* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download RNA 1
DNA repair protein XRCC4 wikipedia , lookup
DNA profiling wikipedia , lookup
Homologous recombination wikipedia , lookup
DNA replication wikipedia , lookup
Microsatellite wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
DNA nanotechnology wikipedia , lookup
DNA polymerase wikipedia , lookup
RNA 1 Biology 9 Sumner High School So far... • DNA codes for genes which are the instructions for proteins. • All living things use the same code. • We know ribosomes are where proteins are made. Today’s question... • How do we get from gene to ribosome? • We need a messenger from the nucleus to the cytoplasm • We need a way to transfer the code into protein. RNA • RNA = ribonucleic acid • DNA = deoxyribonucleic acid • The RNA chain is also a polymer, with similarities to DNA. • But only a single strand (in most cases) • RNA has: • a sugar portion (plain ribose) • a phosphate group • a nitrogen base (3 same as DNA, but 1 different). Deoxyribose vs Ribose DNA vs. RNA Part DNA RNA Sugar deoxyribose ribose Phosphate Yes Yes Nitrogen bases ATGC AUGC double helix single strand Shape The four RNA bases are... • Adenine • Uracil • Guanine • Cytosine • The pairing is different between RNA and DNA Base pairing DNA Double Helix DNA to RNA Template Complement DNA Template A T A U T A T A G C G C C G C G RNA Lecture Question • • What is the relationship among DNA, a gene, and a chromosome? a) A chromosome contains hundreds of genes, which are composed of protein. b) A chromosome contains hundreds of genes, which are composed of DNA. c) A gene contains hundreds of chromosomes, which are composed of protein. d) A gene is composed of DNA, but there is no relationship to a chromosome. e) A gene contains hundreds of chromosomes, which are composed of DNA. Correct answer is b What job is the woman in the front of the picture doing? Preparing the message • What does it mean to “transcribe” something? • What does a “transcriptionist” do? • Keys about transcription • The “language” is the same (English) • The format of the message is different (spoken to written). Message in a Bottle • To start the process, an RNA copy of the DNA strand is made • This is called transcription • Transcription = creation of the message from nucleus to cytoplasm. • The form of RNA made is messenger RNA or mRNA. mRNA • A single strand of RNA • Formed from the template of one DNA strand • Process is governed by the enzyme RNA polymerase. mRNA Synthesis mRNA Synthesis • DNA template strand (the side of the DNA with the code) is read from the phosphate end. • mRNA strand made from the phosphate end as well. • DNA complement strand (DNA across from the template strand) is not used in making the mRNA. At the start codon... • Enzyme (RNA polymerase) attaches to DNA and “unzips” a short length. Moving along... • Enzyme moves down the DNA • New area “unzips” • mRNA bases added using the “rules.” • DNA “re-zips” when the enzyme moves past. mRNA Synthesis At the end... • Enzyme reaches a stop codon • New mRNA set free. • Enzyme leaves the DNA strand. Key Ideas • Transcription uses the same “language” • DNA codons copied to mRNA codons • Transcription makes a copy of the genetic info in another form. • DNA codons to mRNA codons • Same order, same meaning for which amino acid is added to the protein. Practice • Write the following DNA template strand on your paper: • [leave a line space] • TACATACACGGGAAATTCCCCTAGATT • [leave a line space] • Above this strand, make the opposite side of the DNA (complement strand). • Below, make the mRNA strand. Practice Answers •Complement DNA: ATGTATGTGCCCTTTAAGGGGATCTAA •Template DNA: TACATACACGGGAAATTCCCCTAGATT •Messager RNA: AUGUAUGUGCCCUUUAAGGGGAUCUAA