* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Self-Organizing Bio-structures
SNP genotyping wikipedia , lookup
Genetic code wikipedia , lookup
Cancer epigenetics wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Holliday junction wikipedia , lookup
Microevolution wikipedia , lookup
Human genome wikipedia , lookup
DNA polymerase wikipedia , lookup
Genealogical DNA test wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
DNA vaccination wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Molecular cloning wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
History of genetic engineering wikipedia , lookup
Point mutation wikipedia , lookup
Short interspersed nuclear elements (SINEs) wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Epigenetics of human development wikipedia , lookup
RNA interference wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Epigenomics wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Helitron (biology) wikipedia , lookup
DNA nanotechnology wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Messenger RNA wikipedia , lookup
Polyadenylation wikipedia , lookup
Non-coding DNA wikipedia , lookup
DNA supercoil wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
RNA silencing wikipedia , lookup
History of RNA biology wikipedia , lookup
RNA-binding protein wikipedia , lookup
Non-coding RNA wikipedia , lookup
Primary transcript wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Epitranscriptome wikipedia , lookup
Self-Organizing Biostructures NB2-2009 L.Duroux Lecture 3 Self-Assembly in nucleic acids DNA & RNA folding What is RNA? Aside of being DNA’s “messenger”, RNA performs functions itself RNA secondary structure is related to mRNA stability & RNA functions RNA folding can be predicted & the effects of mutations modeled RNA Primary Structure (-e) 5' Structure of RNA backbone (-e) (-e) (-e) 3' • RNA chain directionality: 5'3' • Backbone carries charge (-e) on each nucleotide • Formation of an RNA structure requires cations Four Types of Bases Adenine (A) Uracil (U) Guanine (G) Cytosine (C) Purines Pyrimidines Base-Pairing: a famous case of molecular self-assembly A U G C Watson-Crick canonical base pair What does RNA do? The Central Dogma transcription splicing mRNA tRNA translation ribosome DNA pre mRNA mRNA protein RNAs are Critical to Cellular Functions Messenger RNA (mRNA) Small nuclear RNAs (snRNA) is the integral part of the ribosome Small interfering RNA (siRNA) carries amino acid to ribosome Ribosomal RNA (rRNA) splice mRNA in nucleus Transfer RNA (tRNA) codes for protein mRNA turn-over, defense mechanism Micro RNA (miRNA) Gene expression regulation Some biological functions of non-coding RNA snRNA: RNA splicing, telomere maintenance, transcription regulation miRNA: translational control (down regulation) siRNA: RNA interference, gene specific down regulation Guide RNAs: RNA editing (mitochondria protozoa) Ribozymes: Catalysis in ribozomes The function of the RNA molecule depends on its folded structure RNA Structure(s) The RNA Helix ssRNA forms A-helix: Grooves Binding sites RNA secondary structure U Defined by basepairing Form short helical structures Base pairing in RNA: not necessarily canonical! Torsion Angles define 3D structure P O c c c O P each bond ~ 1.5 Å nucleotide structure We need 7 torsional angles per nucleotide to specify the 3D structure of an RNA Torsion angles are like rotamers of protein side chain RNA specific folds The RNA molecule folds on itself. The base pairing is as follows: G 5’ C A U G hydrogen bond 3’ GAUCUUGAUC LOOP U UU C U A G G A U STEM C 5’ 3’ RNA Secondary Structure Motifs Pseudoknot Stem Interior Loop Single-Stranded Bulge Loop Junction (Multiloop) Hairpin loop Image– Wuchty Secondary structure motifs and symbols Secondary Structure Contact (Base Pair) Tertiary Structure Contact (Base Pair) RNA Pseudoknot Example of RNA tertiary structure: tRNA RNA Folds & Function RIBOZYMES Catalytic RNA Can work alone (Mg2+) or with proteins Therapeutic applications? Control of iron levels by mRNA secondary structure Iron Responsive Element GU (IRE) on mRNA A G C N N N’ conserved N N’ N N’ N N’ C N N’ N N’ N N’ N N’ 5’ N N’ 3’ Recognized by Iron Responsive Protein (IRP1, IRP2) when Fe deficiency F: Ferritin = iron storage TR: Transferrin receptor = iron uptake IRP1/2 IRE F mRNA 3’ 5’ IRP1/2 3’ TR mRNA 5’ Low Iron High Iron IRE-IRP inhibits translation of Ferritin IRE-IRP Inhibition of degradation of TR IRE-IRP off -> Ferritin translated Transferrin receptor degraded Structure-based similarity Sequence Similarity gurken Ifactor %ID = 34% AAGTAATTTTCGTGCTCTCAACAATTGTCGCCGTCACAGATTGTTGTTCGAGCCGAATCTTACT 64 ---TGCACACCTCCCTCGTCACTCTTGATTTT-TCAAGAGCCTTCGATCGAGTAGGTGTGCA-- 58 * * *** ** *** *** * * ***** * * Structural Similarity H H St St Gurken : (miRNA controlling development) 64nt stem loop I1 I1 B B I2 I2 I Factor : (retrotransposon) 58nt stem loop RNA Folding & Predictions RNA folding predictions Goal: To predict function of an RNA from its sequence from: structure stability folding kinetics Ultimate goal: To predict RNA function from its sequence Folding Free Energy of Secondary Structure Folding free energy: ΔG = G ( secondary structure) -G( ΔG = ΔH – T ΔS ) RNA PROTEIN types of sidechains: 4 20 backbone: 7 2 secondary structure: helices α, β, …… # of folded states: often > 1 usually 1 folding driving force: base stacking specific H, Ф nonspecific secondary structure stable without tertiary stability: (7bp ~10 kcal/mol) folding pathway: electrostatics: unstable w/t tertiary (ΔGtot ~10 kcal/mol) multistate, hierarchical usually kinetically controlled usually 2-state usually thermodynamically controlled highly charged variable Applications for RNA folding predictions Explain why non-(protein) coding regions are conserved Viral RNA packing inside capsid Prediction of functional RNAs Identify similarity, not by sequence but by structure Why Study RNA Folding Kinetics? B A conversion is slow as compared with the translational process Conformation B is kinetically trapped. Kinetics is tied to Function Ion-Dependence of RNA folding H2O and metal ions are integral parts of nucleic acid structure [Na+] stabilizes secondary structure From Tinoco & Bustamante,JMB (1999) 273,271 [Na+] by 10 folds Tm by 3.8 C Multivalent Ions Stabilize Tertiary Fold Pseudoknot Co(NH 3 )63 [Mg2+] Stabilization Na+ = 200mM 2 + 50 M Mg From Tinoco & Bustamante,JMB (1999) 273,271 RNA conformational changes are iondependent tRNA RNA folding kinetics strongly depends on ions Na+ Secondary structure 10 100s Mg2+ 10 - 100 ms for tRNA Tertiary structure Metal ion binding sites can be formed before, during, or after the formation of the tertiary structure DNA structure DNA Stabilization--H-bonding between DNA base pair stacks Advantages to Double Helix Stability---protects bases from attack by H2O soluble compounds and H2O itself. Provides easy mechanism for replication Formal geometrical models for describing shape of Helix Allows for molecular modeling based on primary structure Based on Free-energy computations and minimization algorithms Useful to predict impact of sequence composition or mutations (non-canonical basepairing) on helical structure Parameters that define base pairs 3DNA (v1.5) — A 3-Dimensional Nucleic Acid Structure Analysis and Rebuilding Software Package Xiang-Jun Lu, Wilma K. Olson Parameters that define sequential base pair steps 3DNA (v1.5) — A 3-Dimensional Nucleic Acid Structure Analysis and Rebuilding Software Package Xiang-Jun Lu, Wilma K. Olson Parameters that relate base pair to the helical frame 3DNA (v1.5) — A 3-Dimensional Nucleic Acid Structure Analysis and Rebuilding Software Package Xiang-Jun Lu, Wilma K. Olson Physical Structure (cont’d) Chains are anti-parallel (i.e in opposite directions) Diameter and periodicity are consistent 2.0 nm 10 bases/ turn 3.4 nm/ turn Width consistent because of pyrimidine/purine pairing Physical Structure (cont’d) G-C Content A=T, G=C, but AT≠GC Generally GC~50%, but extremely variable Examples: Slime mold~22% Mycobacterium~73% Distribution of GC is not uniform in genomes CONSEQUENCES OF GC CONTENT GC slightly denser: Higher GC DNA moves further in a gradient Higher number of base pairs : more stable DNA, i.e. the strands don’t separate as easily. FORMS OF DNA DNA forms B-form A-form Z-form A-DNA vs. B-DNA A-form dehydrated bp/turn 10.9 helical twist angle 33.1° bp-bp rise 2.9Å B-form hydrated 10.0 35.9° 3.4Å B-DNA is the preferred conformation in vivo A “regular” helix contains two similar grooves Asymmetric attachment of DNA bases to backbone creates unequally sized grooves Major and minor grooves in B-DNA and A-DNA The edges of DNA base pairs can form hydrogen bonds to protein side chains Supercoiling Cruciform Structures Another adaptation to supercoiling Associated with palindromes DNA is Dynamic Like proteins, DNA has tertiary structure Why so many deviations from normal conformation? Effects on transcription (gene expression) Enhances responsiveness May also serve in packaging NOTE: most cellular DNA exists as protein containing supercoils DNA packaging in chromosomes Packaging DNA Histone octamer Histone proteins B DNA Helix 2 nm Packaging DNA Histone octamer Histone proteins B DNA Helix 2 nm Packaging DNA 11 nm Histone octomer Histone proteins Nucleosome B DNA Helix 2 nm Packaging DNA Packaging DNA Packaging DNA “Beads on a string” 11 nm 30 nm Tight helical fiber Looped 200 nm Domains Protein scaffold Packaging DNA Nucleosomes 11 nm 30 nm Tight helical fiber Metaphase Chromosome 700 nm 200 nm Looped Domains 2 nm B DNA Helix Protein scaffold Chromosomes, Chromatids and Centromeres A packaged chromosome Chromatid Identical chromatid Chromosome arm Centromere Chromosome arm Two identical chromosomes Replication Anaphase DNA-binding Proteins Zinc-Finger Helix-Turn-Helix Leucine-Zipper DNA denaturation Denaturation of DNA Denaturation by heating. How observed? A260 For dsDNA, A260=1.0 for 50 µg/ml For ssDNA and RNA A260=1.0 for 38 µg/ml For ss oligos A260=1.0 for 33 µg/ml Hyperchromic shift The T at which ½ the DNA sample is denatured is called the melting temperature (Tm) Importance of Tm Critical importance in any technique that relies on complementary base pairing Designing PCR primers Southern blots Northern blots Colony hybridization Factors Affecting Tm G-C content of sample Presence of intercalating agents (anything that disrupts H-bonds or base stacking) Salt concentration pH Length Renaturation Strands can be induced to renature (anneal) under proper conditions. Factors to consider: Temperature Salt concentration DNA concentration Time Cot Curves What Do Cot Curves Reveal? Complexity of DNA sample Reveals important info about the physical structure of DNA Can be used to determine Tm for techniques that complementary base pairing. Complexity of DNA- Factors Repetitive Sequences Single Copy Genes Highly repetitive (hundreds to millions) Randomly dispersed or in tandem repeats Satellite DNA Microsatellite repeats Miniisatellite repeats Middle repetitive (10- hundreds) Clustered Dispersed Slightly repetitive (2-10 copies) Renaturation curves of E. coli and calf DNA Highly repetitive sequences Middle repetitive sequences Unique sequences The End Why Study RNA Folding Stability? Ribosome binds here mRNA mRNA has sufficient time to equilibrate before translation is initiated equilibrium stability Stability is tied to function Examples of known interactions of RNA secondary structural elements Pseudo-knot Kissing hairpins Hairpin-bulge contact