Download Mutations in genes

Genetics:
Gene Mutations and DNA Repair
INTRODUCTION

The term mutation refers to a heritable change
in the genetic material

Mutations provide allelic variations

On the positive side, mutations are the foundation
for evolutionary change


E.g. Light skin in high latitude human populations
On the negative side, mutations are the cause of
many diseases

E.g. Hemophilia
DNA
Maintenance


Mutation rate are
extremely low
1 mutation out of 109
nucleotides per
generation
CONSEQUENCES OF MUTATIONS

Mutations can be divided into three main types

1. Chromosome mutations


2. Genome mutations


Changes in chromosome number
3. Single-gene mutations


Changes in chromosome structure
Relatively small changes in DNA structure that occur within
a particular gene
Type 3 will be discussed in this set of lecture notes
Gene Mutations Change the DNA Sequence

A point mutation is a change in a single base pair

It involves a base substitution
5’ AACGCTAGATC 3’
3’ TTGCGATCTAG 5’



5’ AACGCGAGATC 3’
3’ TTGCGCTCTAG 5’
A transition is a change of a pyrimidine (C, T) to
another pyrimidine or a purine (A, G) to another purine
A transversion is a change of a pyrimidine to a purine
or vice versa
Transitions are more common than transversions
Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.
© Phototake/Alamy
Normal red blood cells
© Phototake/Alamy
10 μm
Sickled red blood cells
10 μm
(a) Micrographs of red blood cells
NORMAL : NH2 – VALINE – HISTIDINE – LEUCINE – THREONINE – PROLINE – GLUTAMIC ACID – GLUTAMIC ACID...
SICKLE
: NH2 – VALINE – HISTIDINE – LEUCINE – THREONINE – PROLINE – VALINE– GLUTAMIC ACID...
CELL
(b) A comparison of the amino acid sequence between normal b-globin and sickle-cell b-globin
7

Mutations may also involve the addition or
deletion of short sequences of DNA
5’ AACGCTAGATC 3’
3’ TTGCGATCTAG 5’
5’ AACGCTC 3’
3’ TTGCGAG 5’
Deletion of four base pairs
5’ AACGCTAGATC 3’
3’ TTGCGATCTAG 5’
5’ AACAGTCGCTAGATC 3’
3’ TTGTCAGCGATCTAG 5’
Addition of four base pairs
Gene Mutations Can Alter the Coding Sequence
Within a Gene

Mutations in the coding sequence of a structural
gene can have various effects on the polypeptide

Silent mutations are those base substitutions that
do not alter the amino acid sequence of the
polypeptide



Due to the degeneracy of the genetic code
E.g. AUU to AUC still codes for Ile
Missense mutations are those base substitutions in
which an amino acid change does occur


Example: Sickle-cell anemia
If the substituted amino acid does not affect protein
function (as measured by phenotype), the mutation is said
to be neutral

Nonsense mutations are those base substitutions that
change a normal codon to a termination codon

Frameshift mutations involve the addition or deletion of
nucleotides in multiples of one or two

This shifts the reading frame so that a completely
different amino acid sequence occurs downstream
from the mutation
Gene Mutations and Their Effects on
Genotype and Phenotype


In a natural population, the wild-type is the
most common genotype (may be encoded by a
dominant or recessive allele)
A forward mutation changes the wild-type
genotype into some new variation



If it is beneficial, it may move evolution forward
Otherwise, it will be probably eliminated from a
population
A reverse mutation has the opposite effect

It is also termed a reversion (changes mutant back to
wild-type)

Mutations can also be described based on their
effects on the wild-type phenotype


When a mutation alters an organism’s phenotypic
characteristics, it is said to be a variant
Variants are often characterized by their differential
ability to survive

Deleterious mutations decrease the chances of survival




The most extreme are lethal mutations
E.g. Homozygous polydactyly in cats
Beneficial mutations enhance the survival or
reproductive success of an organism
Some mutations are called conditional mutants

They affect the phenotype only under a defined set of
conditions (such as temp affecting wild type and
mutant bacteria)

A second mutation will sometimes affect the
phenotypic expression of another

These second-site mutations are called
suppressor mutations or simply suppressors

Suppressor mutations are classified into two
types

Intragenic suppressors


The second mutant site is within the same gene as the first
mutation
Intergenic suppressors

The second mutant site is in a different gene from the first
mutation

It may make it revert to normal
(wild-type) or add more mutations
Researchers showed that mutations
caused by either a single base insertion (+)
or a single base deletion (-) could be
“suppressed” or restored by a second
mutation of the opposite sign, as long as
the two mutations occurred in the same
vicinity of the gene.
Gene Mutations in Non-coding Sequences

These mutations can still affect gene expression

A mutation, may alter the sequence within a promoter

Up promoter mutations make the promoter more like the
consensus sequence


Down promoter mutations make the promoter less like the
consensus sequence



They may increase the rate of transcription
They may decrease the rate of transcription
Probably responsible for most differences between closely-related
organisms (e.g. humans and chimps)
A mutation can also alter splice junctions in
eukaryotes
(3'-UTR) is the section of
messenger RNA (mRNA) that
immediately follows the
translation termination codon.
Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display
16-13
Mutations Due to Trinucleotide Repeats

Several human genetic diseases are caused by
an unusual form of mutation called trinucleotide
repeat expansion (TNRE)

The term refers to the phenomenon that a sequence of
3 nucleotides can increase from one generation to the
next


These diseases include


Huntington disease (HD)
Fragile X syndrome (FRAXA)
Fragile X Syndrome – most common cause
of genetic mental retardation

Certain regions of the chromosome contain
trinucleotide sequences repeated in tandem


In normal individuals, these sequences are
transmitted from parent to offspring without mutation
However, in persons with TRNE disorders, the length of a
trinucleotide repeat increases above a certain critical size
It also becomes prone to frequent expansion
 This phenomenon is shown here with the trinucleotide
repeat CAG
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG

n = 11
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
n = 18
Genetic Anticipation

Analysis of the rare families in which TNRE
diseases occur has revealed that expansion of
the triplet repeats is linked to something called
genetic anticipation when a disease’s symptoms
appear earlier and more severely in each
successive generation.

In some cases, the expansion is within the
coding sequence of the gene


Typically the trinucleotide expansion is CAG
(glutamine)
Therefore, the encoded protein will contain long tracks
of glutamine



This causes the proteins to aggregate with each other
This aggregation is correlated with the progression of the
disease
In other cases, the expansions are located in
noncoding regions of genes

These expansions are hypothesized to cause
abnormal changes in RNA structure

Thereby producing disease symptoms
Changes in Chromosome Structure Can Affect
Gene Expression


A chromosomal rearrangement may affect a gene
because the break occurred in the gene itself
A gene may be left intact, but its expression may
be altered because of its new location


This is termed a position effect
Movement may be next to a regulatory sequence or into
into a heterochromatic region and now expressed.
Regulatory sequences
are often bidirectional
Mutations Can Occur in Germ-Line or Somatic
Cells

Geneticists classify the animal cells into two types

Germ-line cells


Somatic cells



Cells that give rise to gametes such as eggs and sperm
All other cells
Germ-line mutations are those that occur directly in a
sperm or egg cell, or in one of their precursor
Somatic mutations are those that occur directly in a
body cell, or in one of its precursor cells
The size of the patch
will depend on the
timing of the mutation
The earlier the mutation,
the larger the patch
An individual who has
somatic regions that are
genotypically different
from each other is called
a genetic mosaic
Therefore, the
mutation can be
passed on to future
generations
Figure 16.4
Therefore, the mutation cannot be
passed on to future generations
OCCURRENCE AND CAUSES OF MUTATION

Mutations can occur spontaneously or be induced

Spontaneous mutations

Result from abnormalities in cellular/biological processes


Induced mutations


Caused by environmental agents
Agents that are known to alter DNA structure are termed
mutagens


Errors in DNA replication, for example
These can be chemical or physical agents
Refer to Table 16.4
Mutation Rates and Frequencies


The mutation frequency for a gene is
the number of mutant genes divided
by the total number of genes in a
population.
Ex – if 1 million bacteria were plated and
10 were mutant, the mutation frequency
would be I in 100,000 or 10-5
Mutation frequency also
depends on


Timing of the mutation
Likelihood that the mutation will
be passed on to future generations
Mutation rate

In genetics, the mutation rate is a
measure of the rate at which
various types of mutations occur
over time. Mutation rates are
typically given for a specific class
of mutation, for instance point
mutations, small or large scale
insertions or deletions.
Spontaneous Mutations Are Random Events

Are mutations spontaneous occurrences or
causally related to environmental conditions?

This is a question that biologists have asked
themselves for a long time 

Jean Baptiste Lamarck


Proposed that physiological events (e.g. use and disuse)
determine whether traits are passed along to offspring
Charles Darwin

Proposed that genetic variation occurs by chance

Natural selection results in better-adapted organisms
Random Mutations Can Give an
Organism a Survival Advantage

Directed mutation theory

Selected conditions could promote the formation of specific
mutations allowing the organism to survive


This was consistent with Lamarck’s viewpoint
Random mutation theory – most widely accepted

Environmental factors simply select for the survival of those
individuals that happen to possess beneficial mutations

This was consistent with Darwin’s viewpoint
Causes of Spontaneous Mutations

Spontaneous mutations can arise by three
types of chemical changes

1. Depurination

2. Deamination

3. Tautomeric shift
The most common
Causes of Spontaneous Mutations

Depurination involves the removal of a purine
(guanine or adenine) from the DNA

The covalent bond between deoxyribose and a
purine base is somewhat unstable


It occasionally undergoes a spontaneous reaction with
water that releases the base from the sugar
Fortunately, these can be repaired

However, if the repair system fails, a mutation may result
during subsequent rounds of DNA replication
Three out of four (A, T and G)
are the incorrect nucleotide
There’s a 75% chance
of a mutation
Spontaneous depurination

Deamination involves the removal of an amino
group from the cytosine base


The other bases are not readily deaminated
DNA repair enzymes can recognize uracil as an
inappropriate base in DNA and remove it

However, if the repair system fails, a C-G to A-T mutation will
result during subsequent rounds of DNA replication

Deamination of 5-methyl cytosine can also occur

Thymine is a normal constituent of DNA
This poses a problem for repair enzymes



They cannot determine which of the two bases on the two DNA
strands is the incorrect base
For this reason, methylated cytosine bases tend to
create hot spots for mutation

A tautomeric shift involves a temporary change
in base structure

These rare forms promote AC and GT base pairs

For a tautomeric shift to cause a mutation it must
occur immediately prior to DNA replication
Common
Figure 16.10
Rare
Temporary
tautomeric shift
Shifted back to
its normal fom
16-42
Types of Mutagens


An enormous array of agents can act as
mutagens to permanently alter the structure of
DNA
The public is concerned about mutagens for
two main reasons:



1. Somatic mutagens are often involved in the
development of human cancers
2. Germ-line mutations may have harmful effects in
future generations
Mutagenic agents are usually classified as
chemical or physical mutagens
Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display
16-53

Nonionizing radiation





Includes UV light
Has less energy
Cannot penetrate deeply
into biological molecules
Causes the formation of
cross-linked thymine
dimers
Thymine dimers may
cause mutations when
that DNA strand is
replicated
Damage from X-rays




Causes base deletions
Single nicks in DNA molecule
Cross-linking
Chromosomal breaks
DNA Repair



All species have a variety of DNA
repair systems to avoid the harmful
effects of mutations.
Excision repair recognizes and
removes a damaged base or damaged
segments of DNA.
Base mismatch repair recognizes a
base mismatch and removes a
segment of the DNA strand with the
incorrect base.
Mismatch Repair
DNA polymerase replaces missing or
damaged bases.
Excision Repair
Please note that due to differing
operating systems, some animations
will not appear until the presentation is
viewed in Presentation Mode (Slide
Show view). You may see blank slides
in the “Normal” or “Slide Sorter” views.
All animations will appear after viewing
in Presentation Mode and playing each
animation. Most animations will require
the latest version of the Flash Player,
which is available at
http://get.adobe.com/flashplayer.
57
Xeroderma pigmentosum, or XP, is an autosomal
recessive genetic disorder of DNA repair in which the
ability to repair damage caused by ultraviolet (UV)
light is deficient.
The absorption of the highenergy light leads to the
formation of pyrimidine dimers
photoproducts. In a healthy,
normal human being, the
damage is first excised by
endonucleases. DNA polymerase
then repairs the missing
sequence, and ligase "seals" the
transaction. This process is
known as nucleotide excision
repair.
Symptoms include:
 Severe sunburn when exposed to only small amounts
of sunlight. These often occur during a child's first
exposure to sunlight.
 Development of many freckles at an early age
 Rough-surfaced growths and skin cancers
 Eyes that are painfully sensitive to the sun and may
easily become irritated, bloodshot and clouded
 Blistering or freckling on minimum sun exposure
 Spider Veins
 Limited growth of hair on chest and legs
 Scaly skin
 Dry skin
 Irregular dark spots on the skin
 Corneal ulcerations
Mutant Hemoglobin Lab
EPIGENETICS
http://www.pbs.org/wgbh/nova/body/epigenet
ics.html
https://www.youtube.com/watch?v=9AfB
sTAQ8zs&edufilter=ITEV1GgfY7rUuGxSyy
0SA
Epigenetics
Epigenetic Research

The number of
publications in the
field has increased
dramatically in the
last 10 years.
•
Genetic Engineering and Biotechnology
News Feb 1, 2013 (Vol. 33, No. 3)
Epigenetic Effects


The effects of epigenetics have been known
for many years.
Lyon Hypothesis from 1961.

Renamed the Lyon Law in 2011.

Inactive X chromosome is
heavily epigenetically modified.
Another Familiar Epigenetic Case:
Genomic imprinting
 Ex - Chromosome 15 imprinting

Prader-Willi Syndrome

Angelman Syndrome


This is, the offspring cell distinguishes
between the maternally and the paternally
inherited allele by means of the different
methylation patterns.
Thus, the phenotype of the offspring depends
on the sex of the parent who has inherited an
imprinted allele due to promoter inhibition of
one allele by DNA-methylation.

Imprinting is not the cause of these
syndromes but is responsible for the unique
presentation of these diseases.


Genomic imprinting is probably responsible for
hereditary defects caused by in-vitro fertilization and
cloning of mammals (e.g. "Dolly" born with a vast
burden of false epigenetic information due to sole
maternal imprinting).
Children born after conception with the help of
"Assisted Reproductive Technologies" (ARTs) showed
significant lower birth weight, a higher incidence of
juvenile cancer and an increased frequency of
Beckwith-Wiedemann and Angelman syndrome,
respectively (Schieve et al., Obstet. Gynecol 2004;
Gosden et al., Lancet 2003; Niemetz and Feinberg Am J
Hum Genet 2004).


Importantly, X-inactivation and
genomic imprinting are normal
processes.
Much of the recent research has
analyzed when the process of
epigenetics is altered from normal.


This has involved the study of changes
within somatic cells in disease.
It has also involved the study of changes
within the germ cells (heritable
epigenetics).
Heritable Epigenetics

Evidence suggests that environmental
information could be propagated through
meiosis.
Överkalix Study


Retrospective study conducted
in Överkalix, Sweden.
Divided population into three
cohorts:
Born
1890
•
Born
1905
Born
1920
Assessed each cohort for access to food during slow
growth period (SGP) of adolescence (8-10 girls, 9-12
boys).
Överkalix Study Results



When the father was exposed to a
famine during his SGP, his offspring
exhibited protection against
cardiovascular causes of death.
Paternal grandmother exposure to
famine also showed a trend towards
similar protection in grandchildren.
If the paternal grandfather lived
through a famine during his SGP it
tended to protect grandchildren from
diabetes.



If the paternal grandfather had an
abundance of food during their SGP,
their grandchildren had a four-fold
increased risk for death of diabetes
mellitus.
One mechanism to explain these
results is transmission of epigenetic
markers that were influenced by the
environment of the parent.
Effect on grandchildren suggests
the markers are maintained
through multiple generations.
Lamarkism?

Jean Batiste Lamark (1744-1829)

Inheritance of acquired characteristics.

Largely discounted with
Darwin’s publication of
Origin of Species and the
rediscovery of work of
Mendel.

Recent work in
epigenetics suggest
Larmark may have been
correct to some degree.
Molecular Basis of Epigenetics
Two primary mechanisms
identified.



Methylation of cytosine
nucleotides in DNA
Modification to histone
proteins.
Includes acetylation,
methylation and
phosphorylation
A third proposed
mechanism involves
expression of small
interfering RNAs (siRNA).


Cytosine Methylation

Methylation of cytosine
occurs at CpG dinucleotides.


Often located just upstream of
genes (promoter regions).
Associated with attenuation of
expression of nearby genes.
Histone Modification



Histones are the proteins that organize the genetic
material.
Have a high percentage of basic amino acids, which
gives histones an overall positive charge.
Positively charged amino acids associate with the
overall negative charge of the DNA.
Histone Modification



Most histone modification occurs on the extended
tails of histone proteins.
Modifications influence the association of histones
with the DNA and patterns of gene expression.
Best studied modification is histone acetylation.
Epigenetic Errors

Fragile X syndrome is most commonly caused by a CGG
trinucleotide repeat expansion in the 5’ region of the
FMR1 gene.

Unaffected individuals have 6-50 CGG repeats.

>200 CGG repeats is seen
in individuals with fragile X.

>200 CGG repeats is
correlated with
hypermethylation at CpG
dinucleotides and silencing
of the FMR1 gene.
Epigenetics and Cancer





DNA repair is a critical process to maintain
genomic fidelity.
Loss of DNA repair is thought to be a major
contributor to the development of cancer.
Epigenetic changes involving DNA repair
genes are thought to be a major early step
in cancer progression.
~13% of sporadic breast cancers and 5-30% of
ovarian cancers present with hypermethylation of
the BRCA1 gene.
40-90% of sporadic colorectal cancer has
hypermethylation of the MGMT gene (O6methylguanine methyltransferase).
Therapies Targeting
Epigenetic Errors


In contrast to mutations, epigenetic changes can be
reversed.
Are there therapies that influence epigenetic patterns?

Vorinostat (trade name Zolinza)
approved by FDA for cutaneous T cell
lymphoma in 2006.



Yes
Vorinostat is a histone deacetylase
inhibitor.
⬆ acetylation = ⬆gene expression.
X
Our Epigenome

If epigenetic markers are dynamic and respond to
environmental influences, do they change over time?


Evidence suggests the answer is yes.
Twin studies have been highly informative for this question.
Yellow tags same; green and red different tags.
Epigenomic Alterations




If the epigenome changes as we age, what kinds of things
can induce these changes?
Very active area of current research.
Some interesting findings:
Fear conditioning induces
changes in DNA methylation
in rat brains.



In rats, social deprivation during the 1st
postnatal week triggers changes in DNA
methylation across the gene that stimulates
neuron development.
Studies with cocaine exposure suggest that the
drug induces acetylation of the BDNF gene
histones that is transmittable to future male
offspring.
Smoking
Nicotine causes epigenetic changes
in mice that spur cocaine addiction
What’s the News: Epidemiologists have long
noticed that people with drug addictions
often start out smoking cigarettes before
moving on to harder stuff. Whether that’s
because there’s something about cigarettes
that makes people vulnerable to other drugs
or because certain kinds of people are
predisposed to addiction (or for some other
reason entirely) is an open question, and
the idea of so-called “gateway drugs” has
been a controversial topic in addiction for
years. Now, an elegant new study in mice has
discovered a mechanism that could explain
the gateway drug effect: nicotine actually
changes the expression of genes linked to
addiction. Read article below.
http://blogs.discovermagazine.com/80beats/2011/11/05/nicotinecauses-epigenetic-changes-in-mice-that-spur-cocaine-addiction/
Supplements in diet in the
mother
Lick your rats
http://learn.genetics.utah.edu/content/epigenetics/rats/