Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Welcome to CSE 527: Computational Biology Lecture 1 – Sep 27, 2011 CSE 527 Computational Biology, Fall 2011 Instructor: Su-In Lee TA: Christopher Miles Monday & Wednesday 12:00-1:20 Johnson Hall (JHN) 022 1 Who is the instructor? Prof. Su-In Lee Assistant Professor A joint faculty member Computer Science & Engineering, Genome Sciences Office hours: Wednesday 1:30-2:30 Research interests Developing machine learning techniques applied to Computational Biology (genetics, systems biology) Predictive Medicine, Translational Medicine 2 Teaching assistant Christopher Miles (CSE PhD student) Office: TBA Office hours: Monday 1:30-2:30 Email: cmiles@uw.edu 3 What is the Coolest Thing a Computational/Mathematical Scientist Can Do? Curing cancer. Understanding how the blue print of life (DNA) determines important traits (e.g. diseases)? Predicting your disease susceptibilities based on your biological information including DNA sequence. Predicting sudden changes in the condition of patients at ICU (intensive care unit). Determining the order of A,G,C and T in my 3-billion long DNA sequence. : CSE 527 will provide you with basic concepts and ML/statistical techniques that you can use to realize these goals. A cell’s biological state can beBiology described byis millions of More and More of numbers! What biological discoveries we can make highly depends on Becoming an method Information Science the computational we use to analyze the data. Machine learning techniques provide very effective tools. Gene (~30,000 in human) Gene regulation AGATATGTGGATTGTTAGGATTTATGCGCGTCAGTGACTACGCATGTTACGCACCTACGACTAGGTAATGATTGATC DNA RNA Protein Gene expression AUGUGGAUUGUU AUGCGCGUC AUGCGCGUC AUGUUACGCACCUAC RNA degradation MWIV MRV MRV MLRTY Gene interaction map Biological information (data) DNA sequence information RNA levels of 30K genes Protein levels of 30K genes DNA molecule’s 3D structure : AUGAUUGAU AUGAUUAU MID Cell: The basic unit of life Outline Course logistics A zero-knowledge based introduction to biology Potential project topics 6 Goals of this course Introduction to Computational Biology Basic concepts and scientific questions Basic biology for computational scientists In-depth coverage of ML techniques Current active areas of research Useful machine learning (ML) algorithms Probabilistic graphical models, clustering, classification Learning techniques (MLE, EM) 7 Topics in CSE 527 Part 1: Basic ML algorithms Introduction to probabilistic models Bayesian networks, Hidden Markov models Representation and learning Part 2: Topics in computational biology and areas of active research Genetics, systems biology, predictive medicine, sequence analysis Finding genetic factors for complex biological traits Inferring biological networks from data Comparative genomics DNA/RNA sequence analysis 8 Course responsibilities Class participation and attendance (10%) Good answers to the questions asked in class Initiating a productive discussion. Homework assignments (40%) Four problem sets Collaboration allowed Due at beginning of class Up to 3 late days (24-hr period) for the quarter Teams of 2 or 3 students Individual writeups Final project (50%) A group of up to two students. 9 Project overview (1/2) Topic Choose from the list of project topics on the course website, or come up with your own. Open-ended Project deliverables Project proposal (due 10/19) Midterm report (due 11/16) Final report (due 12/14) Final presentations or poster session (12/7) 10 Project overview (2/2) Final report Short report (up to 10 pages) Conference-style presentation Successful project reports can be submitted to computational biology/ ML conferences (ISMB, RECOMB, NIPS, ICML) Or journals (PLoS journals, Nature journals, PNAS, Genome Research and so on) 11 Reading material Lecture notes Biological background The Cell, a molecular approach by Copper Genetics, from genes to genomes by Hartwell and more Principles of Population genetics by Hartl & Clark Computational background Mostly based on recent papers & old seminar papers Probabilistic graphical models by Profs. Daphne Koller & Nir Friedman Prof. Andrew Ng’s machine learning lecture note (cs229.stanford.edu) No textbook required for the course 12 Class resources Course website – cs.washington.edu/527 Lecture notes, assignments, project topics Deadlines of assignments and projects Mailing list cse527@cs.washington.edu 13 Outline Course logistics A zero-knowledge based introduction to biology Prepared by George Asimenos (PhD student, Stanford) for CS262 Computational Genomics by Prof. Serafim Batzoglou (Stanford). Potential project topics 14 Cells: Building Blocks of Life cell, nucleus, cytoplasm, mitochondrion Eukaryots: Plants, animals, humans DNA resides in the nucleus Contain other compartments for other specialized functions Prokaryots: Bacteria Do not contain compartments Little recognizable substructure © 1997-2005 Coriell Institute for Medical Research 15 DNA: “Blueprints” for a cell Genetic information encoded in long strings of double-stranded DNA Deoxyribo Nucleic Acid comes in only four flavors: Adenine, Cytosine, Guanine, Thymine 16 Nucleotide Deoxyribose, nucleotide, base, A, C, G, T, 3’, 5’ to previous nucleotide O O P O- 5’ H O H C H Guanine (G) Thymine (T) Cytosine (C) to base O C Adenine (A) C H H C C 3’ H H Let’s write “AGACC”! to next nucleotide 17 “AGACC” (backbone) 18 “AGACC” (DNA) deoxyribonucleic acid (DNA) 3’ 5’ 5’ 3’ 19 DNA is double stranded strand, reverse complement 5’ 3’ 3’ 5’ DNA is always written 5’ to 3’ AGACC or GGTCT 20 DNA Packaging histone, nucleosome, chromatin, chromosome, centromere, telomere telomere centromere nucleosome DNA chromatin H1 ~146bp H2A, H2B, H3, H4 21 The Genome The genome is the full set of hereditary information for an organism Humans bundle two copies of the genome into 46 chromosomes in every cell = 2 x (1-22 + X/Y) 22 Building an organism DNA cell Every cell has the same sequence of DNA Subsets of the DNA sequence determine the identity and function of different cells 23 From DNA To Organism ? Proteins do most of the work in biology, and are encoded by subsequences of DNA, known as genes. 24 RNA ribonucleotide, U to previous ribonucleotide O O P O- 5’ H O H C H 3’ Guanine (G) Uracil (U) Cytosine (C) to base O C Adenine (A) C H H C C OH to next ribonucleotide H TU 25 Genes & Proteins gene, transcription, translation, protein Double-stranded DNA 5’ 3’ TAGGATCGACTATATGGGATTACAAAGCATTTAGGGA...TCACCCTCTCTAGACTAGCATCTATATAAAACAGAA ATCCTAGCTGATATACCCTAATGTTTCGTAAATCCCT...AGTGGGAGAGATCTGATCGTAGATATATTTTGTCTT 3’ 5’ (transcription) Single-stranded RNA AUGGGAUUACAAAGCAUUUAGGGA...UCACCCUCUCUAGACUAGCAUCUAUAUAA (translation) protein 26 Gene Transcription promoter 5’ 3’ G A T T A C A . . . C T A A T G T . . . 3’ 5’ 27 Gene Transcription transcription factor, binding site, RNA polymerase 5’ 3’ G A T T A C A . . . C T A A T G T . . . 3’ 5’ Transcription factors: a type of protein that binds to DNA and helps initiate gene transcription. Transcription factor binding sites: short sequences of DNA (6-20 bp) recognized and bound by TFs. RNA polymerase binds a complex of TFs in the promoter. 28 Gene Transcription 5’ 3’ 3’ 5’ The two strands are separated 29 Gene Transcription 5’ 3’ 3’ 5’ An RNA copy of the 5’→3’ sequence is created from the 3’→5’ template 30 Gene Transcription G A T T A C A . . . 5’ 3’ 3’ 5’ C T A A T G T . . . pre-mRNA 5’ G A U U A C A . . . 3’ 31 RNA Processing 5’ cap, polyadenylation, exon, intron, splicing, UTR, mRNA 5’ cap poly(A) tail exon intron mRNA 5’ UTR 3’ UTR 32 Gene Structure introns 5’ 3’ promoter 5’ UTR exons 3’ UTR coding non-coding 33 How many? (Human Genome) Genes: ~ 20,000 Exons per gene: ~ 8 on average (max: 148) Nucleotides per exon: 170 on average (max: 12k) Nucleotides per intron: 5,500 on average (max: 500k) Nucleotides per gene: 45k on average (max: 2,2M) 34 From RNA to Protein Proteins are long strings of amino acids joined by peptide bonds Translation from RNA sequence to amino acid sequence performed by ribosomes 20 amino acids 3 RNA letters required to specify a single amino acid 35 Amino acid amino acid H N H O C C H R OH Alanine Arginine Asparagine Aspartate Cysteine Glutamate Glutamine Glycine Histidine Isoleucine Leucine Lysine Methionine Phenylalanine Proline Serine Threonine Tryptophan Tyrosine Valine There are 20 standard amino acids 36 Proteins N-terminus, C-terminus to previous aa N H O C C to next aa H R H N-terminus (start) from 5’ OH C-terminus (end) 3’ mRNA 37 Translation ribosome, codon P site A site mRNA The ribosome (a complex of protein and RNA) synthesizes a protein by reading the mRNA in triplets (codons). Each codon is translated to an amino acid. 38 The genetic code Mapping from a codon to an amino acid 39 Translation 5’ . . . A U U A U G G C C U G G A C U U G A . . . 3’ UTR Met Start Codon Ala Trp Thr Stop Codon 40 Translation amino acid t-RNA Met Ala Trp 5’ . . . A U U A U G G C C U G G A C U U G A . . . 3’ 41 Errors? mutation What if the transcription / translation machinery makes mistakes? What is the effect of mutations in coding regions? 42 Reading Frames reading frame G C U U G U U U A C G A A U U A G G C U U G U U U A C G A A U U A G G C U U G U U U A C G A A U U A G G C U U G U U U A C G A A U U A G 43 43 Synonymous Mutation synonymous (silent) mutation, fourfold site G G C U U G U U U A C G A A U U A G G C U U G U U U A C G A A U U A G Ala Cys Leu Arg Ile G C U U G U U U G C G A A U U A G Ala Cys Leu Arg Ile 44 44 Missense Mutation missense mutation G G C U U G U U U A C G A A U U A G G C U U G U U U A C G A A U U A G Ala Cys Leu Arg Ile G C U U G G U U A C G A A U U A G Ala Trp Leu Arg Ile 45 45 Nonsense Mutation nonsense mutation A G C U U G U U U A C G A A U U A G G C U U G U U U A C G A A U U A G Ala Cys Leu Arg Ile G C U U G A U U A C G A A U U A G Ala STOP 46 Frameshift frameshift G C U U G U U U A C G A A U U A G G C U U G U U U A C G A A U U A G Ala Cys Leu Arg Ile G C U U G U U A C G A A U U A G Ala Tyr Cys Glu Leu 47 Transcription and translation Let’s see how this happens! Transcription: http://www.youtube.com/watch?v=DA2t5N72mgw Translation: http://www.youtube.com/watch?v=WkI_Vbwn14g&feature=related Illustration from Radboud University Nijmegen 48 Gene Expression Regulation Regulation, signal transduction When should each gene be expressed? Regulate gene expression Examples: Make more of gene A when substance X is present Stop making gene B once you have enough Make genes C1, C2, C3 simultaneously Why? Every cell has same DNA but each cell expresses different proteins. Signal transduction: One signal converted to another Cascade has “master regulators” turning on many proteins, which in turn each turn on many proteins, ... 49 Gene Regulation Gene expression is controlled at many levels DNA chromatin structure Transcription Post-transcriptional modification RNA transport Translation mRNA degradation Post-translational modification 50 Transcription regulation Much gene regulation occurs at the level of transcription. Primary players: Binding sites (BS) in cis-regulatory modules (CRMs) Transcription factor (TF) proteins RNA polymerase II Primary mechanism: TFs link to BSs Complex of TFs forms Complex assists or inhibits formation of the RNA polymerase II machinery 51 Transcription Factor Binding Sites Short, degenerate DNA sequences recognized by particular TFs For complex organisms, cooperative binding of multiple TFs required to initiate transcription Binding Sequence Logo 52 Summary All hereditary information encoded in doublestranded DNA Each cell in an organism has same DNA DNA RNA protein Proteins have many diverse roles in cell Gene regulation diversifies protein products within different cells 53 Outline Course logistics A zero-knowledge based introduction to biology Potential project topics 54 Example project topic #1 (1/3) Which Drug Patient X Should Be Treated With? Say that a cancer patient X undergoes a chemotherapy. There are >200 drugs patient X can be treated with. How do doctors choose which drug to use in chemotherapy treatment ? Follicular lymphoma Diffuse large B cell lymphoma A few histologic features Patient X How can we improve this? Chemotherapy drugs 5-Iodotubercidin Acrichine ARQ-197 Arsenic trioxide AS101 AS-703026 AT-7519 Axitinib Azacitidine : Example project topic #1 (1/3) Which Drug Patient X Should Be Treated With? …ACGTAGCTAGCT AGCTAGCTGATGC TAGCTACGTGCT… A few histologic features Epigenetics (Methylation) DNA sequence RNA levels of genes Follicular lymphoma Diffuse large B cell lymphoma A few histologic features Patient X Protein levels of genes Chemotherapy drugs 5-Iodotubercidin Acrichine ARQ-197 Arsenic trioxide AS101 AS-703026 AT-7519 Axitinib Azacitidine : Doctors cannot handle millions of numbers! How about computers? Example project topic #1 (3/3) Let’s Build a Prediction Model This is a pure machine learning problem! Transfer learning, Feature reconstruction ~100 patients at UWMC 30,000 genes … g1 g2 g4 RNA levels of genes in cancer cells g7 g10 g13 g3 g5 g6 g15 g16 g30,000 g g9 g14 g g3 g g 30,000 features! g (feature selection) 160 drugs Drug i Drug 2 Drug sensitivity test Publicly available RNA level data g g11 g g e8 g12 >3000 patients Patient X Drug 3 Drug 4 Drug 6 Drug 5 Goal: realizing personalized cancer treatment Prior knowledge on drugs’ targets Drug 160 In collaboration with Tony Blau, Pam Becker, Ray Monnat, David Hawkins (Medicine) Example project topic #2 (1/2) How Well Can We Predict Diseaserelated Traits Based on DNA? DNA sequence Athin, T fat Nresearch instances One of the most important Individual A …ACCCGGTAGACCTTTATTCGGCCCGG… …ACCCGGTAGACCTTTATTCGGCCCGG… problems in this areaIndividual is to develop new environmental factors A …ACCCGGTAGACCTTAATTCGGCCGGG… …ACCCGGTAGACCTTAATTCGGCCGGG… Individual computational methods that can : represent more complicated interaction Individual T …ACCCGGTAGTCCTATATTCGGCCCGG… …ACCCGGTAGTCCTATATTCGGCCCGG… cell, aand complex system between sequence variation trait. Individual T …ACTCGGTAGTCCTATATTCGGCCGGG… …ACTCGGTAGTCCTATATTCGGCCGGG… …ACTCGGTAGACCTAAATTCGGCCCGG… A …ACTCGGTAGACCTAAATTCGGCCCGG… 1 2 3 : N-1 N p≈106 ! s1 s2 … too weak to be detected ? Causality? obesity ? sp ? Standard approach Obesity Find a simple rule! Failed to detect the DNA affecting many important traits. Example project topic #2 (2/2) How Well Can We Predict Diseaserelated Traits Based on DNA? ~2000 subjects …ACTCGGACCTAAATCCCG… …ACCCGGACCTTAATGCGG… …ACCCGGACCTATATGCCG… …ACCCGGACCTTTATGCCG… : …ACCCGGACCTTAATGCGG… …ACCCGGTCCTATATGCCG… …ACTCGGTCCTTAATGCGG… …ACTCGGTCCTATATGCGG… … s1 Sequence Information Year 0 Phenotype Data : Year 25 Phenotype Data Longitudinal study Environmental factors Age, sex, smoking status s2 s3 s4 p≈106 sP ! (feature selection) Cholesterol Fatty acid Glucose Insulin Structural learning : Age-specific genetic influence Cholesterol Fatty acid Glucose Insulin In collaboration with Alex Reiner (Epidemiology) More project topics at the course website! Questions?