* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download dna
Designer baby wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Holliday junction wikipedia , lookup
Polyadenylation wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Genomic library wikipedia , lookup
DNA profiling wikipedia , lookup
RNA silencing wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
SNP genotyping wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Microevolution wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
DNA vaccination wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Epitranscriptome wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Point mutation wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
DNA replication wikipedia , lookup
Molecular cloning wikipedia , lookup
Non-coding RNA wikipedia , lookup
History of RNA biology wikipedia , lookup
DNA nanotechnology wikipedia , lookup
DNA polymerase wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Epigenomics wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
History of genetic engineering wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Non-coding DNA wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
DNA supercoil wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Helitron (biology) wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Primary transcript wikipedia , lookup
Nucleic Acids: DNA, RNAand Genes Mr. Lowell Tuesday, May 23, 2017 Nucleic Acids: DNA and RNA What is DNA Deoxyribonucleic Acid A complex linear molecule that contains the information for the production of proteins that control the cell. Its general shape is a long “double helix” or “twisted ladder” shape A polynucleotide - polymers of nucleotides Nucleotides Three major Components: •Nitrogen containing bases •Purines - Adenine and Guanine (Double ring structure) •Pyrimidines - Cytosine, Thymine (only in DNA), Uricil (only in RNA) •Sugar •Ribose in RNA or Deoxyribose in DNA •Phosphate DNA Structure 6 DNA Nucleotides DNA Nucleotides Removed when added to DNA chain DNA Nucleotides Phosphate DNA Nucleotides Base DNA Nucleotides 10 Nucleotides Adenine Thymine Guanine Cytosine Nucleotides Adenine Guanine Purines - Have a double Ring Structure Thymine Cytosine Pyrimidines Single Ring Structure Adenine 13 Guanine 14 Thymine 15 Cytosine 16 Uricil, found in RNA 17 18 The Sugars and their differences: 19 Deoxyribose with labeled carbon atoms: 20 Nucleotide Pairing In DNA Adenine is always paired with Thymine Guanine is always paired with Cytosine DNA: Paired Nucleic Acids Adenine to Thymine 22 DNA: Paired Nucleic Acids Cytosine to Guanine 23 A DNA Sequence: ACTTGGAACGATTGCCGTATGCT TGAACCTTGCTAACGGCATACGA Period 4 starts here REPLICATION OKAZAKI FRAGMENTS Steps in Replication 1. A section of the DNA is separated by a protein enzyme called a HELICASE and forms a replication fork. Steps in Replication 2. A molecule of DNA POLYMERASE binds to one of the strands of DNA and begins to move in the 3’ to 5’ direction along it. This produces a new strand of DNA that is called the LEADING STRAND. DNA in the leading strand is synthesized in the 5’ to 3’ direction which is the ONLY way new DNA can be synthesized. Steps in Replication 3. A second type of DNA Polymerase binds to the other original strand of DNA. Since the DNA on this second strand runs the opposite direction from the leading strand the DNA that is synthesized on this LAGGING strand is created in the opposite direction from the first. Replication Because of the direction of travel the polymerase the DNA is created in short pieces called OKASAKI FRAGMENTS. Another enzyme called a DNA LIGASE takes these fragments and puts them together into what is called the LAGGING STRAND. Period 2 starts here Replication of DNA 24 Speed of Replication Prokaryotes have a single circular strand of DNA to replicate. This takes about 40 minutes. R Speed of Replication Eukaryotes if their DNA was done by one polymerase molecule per chromosome would take about a month for the DNA to replicate. Multiple polymerase latch on the the replicating DNA simultaneously and as a result replication in humans takes about an hour. R For more on Replication see: http://www.ultranet.com/~jkimba ll/BiologyPages/D/DNAReplicati on.html Split Genes Eukaryotic genes contain large amounts of non-functional DNA. These sections of DNA that are not part of the coding for a gene are referred to as INTRONS for intervening sequences More on this in the RNA transcription section Exons These are sections of the DNA that actually code for the proteins of a gene. The DNA for a single gene is often not contiguous but rather split into sections of exons separated by introns Central Dogma RNA Single stranded nucleic acid Sugar in the nucleotide is RIBOSE not deoxyribose Uracil replaces Thymine in the base pairs. Memory device: Gene Expression in Eukarotic Cells (For more information on gene expression in prokaryotic cells see: Transcription and Translation in Prokaryotes by Dr. John W. Kimball) Types of RNA Messenger RNA mRNA Ribosomal RNA rRNA Transfer RNA tRNA Small Nuclear RNA snRNA Small Nucleolar RNA snoRNA Micro RNA miRNA RNA is produced by a process known as : Transcription Transcription Steps 1. Protein Transcription factors bind to a DNA strand 2. An RNA Polymerase binds to the transcription factors 3. The DNA is opened up Transcription 4. The polymerase moves down one of the DNA strands in the 3’ to 5’ direction. 5. It assembles RIBONUCLEOTIDES into stand of RNA 6. These nucleotides are inserted using rules for similar to DNA EXCEPT that in place of Thymine the nucleotide URICIL is used Transcription At some point the end of the RNA molecule is reached and the polymerase and the RNA strand are released from the DNA into the nucleus. The DNA then goes back to its stable double helix form. 32 AND then... The transcribed RNA may be fully functional or it may need to be processed before it can be functional. mRNA must be processed and the unneeded intron areas removed. More on Transcription at: http://www.ultranet.com/~jkimba ll/BiologyPages/T/Transcription. html Translation Central Dogma Graphic R Transfer RNA tRNA Anticodon Messenger RNA Long strands of RNA that contain the codes for the proteins that will be produced by a gene. These codes are in sets of 3 nucleotides and are called CODONS. Translation Steps: The light or smaller sub unit of the ribosome binds to the mRNA strand. Translation Steps It moves along the strand until it reaches a “start” codon - AUG. At this point it is joined by the large or Heavy subunit and a special tRNA that is known as the initiator tRNA that in eukarotic cells carries the Methionine amino acid Steps continued There are three sites in the large ribosomal unit called the A SITE, the P SITE, and the EXIT SITE were tRNA bind temporarily, deliver their amino acid and then bind it to the growing polypeptide chain. Steps continued tRNA enter at the A site binding to a codon with their anticodon. They then slide over to the P site where their amino acid is bound to the polypeptide chain and finally they slide into the Exit site and are release back out into the cytoplasm Steps continued Steps continued The process continues until a stop codon is reached. UAA UGA UAG Steps continued Steps continued Most of the graphics in this presentation come from: http://www.sbc.edu.hk/bio/pic4we b/dna/page_01.htm or http://www.nbif.org/products/clip art/clipart.php#ca-molecular End of Show Return to start