNA. You take cells, break them open, isolate the RNA and run the RNA on a gel Transfer RNA to membrane and use probe for gene of interest. WT individual Globin probe Kidney Bone marrow Brain erythrocyte Lymphocyte Kidney Bone marrow Brain erythrocyte Lymphocyte The RNA can be from specific tissues or cell types mutant individual Globin probe Presence of RNA is a reflection of gene activity 105 Microarray Microarrays are miniature devices containing thousands of DNA sequences stuck on at different positions (addresses). Hybridisation to complex mixtures of labelled DNA molecules, prepared from cellular RNA, shows the relative expression levels of thousands of genes. This can be used to compare gene expression levels within a sample or look at differences in the expression of specific genes across different samples. Key principles * RNA isolated from a particular cell type or tissue comprises a complex mixture of different RNA transcripts. The abundances of individual transcripts in the mixture reflect the expression levels of the corresponding genes. * A microarray is a small device, about the size of a microscope slide, with thousands of different known DNA sequences immobilised at different addresses on the surface. * Each of these DNA sequences can participate in a hybridisation reaction. * If a complex DNA mixture copied from the above RNA is labelled and hybridised to the microarray, the strength of the signal at each address shows the relative expression levels of the corresponding gene. Microarrays can be used to compare gene expression levels within a sample or look at differences in the expression of specific genes across different samples. How does it work? Single DNA strands with complementary sequences can pair with each other and form double-stranded molecules. This hybridisation process occurs with such specificity that a labelled DNA probe - a single DNA strand carrying a label that allows it to be detected — can pick out a matching partner, the target, in a complex mixture containing millions of different sequences. Microarrays apply the hybridisation principle in a highly parallel format. Instead of one target, thousands of different potential targets are arrayed on a miniature solid support. Instead of a unique labelled DNA probe, a complex mixture of labelled DNA molecules is used, prepared from the RNA of a particular cell type or tissue. The abundances of individual labelled DNA molecules in this complex probe reflect the expression levels of the corresponding genes. When hybridised to the array, abundant sequences will generate strong signals and rare sequences will generate weak signals. The strength of the signal thus represents the level of gene expression in the 106 original sample. How is it used? Microarrays These are reverse northern blots. Allows us to examine gene expression of all of the genes in the genome! Each spot is DNA for one defined gene. Each gene DNA is spotted in a grid. They cover the entire genome. Make total RNA from normal and mutant cell, Label each total RNA differently Wt=red Mut=green Add labeled RNA from normal and mutant cells to array and let hybridize Measure label and determine change WT Mut 1 2 3 4 5 Ratio of WT/mut 107 1, 2, 3 … are sequences specific for gene1, gene2, gene3 etc printed on the slide Use of microarrays To measure changes in transcription of genes during drug treatment To identify deletions in DNA A microarray works by exploiting the ability of a given mRNA molecule to bind specifically to, or hybridize to, the DNA template from which it originated. 108 Genome sequencing Whether bacterium or human, the genome of any organism to too large to be deciphered in one go. The genome is therefore broken into smaller pieces of DNA, each piece is sequenced and computers fit all the sequences back together. The human chromosome to be sequenced. The chromosome is first chopped randomly into conveniently sized chunks. These large fragments are inserted into bacterial artificial chromosomes (BACs) and cloned in bacteria. These fragments are then mapped so it is known which region of the chromosome they came from. Each BAC is shotgunned - broken randomly into many small pieces. This process is repeated several times to give different sets of fragments. (The whole-genome shotgun method goes directly to this stage.) The fragments are cloned in small vectors and then sequenced. About 500 bases of sequence information is produced from each fragment. The sequences are fed into a computer, which looks for overlaps at the end of the sequence to find neighbouring fragments. When many fragments have been sequenced the sequence of the original BAC insert can be assembled. The process is carried out for all the BACs to give a complete chromosomal sequence. For example, the human genome is about 3 billion base pairs, arrayed in 24 chromosomes. The chromosomes themselves are 50–250 million bases (megabases) long. These tracts of DNA are much too large for even the latest automated machines, which sequence fragments of DNA between 400 and 700 bases long. The genome is first broken into conveniently sized chunks, fragments of about 150 kilobases. Each fragment is inserted into a bacterial artificial chromosome (BAC), a cloning vector used to propagate DNA in bacteria grown in culture. The BACs are then mapped, so that it is known exactly where the inserts have come from. This process makes re-assembling the sequenced fragments to reflect their original position in the genome easier and more accurate, and any one piece of human DNA sequence can automatically be placed to an accuracy of 1 part in 30 000. Each of the large clones is then 'shotgunned' - broken into pieces of perhaps 1500 base pairs, either by enzymes or by physical shearing - and the fragments are sequenced separately. Shotgunning the original large clone randomly several times ensures that some of the fragments will overlap; computers then analyse the sequences of these small fragments, looking for end sequences that overlap - indicating neighbouring fragments - and assembling the original sequence of the clone. An alternative approach, 'whole genome shotgun sequencing', was first used in 1982 by the inventor of shotgun sequencing, Fred Sanger, while working on phages (viruses of bacteria). As its name suggests, in this technique the whole genome is broken into small fragments that can be sequenced and reassembled. This method is very useful for organisms with smaller genomes, or when a related genome is already known. 109 Animal cloning Animal clones are genetically identical. Natural clones occur in the form of identical twins but it is also possible to produce artificial clones by nuclear transfer. The nucleus is removed from a somatic (body) cell and placed in an egg whose own nucleus has been removed. The egg is then implanted in a surrogate mother and develops to term. Key principles * Differentiated animal cells are unable to develop into complete animals *The nuclei of most differentiated cells retain all the necessary genetic information. * Transfer such a nucleus into an egg whose own nucleus has been removed. * Transfer to the environment of the egg reprograms the nucleus (makes it forget its history) and allows the full development of a viable animal that is genetically identical to the donor of the somatic cell. * Until 1997, cloning in mammals was only possible using nuclei obtained from very early embryos. A breakthrough was made when cloning was achieved using nuclei from adult cells. * Recent research suggests that animals produced by cloning from adult cells may age prematurely, but further investigation is necessary. How does it work? Nuclear transfer is carried out by fusing the donor somatic cell to an egg whose own nucleus has been removed. Fusion is achieved in a culture dish by applying an electric current. The change in electrical potential also mimics the normal events of fertilisation and initiates development. A key aspect in the success of nuclear transfer is synchronisation of the cell cycles between the donor nucleus and the egg. Before fertilisation, the egg's nucleus is quite inactive. The nucleus of the donor cell must also be made inactive otherwise it will not be reprogrammed and development will fail. Inactivation is achieved by culturing the cell but starving it of essential nutrients. The cell stops dividing and enters a quiescent state compatible with nuclear transfer. How is it used? Animal cloning has the potential to overcome the limitations of the normal breeding cycle. In the future, it may be used to produce elite herds by cloning the superior animals, or to rapidly produce herds of transgenic or otherwise modified animals. Transgenic farm animals make useful bioreactors, producing valuable proteins in their milk. Another application is the use of genetically-modified pigs as a source of organs suitable for transfer to humans (xenotransplantation). 110 xxxxxx 111 How is a specific gene isolated (CLONED)? Its like going to the library and looking for a specific book. It involves screening through a genomic library. A genomic library is a large collection of plasmids containing pieces of DNA from a specific species. The set of cloned fragments is so comprehensive that virtually the entire genome is represented in the library. The fragments that make up the library are initially generated by digesting genomic DNA (e.g. human) with a restriction enzyme- say EcoRI The EcoRI sites are randomly distributed in the genomefragments of varying lengths will be generated. Some fragments will contain one gene, others two genes or cut genes in half. A Gene1 Gene2 B C Gene3 D E F 112 A Gene1 Gene2 B C Gene3 D E F Each fragment is cloned into the plasmid, each plasmid is put (transformed) into E.coli C D A B 113 The library is random! Each fragment is cloned into the plasmid, each plasmid is put (transformed) into E.coli C D A B A Gene1 Gene2 B C Gene3 D E F 114 Fragments,bookmark, title The library is not bookmarked or even titled and is in fragments! There is no organization to the library. It is simply a populations of cloned fragments representing the entire genome. The equivalent of this would be if you went to the University Library to find all the books in a large heap, the books had no title, and in addition instead of entire books you often found parts of books. How do you use such a library? How do you find the book you are interested in. Lets work our way through this problem with a simple example Organism has EIGHT genes in its genome A B C D E F G H EcoRI 115 Genomic library If we wanted to study gene CCreate a restriction map of gene C Determine it sequence Study proteinC What do we need to do We need to initially clone the gene and make many copies of gene C Creating a genomic library provides a means of obtaining many copies of gene C To generate a genomic library: Total genomic DNA is isolated from the species of interest The DNA is cut with EcoRI A A B C D b E d b C d E F F G G H h h 116 Genomic library These genomic DNA fragments are mixed with a plasmid that has been linearized at a single EcoRI site (say pUC18) b d Ampr Ori F G h h d Ori Ampr C Ampr b E Ampr A Ori Ori Both the plasmid and genomic DNA have been cut with EcoRI, they have complementary sticky ends | G A A T T C C T T A A G | 117 Recombinant plasmid This process where foreign DNA is joined to plasmid DNA is called ligation It results in recombinant plasmid (foreign DNA+plasmid) Each plasmid has one foreign EcoRI fragment Each foreign fragment is still present as only one copy! This is not useful. A b d E F G h h b C d 118 How are genomic libraries used? If we are interested in studying gene C, you need the plasmid containing gene C Having a genomic library means you have gene C, but where is it? Which colony on the Petri dish contains gene C? Genomic libraries are much more complex than the one described for our hypothetical 8 gene organism You need to identify one recombinant plasmid out of 100,000’s present in a library. Identifying and isolating a specific plasmid is called screening a library. This requires a probe A probe is a sequence complementary to PART of the sequence one wishes to pull out. You radiolabel the probe and once labeled the probe is used to identify the plasmid containing E. coli colony How do we get the probe? 119 The genomic library and a specific probe enabled us to achieve two goals Out of the billions of base pairs in a large genome, we have been able to identify a few 1000 base pairs that correspond to a specific gene of interest. In addition we were able to isolate this sequence on a specifically engineered plasmid That allows us to make large quantities of this rare sequence. Genomic libraries are described in terms of average fragment size and the number of plasmids that must be screened to have the entire genome represented To have a good probability (>99%) of identifying a given DNA sequence (gene) present in the collection of plasmids (library). The number of plasmids (colonies) that must be screened is a function of the size of the genome of the species from which the Library was constructed. 120 xxxxxx 121