* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Protein Synthesis
Survey
Document related concepts
Transcript
DNA Complementary Practice 1. CATTAGCTGTACTTAAGCCT 2. TGCACTGAATGCCGGTTTAAATGC 3. ATCGGCATTGAATGCC 4. AATCTCCGCATTAGCT 5. TACATAAC DNA Complementary Practice 6. ACTGAATGCGATTCGTC 7. CCGGCACT 8. TACATAACTTTAAGT 9. CGAACTAGATAA 10. GTACGAGGAAAC Protein Synthesis What is protein synthesis? Is protein synthesis important? What is RNA? Where is RNA found? Is RNA similar to DNA? What is translation? What is Protein Synthesis? *Protein synthesis is the building of proteins following the instructions of DNA. *The instructions of DNA are written by the order of the bases. Example of instructions on DNA: A-G-A-T-C-T Why is Protein Synthesis Important? 1. Proteins make up the structure of an organism 2. Control all of the organism’s chemical reactions to keep it alive Examples of proteins: ligaments, hair, nails, muscles , bones and antibodies 3 examples of proteins Hemoglobin Elastin Collagen Protein Structure A protein is made up of a chain of AMINO ACIDS in a particular order, held together by PEPTIDE BONDS. Example of Protein: a chain of Amino Acids Alanine Phenylalanine Glutamine Valine Proline Lysine NAMES OF AMINO ACIDS Actual Sequence and names of AMINO ACIDS In Blood (Hemoglobin) Shapes of Proteins *the shape of a protein depends on its function & its order of amino acids. Where does protein synthesis occur? *The DNA never leaves the nucleus. *RNA copies the DNA in the nucleus. DNA in the nucleus is safe !! *RNA carries the instructions from DNA out to the ribosome. *The protein is built on the ribosome in the cytoplasm. DNA in the cytoplasm can be destroyed What is RNA? Full Name: Ribonucleic acid *It is the nucleic acid responsible for three things in protein synthesis: 1 – copying instructions from DNA 2 – carrying the instructions for making proteins to the ribosome 3 – putting the protein together on the ribosome What makes up RNA? Bases in RNA Sugar in RNA Ribose Strands in RNA “ONE” 3 Types of RNA 1. Messenger RNA (mRNA) 2. Transfer RNA (tRNA) 3. Ribosomal RNA (rRNA) mRNA tRNA rRNA Messenger RNA (mRNA) Function: 1. Goes into the nucleus and makes a copy of DNA using RNA bases. 2. Takes the copy to the ribosomes. 3. Contains the “CODON” (group of 3 bases on mRNA) Transfer RNA (tRNA) Function: 1. carries amino acids to mRNA at the ribosome to (make) the protein. 2. contains “ANTICODON” (3 bases that match up w/codon on mRNA) Ribosomal RNA (rRNA) Major structural part of the ribosome where protein synthesis occurs. Comparison of DNA and RNA Strands: *DNA* * RNA* 2 1 Sugar: deoxyribose A, G, C, T Bases: *Thymine (A – T) ribose A, G, C, U *Uracil (A – U) Steps in Protein Synthesis Step I – Transcription Step 2 – Translation: Step 1: Transcription Location: in the nucleus Purpose: to copy the DNA code (order of bases) onto mRNA. Events: 1.) DNA is unwound and DNA helicase unzips DNA strand. 2.) RNA polymerase reads the complementary base and adds the new nucleotides along the DNA strand. 3.) mRNA is made, leaves the nucleus to go to ribosome. FYI RNA polymerase Function: Enzyme that recognizes the complementary base of RNA to DNA, and glues them together. Examples: Guanine with Cytosine Adenine with Thymine *Uracil with Adenine Step 2: Translation Location: in the cytoplasm, on the ribosome. Purpose: to convert the instructions of RNA (order of bases) into amino acids, to make proteins. Step 2: Translation Events of translation: 1.) The first three bases of mRNA (codon) join the ribosome. AUG – is the start codon 2.) tRNA brings the amino acid down to the ribosome. The three bases on tRNA, or the anticodon, match the complementary bases on mRNA. Step 2: Translation … (final stage) Events of translation: 3.) Each tRNA has an AMINO ACID that is determined by its anticodon. Ex: codon (AUG) Amino Acid - methionine 4.) The amino acids are joined by polypeptide bonds. 5.) The resulting chain of amino acids are called a PROTEIN. Codons & Anticodons Codon – def: three nucleotides of mRNA. Start codon - AUG codons signals the start of a polypeptide chain STOP codons - UAA, UAG, UGA - all three of these codons signal the end of a polypeptide chain Codons Amino Acids *C U A - *G G C - *A A C - *U U A Leucine - Glycine - Asparagine - Leucine ANTICODON - segment of three bases on tRNA that are complementary to the mRNA codon. TRANSLATION & tRNA in pictures Practice with Amino Acids You are given this DNA sequence: TAC AGT GCC GAG GGA TCT AGG ATT GGA CAT What Amino Acids will it code for? DNA mRNA tRNA AA DNA mRNA tRNA AA TAC AUG UAC start 2. What are the amino acids for these codons: AUG _____________ CCU _____________ UGG _____________ AGU _____________ Animations • DNA Replication review • Transcription & Translation • http://www.wisconline.com/objects/ViewObject.aspx?ID=a p1302