Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Regulation of gene expression Haixu Tang School of Informatics Genetic material are not lost Different Cell Types Synthesize Different Sets of Proteins • Many processes are common to all cells, and any two cells in a single organism therefore have many proteins in common. • Some proteins are abundant in the specialized cells in which they function and cannot be detected elsewhere, even by sensitive tests. Hemoglobin, for example, can be detected only in red blood cells. • Studies of the number of different mRNAs suggest that, at any one time, a typical human cell expresses approximately 10,000 20,000 of its approximately 30,000 genes • Although the differences in mRNAs among specialized cell types are striking, they nonetheless underestimate the full range of differences Gene Expression is regulated in Response to External Signals Switching devices for gene regulation • Short stretches of DNA of defined sequence (cis-elements) • gene regulatory proteins that recognize and bind to them (trans-factors) Base pairs in DNA can be recognized from their edges DNA conformation changes after protein binding Bacteria Yeast Drosophila Mammals lac repressor 5 AATTGTGAGCGGATAACAATT CAP TGTGAGTTAGCTCACT lambda repressor TATCACCGCCAGAGGTA Gal4 CGGAGGACTGTCCTCCG Mata2 CATGTAATT Gcn4 ATGACTCAT Kruppel AACGGGTTAA Bicoid GGGATTAGA Sp1 GGGCGG Oct-1 Pou domain ATGCAAAT GATA-1 TGATAG MyoD CAAATG p53 GGGCAAGTCT DNA binding on the major groove The DNA-binding helix-turn-helix motif Some helix-turn-helix DNAbinding proteins lambda Cro protein Hemeodomain Zinc fingers DNA binding by a zinc finger protein A dimer of the zinc finger domain b sheets Can Also Recognize DNA Leucine Zipper Heterodomain of Leucine zipper Dimerization of HTH A heterodimer composed of two homeodomain DNA-protein interaction DNA recognition code Gel-mobility assay DNA affinity chromatography Tryptophan switch Switch on/off Switch on/off by tryptophan binding Dual control of the lac operon Enhancers from distance Binding of two proteins to separate sites on the DNA double helix can greatly increase their probability of interacting Protein interaction in gene switch Gene control region for a eukaryotic gene The modular structure of a gene activator protein Transcriptional synergy Repressor Assembled complex The nonuniform space distribution Switching gene expression by DNA inversion in bacteria. Control of cell type in yeast Cassette model of yeast matingtype switching Speculative model for the heterochromatin A positive feedback loop Circadian clock Clustered genes coordinated by single protein Myogenic regulatory proteins in muscle development ey gene in precursor cells of the leg X-inactivation DNA methylation patterns are faithfully inherited Genome imprinting CG island An explanation of CG island Post transcriptional regulation Alternative splicing Negative and positive control of alternative RNA splicing Regulation of the site of RNA cleavage RNA editing in the mitochondria of trypanosomes Mechanism of A-to-I RNA editing in mammals Negative translational control The elF-2 cycle Translation initiation mRNA decay The competition between mRNA translation and mRNA decay Two posttranslational controls mediated by iron Nonsense mRNA decay