* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Genetic Code exercise
Survey
Document related concepts
Transcript
Using the Genetic Code Objective: Translate DNA codes to amino acid sequences of proteins. Reminder: * When transcribing the code into RNA, A in DNA goes with U in RNA, and T in DNA goes with A in RNA * The amino acids in the genetic code match the mRNA codons (not the anti-codons!). * The message is between the Start and Stop codons only! Part I: Going Step by Step Template Non-Template AACTACTTACC T TATACGATCTTTA TTGATGAATGGAATATGCTAGAAAT 1. Write the template DNA strand: _____________________________________________________ 2. Transcribe to mRNA: _________________________________________________ 3. Divide into codons: _____ _____ _____ _____ _____ _____ _____ _____ _____ 4. List the tRNA anticodons: (Not to be used in step 5!)_____ _____ _____ _____ _____ _____ _____ _____ _____ 5. Write the amino acid sequence of the protein, using the genetic code, and the CODONS of the mRNA: _______________________________________________ Notes: * Start = AUG. * Amino-acids: Use the first 3 letters. (Methionine = Met) 6. Check yourself: The first letters of the amino acids you put together make up a word. The word is: _______________________ Part II: Practice Skipping steps 1 and 4, repeat the process with the following DNA template strands: 1. AATCTACAGACGCGACTAGCAACGGATTCCC 2. TTCTACCGCTACTAGACATAATCAGGGTAGAGACTAACT 3. CGGTTACTCATACCTAAATTTTATTCCGTGCC Written by: Michal Danin-Kreiselman, Ph.D.