* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Controlling Gene Expression in Bacteria
X-inactivation wikipedia , lookup
Transcription factor wikipedia , lookup
Genome evolution wikipedia , lookup
Bottromycin wikipedia , lookup
Secreted frizzled-related protein 1 wikipedia , lookup
Genomic imprinting wikipedia , lookup
Molecular evolution wikipedia , lookup
Ridge (biology) wikipedia , lookup
Non-coding DNA wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Gene regulatory network wikipedia , lookup
Gene expression profiling wikipedia , lookup
RNA interference wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Polyadenylation wikipedia , lookup
RNA silencing wikipedia , lookup
Messenger RNA wikipedia , lookup
Promoter (genetics) wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Gene expression wikipedia , lookup
Non-coding RNA wikipedia , lookup
Epitranscriptome wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Ecclesiastes 3:1, 17 1 To every thing there is a season, and a time to every purpose under the heaven: 17 I said in mine heart, God shall judge the righteous and the wicked: for there is a time there for every purpose and for every work. ©2000 Timothy G. Standish Controlling Gene Expression: Bacteria Timothy G. Standish, Ph. D. ©2000 Timothy G. Standish All Genes Can’t be Expressed At The Same Time Some genes are needed for the function of all cells all the time. These continually expressed genes are called constitutive genes. Other genes are only needed by certain cells or at specific times. The expression of these inducible genes is tightly controlled. For example, pancreas beta cells make the protein insulin by expressing the insulin gene. Neurons, in comparison, don’t express insulin. ©2000 Timothy G. Standish Operons Are Groups Of Genes Expressed By Prokaryotes The genes grouped in an operon are all needed to complete a given task Each operon is controlled by a single control sequence in the DNA Because the genes are grouped together, they can be transcribed together then translated together ©2000 Timothy G. Standish The Lac Operon Genes in the lac operon allow E. coli bacteria to metabolize lactose E. coli is unlikely to encounter lactose, so it would be wasteful to produce the proteins needed to metabolize it unless necessary Metabolizing lactose for energy only makes sense when two criteria are met: – Other more readily metabolized sugar (glucose) is unavailable – Lactose is available ©2000 Timothy G. Standish The Lac Operon - Parts The lac operon is made up of a control region and four genes: 1 LacZ - b-galactosidase - An enzyme that hydrolizes the bond between galactose and glucose 2 LacY - Codes for a permease that lets lactose across the cell membrane 3 LacA - Transacetylase - An enzyme whose function in lactose metabolism is uncertain 4 Repressor - A protien that works with the control region to control expression of the operon ©2000 Timothy G. Standish The Lac Operon - Control The control region is made up of two parts: 1 Promoter – Promoters are specific DNA sequences to which RNA Polymerase binds so that transcription can occur – The lac operon promoter also has a binding site for protein called Catabolite Activator Protein (CAP) 2 Operator – The binding site of the repressor protein – The operator is located down stream (in the 3’ direction) from the promoter so that if repressor is bound RNA Polymerase can’t transcribe ©2000 Timothy G. Standish The Lac Operon: When Glucose Is Present But Not Lactose Come on, let me through Hey man, I’m constitutive Repressor CAP Binding Repressor mRNA RNA Pol. Promoter Operator LacZ LacY LacA Repressor No way Jose! Repressor CAP ©2000 Timothy G. Standish The Lac Operon: When Glucose And Lactose Are Present Great, I can transcribe! Hey man, I’m constitutive Repressor CAP Binding RNA Pol. Promoter Operator X Repressor mRNA Repressor Repressor LacZ LacY RNA LacA Pol. Repressor This lactose has bent me out of shape CAP Some transcription occurs, but at a slow rate ©2000 Timothy G. Standish The Lac Operon: When Lactose Is Present But Not Glucose Hey man, I’m constitutive Repressor CAP Binding CAP Bind to me Polymerase Yipee…! RNA Pol. Promoter Operator cAMP X Repressor mRNA LacZ RNA LacA Pol. LacY Repressor CAP cAMP Repressor Repressor This lactose has bent me out of shape cAMP CAP ©2000 Timothy G. Standish The Lac Operon: When Neither Lactose Nor Glucose Is Present Hey man, I’m constitutive Repressor CAP Binding CAP Bind to me Polymerase RNA Pol. Alright, I’m off to the races . . . Come on, let me through! Promoter Operator LacZ LacY LacA Repressor cAMP Repressor mRNA Repressor STOP Right there Polymerase CAP cAMP cAMP CAP ©2000 Timothy G. Standish The Trp Operon Genes in the trp operon allow E. coli bacteria to make the amino acid tryptophan Trp operon genes encode enzymes involved in the biochemical pathway that converts the precursor chorismate to tryptophan. The trp operon is controlled in two ways: – Using a repressor that works in exactly the opposite way from the lac operon repressor – Using a special attenuator sequence ©2000 Timothy G. Standish The Tryptophan Biochemical Pathway COO- Glutamine Glutamate + Pyruvate COO- CH2 5-Phosphoribosyla-Pyrophosphate NH2 COO- HO H O C H Anthranilate synthetase (trpE and D) Chorismate OH OH -2O PO 3 CH2 C C C -OOC OH PPi Anthranilate synthetase -2O P 3 O CH2 Antrhanilate H CH2 C N-(5’-Phosphoribosyl)Anthranilate isomerase Indole- H Enol-1-oH H C 3’-glycerol phosphate synthetase N Carboxyphenylamino H H -1-deoxyribulose phosphate Glyceraldehyde- Tryptophan synthetase (trpB and A) H 3-phosphate Serine H2O -OOC C C HN N-(5’H Phosphoribosyl) -anthranilate OH H H N-(5’-Phosphoribosyl)-anthranilate OH isomerase Indole-3’-glycerol OH OH phosphate synthetase (trpC) CO2+H2O -2O PO 3 O -OOC C H C H N H Indole-3-glycerol phosphate CH2 NH3+ Tryptophan synthetase N H Indole N H Tryptophan ©2000 Timothy G. Standish The Trp Operon: When Tryptophan Is Present Hey man, I’m constitutive Repressor RNA Pol. Foiled Again! Promo. Operator Lead. Aten. trpE trpD trpC trpB trpA Repressor Trp Repressor mRNA STOP Right there Polymerase Repressor Trp ©2000 Timothy G. Standish The Trp Operon: When Tryptophan Is Absent Hey man, I’m constitutive RNA RNA Operator Repressor Promo. Lead. Aten. trpE trpD trpC trpBPol.trpA Pol. Repressor mRNA I need tryptophan Repressor needs his little buddy tryptophan if I’m to be stopped Repressor ©2000 Timothy G. Standish Attenuation The trp operon is controlled both by a repressor and attenuation Attenuation is a mechanism that works only because of the way transcription and translation are coupled in prokaryotes Therefore, to understand attenuation, it is first necessary to understand transcription and translation in prokaryotes ©2000 Timothy G. Standish Transcription And Translation In Prokaryotes 5’ 3’ 3’ 5’ RNA Pol. Ribosome mRNA Ribosome 5’ ©2000 Timothy G. Standish The Trp Leader and Attenuator Met-Lys-Ala-Ile-Phe-ValAAGUUCACGUAAAAAGGGUAUCGACA-AUG-AAA-GCA-AUU-UUC-GUALeu-Lys-Gly-Trp-Trp-Arg-Thr-Ser-STOP CUG-AAA-GGU-UGG-UGG-CGC-ACU-UCC-UGA-AACGGGCAGUGUAUU 1 2 CACCAUGCGUAAAGCAAUCAGAUACCCAGCCCGCCUAAUGAGCGGGCUUUU 3 4 Met-Gln-Thr-Gln-Lys-Pro UUUU-GAACAAAAUUAGAGAAUAACA-AUG-CAA-ACA-CAA-AAA-CCG trpE . . . Terminator ©2000 Timothy G. Standish The mRNA Sequence Can Fold In Two Ways 1 1 2 2 3 3 4 4 Terminator haripin ©2000 Timothy G. Standish The Attenuator When Starved For Tryptophan 5’ 3’ Leader peptide3’ Help, I need Tryptophan RNA Pol. 2 Ribosome 3 4 1 5’ Ribosome stalls over sequence 1 and sequence 2 binds to sequence 3 preventing formation of the 3, 4 hairpin ©2000 Timothy G. Standish The Attenuator When Tryptophan Is Present 5’ 3’ Ribosome 3’ 1 Leader peptide is released 5’ 2 RNA Pol. 3 4 Ribosome passes over sequence 1 and onto sequence 2 allowing sequence 3 to form the 3, 4 hairpin ©2000 Timothy G. Standish The Attenuator When Tryptophan Is Present 5’ 3’ Ribosome 3’ 1 5’ 2 RNA Pol. 3 4 The 3, 4 hairpin destabilizes the elongation complex ©2000 Timothy G. Standish The Attenuator When Tryptophan Is Present 5’ 3’ Ribosome 3’ 1 5’ RNA polymerase falls off ending transcription 2 3 4 RNA Pol. ©2000 Timothy G. Standish ©2000 Timothy G. Standish