* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Protein Synthesis
Survey
Document related concepts
Transcript
Starter • Read 11.4 ▫ Answer concept checks 2-4 Starter • Read page 236 in a book from the back • Compare and contrast DNA and RNA • Define transcription, translation, and codon RNA vs DNA • DNA – deoxyribose • RNA – ribose RNA vs DNA • RNA ▫ A-U ▫ G-C • DNA ▫ A-T ▫ G-C • RNA is single stranded • DNA is double stranded Protein Synthesis Protein Synthesis • Creating proteins • Most complex construction in the cell • Numerous molecules and energy ▫ Single gene encodes the information for a single protein GENE = Section of DNA that codes for a protein. • DNA RNA Proteins Transcription – Step 1 of Protein Synthesis • DNA transcribed into mRNA 1. Enzyme unwinds DNA 2. mRNA gets constructed Enzyme bonds the RNA nucleotides together using the DNA gene as its template 3. mRNA leaves the DNA strand and nucleus Goes to the cytoplasm 4. DNA reforms with its hydrogen bonds • Read Page 238 ▫ Answer question 1 on page 241 • Go through transcription using the bold and underlined sequence as your gene sequence. 3’ – TACGGCCCCTAATGCAAAATT – 5’ 5’ – ATGCCGGGGATTACGTTTTAA – 3’ 3’ – TACAATGTTACCTGCGTCACT – 5’ 5’ – ATGTTACAATGGACGCAGTGA – 3’ Starter • Explain transcription. Translation – Step 2 of protein synthesis 1. Ribosome attaches to the mRNA in the cytoplasm mRNA divided into codons These codons are sections of 3 mRNA nucleotides ▫They code for a protein by: ▫ Determining the order of specific amino acids ◦ tRNA reads mRNA Codon by codon tRNA • Decodes mRNA to proteins • One end forms base pairs with mRNA ▫ Anticodon • Opposite end ▫ Site for AA Translation – Step 2 of protein synthesis – after the ribosome is attached 2. Initiation ▫ Start codon (AUG) 3. Elongation ▫ Amino acids are being added to each other Codon by codon 4. Termination ▫ mRNA has stop codon ▫ No AA • Protein is complete Assignment • Read Pages 239-241 ▫ Ignore the top of the page (Editing RNA) ▫ Answer concept Checks 3 and 4. ▫ Write down a question about something you don’t understand with protein synthesis. Go through transcription and translation of the following sequences: 3’ – TACGGCCCCTAATGCAAAATT – 5’ 5’ – ATGCCGGGGATTACGTTTTAA – 3’ 3’ – TACAATGTTACCTGCGTCACT – 5’ 5’ – ATGTTACAATGGACGCAGTGA – 3’ Answers mRNA AUGCCGGGGAUUACGUUUUAA AA sequence MET – PRO – GLY – ILE – THR – PHE – STOP mRNA AUGUUACAAUGGACGCAGUGA AA sequence MET – LEU – GLN – TRP – THR – GLN - STOP Your turn. Go through transcription and translation with the following DNA sequences. 3’ – TACGGCCCCTAATGCAAAATT – 5’ 5’ – ATGCCGGGGATTACGTTTTAA – 3’ 3’ – TACAATGTTACCTGCGTCACT – 5’ 5’ – ATGTTACAATGGACGCAGTGA – 3’