* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download RNA notes 2015 - OG
Bottromycin wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Cell-penetrating peptide wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
RNA silencing wikipedia , lookup
Community fingerprinting wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Polyadenylation wikipedia , lookup
Molecular cloning wikipedia , lookup
Transcriptional regulation wikipedia , lookup
List of types of proteins wikipedia , lookup
Non-coding DNA wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Molecular evolution wikipedia , lookup
Biochemistry wikipedia , lookup
Non-coding RNA wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Messenger RNA wikipedia , lookup
Gene expression wikipedia , lookup
Expanded genetic code wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Genetic code wikipedia , lookup
AMINO ACID tRNA ANTICODON CODON mRNA Protein Examples Hemoglobin is a protein in your blood that transports oxygen Collagen is a proteins that makes your cartilage and tendons Keratin is a protein that makes up your hair & fingernails Enzymes that break down your food are proteins Everything in you is made of or by proteins! DNA is like a code that instructs the cell to make proteins A gene is a sequence of DNA that carries the code for making one protein RNA is like DNA except… DNA – Deoxyribonucleic acid RNA – Ribonucleic Acid * 2 strands vs. 1 strand Nitrogen Bases * Thymine vs. Uracil (others are the same) Sugars & Phosphates * Deoxyribose vs. Ribose * Nucleus vs. Cytoplasm RNA DNA Types of RNA 1. mRNA – “messenger” RNA - Carries copies of instructions from DNA for making amino acids into proteins 2. tRNA – “transfer” RNA - Transfers each amino acid to the ribosome as specified by the code on mRNA 3. rRNA – “ribosomal” RNA - Makes up part of the ribosome, where proteins are made • Both DNA and RNA are involved in protein synthesis 2 parts of protein synthesis: 1. Transcription – DNA is converted to RNA - Occurs in the nucleus 2. Translation – RNA is converted to a protein - Occurs in the cytoplasm • Transcription (the 1st part of Protein Synthesis) • Converts DNA to RNA • DNA (in the nucleus) needs to send a code to the ribosome (in the cytoplasm) • Problem: DNA can’t fit through the nuclear pores • A special “messenger” is used to copy and carry the code… Transcription Cont’d • messenger RNA (mRNA) goes into the nucleus and copies the DNA • Uses enzyme – RNA Polymerase • DNA AGGTATCGCAGATCGACAGATC •RNA UCCAUAGCGUCUAGCUGUCUAG • The next step is that mRNA moves from the nucleus to the cytoplasm and to the ribosome nd (2 Translation part of protein synthesis) • Amino acids – building blocks of proteins, carried to ribosomes by ______________ tRNA Amino Acids • Polypeptides – long chains of ____________ 3 nucleotide bases in mRNA which • Codon – group of ____ carries code for making _______________________ ONE amino acid • Ex: AUG - Methionine 3 • Anticodon – group of _____ nucleotide bases in tRNA codon which is complementary to one ___________________ Translation Cont’d • mRNA ____________ attaches to the ribosome • tRNA ____________ carries amino acids to the ribosome and matches them to the coded mRNA message (codon) • Amino acids bond together, forming a long Polypeptide chain chain called a ____________________ • Finally, polypeptides fold into various types of proteins and there you have it! Translation (the 2nd part of Protein Synthesis) • Translation – a process that converts mRNA into a protein • Occurs on the ribosome in the cytoplasm of a cell • ______________ - building blocks of proteins; join together Amino acids into long chains called polypeptides Codon • ____________ - a sequence of 3 bases on mRNA that codes for a single amino acid Anticodon • _____________ – sequence of 3 bases on tRNA that is complementary to one mRNA codon “UCU” is the codon that makes an amino acid called SERINE • Another form of RNA called transfer RNA (tRNA) carries amino acids to the ribosome and matches them to the coded mRNA message •The tRNA lines up with 3 bases in mRNA (codon) •tRNA anticodon GAA •mRNA codon CUU •tRNA drops off the amino acid in the correct spot mRNA attaches to the ribosome AMINO ACID tRNA ANTICODON CODON mRNA Any change in the DNA structure (specifically the order of nitrogen bases) is a mutation. Mutations can be helpful, harmful, or neutral. Helpful – can create diversity in a population Harmful – can cause things like cancer Neutral – can have absolutely no effect at all A mutagen is something that causes mutations in the DNA (for example: smoking, radiation from the sun etc) Slooze Worm An insertion mutation is when a nitrogen base is added to the existing DNA A deletion mutation is when a nitrogen base is subtracted from the DNA A substitution mutation is when one nitrogen base is put in place of another. If our DNA was AATTGGCC An insertion would be AATTAGGCC A deletion would be AATGGCC A substitution would be AAATGGCC Gene Sequencing – Determining the order of nucleotide bases within a gene DNA Fingerprinting – technique used in criminal investigations. DNA Fingerprinting takes the DNA out of a cell and separates it. This will allow investigators to distinguish body cells of different individuals (since they are unlikely to have the same DNA) Cloning – take the DNA out of one of your cells then take the DNA out of a zygote (fertilized egg). Put the DNA from your cell into the zygote. Genetic engineering is the process of moving genes from the chromosomes of one organism to those of another organism. Recombinant DNA is formed by joining DNA molecules.from two different organisms What would represent the strand of DNA from which the mRNA strand in the diagram was made? A.CUCAAGUGCUUCB.GAGUUCACGAAG C.GAGTTCACGAAGD.AGACCTGTAGGA What is the amino acid sequence in the portion of the protein molecule coded for by the piece of mRNA shown in the diagram? A. Ser-Tyr-Arg-GlyB.Leu-Lys-Cys-PheC.Val-Asp-Pro-HisD.Pro-GluLeu-Val