Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Regulation of adiponectin gene expression in adipose tissue by thyroid hormones Samira Seifi, Mohammad Reza Tabandeh, Saed Nazifi, Mehdi Saeb, Sadegh Shirian & Parisa Sarkoohi Journal of Physiology and Biochemistry Official Journal of the University of Navarra, Spain ISSN 1138-7548 Volume 68 Number 2 J Physiol Biochem (2012) 68:193-203 DOI 10.1007/s13105-011-0131-1 1 23 Your article is protected by copyright and all rights are held exclusively by University of Navarra. This e-offprint is for personal use only and shall not be self-archived in electronic repositories. If you wish to selfarchive your work, please use the accepted author’s version for posting to your own website or your institution’s repository. You may further deposit the accepted author’s version on a funder’s repository at a funder’s request, provided it is not made publicly available until 12 months after publication. 1 23 Author's personal copy J Physiol Biochem (2012) 68:193–203 DOI 10.1007/s13105-011-0131-1 Regulation of adiponectin gene expression in adipose tissue by thyroid hormones Samira Seifi & Mohammad Reza Tabandeh & Saed Nazifi & Mehdi Saeb & Sadegh Shirian & Parisa Sarkoohi Received: 5 August 2011 / Accepted: 15 November 2011 / Published online: 30 November 2011 # University of Navarra 2011 Abstract Available experimental data suggest that adiponectin and thyroid hormones have biological interaction in vivo. However, the effects of thyroid hormones on adipose adiponectin gene expression in thyroid dysfunction are unclear. We induced hyper(HYPER) and hypothyroidism (HYPO) by daily S. Seifi Department of Biochemistry, Research and Science Branch, Islamic Azad University, Tehran, Iran M. R. Tabandeh (*) : P. Sarkoohi Department of Biochemistry and Molecular Biology, Faculty of Veterinary Medicine, Shahid Chamran University of Ahvaz, Ahvaz, Iran e-mail: m.tabandeh@scu.ac.ir S. Nazifi Department of Clinical Studies, School of Veterinary Medicine, Shiraz University, Shiraz, Iran M. Saeb Department of Biochemistry, School of Veterinary Medicine, Shiraz University, Shiraz, Iran S. Shirian Department of Phatobiology, School of Veterinary Medicine, Shiraz University, Shiraz, Iran administration of a 12 mg/l of levothyroxine and 250 mg/l of methimazole in drinking water of rats, respectively, for 42 days. The white adipose tissues and serum sample were taken on days 15, 28, 42 and also 2 weeks after treatment cessation. Analysis of adiponectin gene expression was performed by real-time PCR and 2−ΔΔct method. The levels of adipose tissue adiponectin mRNA in the HYPO rats were decreased during the 6-week treatment when compared to control rats (<0.05) and were increased significantly 2 weeks after HYPO cessation (P<0.05). This decline in adiponectin gene expression occurred in parallel with a decrease in T3, T4, fT3 and fT4 concentrations (P<0.05). In opposite to HYPO rats, adipose adiponectin gene expression was increased in HYPER rats during the 6-week treatment in parallel with an increase the thyroid hormones concentrations (P<0.05), and its expression was decreased 2 weeks after HYPER cessation (P<0.05). Adiponectin gene expression levels showed significant negative correlations with concentrations of LDL (HYPO; r=−0.806, P=0.001 and HYPER; r=−0.749, P=0.002), triglyceride (HYPO; r=−0.825, P=0.001 and HYPER; r=−0.824, P= 0.001) and significant positive correlations with concentrations of glucose (HYPO; r=0.674, P= 0.004 and HYPER; r=0.866, P=0.001) and HDL (HYPO; r=0.755, P=0.001 and HYPER; r=0.839, P=0.001). The current study provides evidence that adiponectin gene expression in adipose tissue is regulated by thyroid hormones at the translation level Author's personal copy 194 and that lipid and carbohydrate disturbances in a patient with thyroid dysfunction may be, in part, due to adiponectin gene expression changes. Keywords Adiponectin . Gene expression . Adipose tissue . Hypothyroidism . Hyperthyroidism . Rat Introduction Adipose tissue was once known primarily as a storage organ for excess energy in the form of triglycerides [14]. However, during the past decade, this tissue is known to secrete various hormones that are recognized as adipocytokines. Adiponectin is a recently described adipocytokine with multiple functions [4]. This hormone plays an important role in the regulation of whole body energy homeostasis, insulin sensitivity, lipid/carbohydrate metabolism [19] and reproduction functions [31, 34, 35]. The thyroid hormones thyroxin (T4) and triiodothyronine (T3) also exert several important metabolic actions similar to adiponectin [7, 10, 30]. Available experimental data suggest that adiponectin and thyroid hormones share some biological effects as insulin-sensitizing, antiatherogenic and antiinflammatory properties [7, 19]. Furthermore, the levels of these hormones change in different diseases such as cardiovascular diseases, type 2 diabetes and obesity [14]. Adiponectin might participate in the regulation of thyroid hormone production. The C-terminal globular structure of adiponectin can use the gC1q receptor, a molecule with broad tissue distribution [30]. Some authors have suggested that adiponectin, via this receptor found in the mitochondria of the thyroid cells, may be a regulator of thyroid hormone production [25]. In agreement with this hypothesis, human studies have shown that healthy subjects with high adiponectin levels had higher serum-free T4 levels [12]. Recent reports on the relationship between adiponectin and hypothyroidism have given conflicting results. Most of the authors have reported that adiponectin levels remain unmodified in patients with thyroid hypofunction in comparison with euthyroid subjects [5, 18, 27]. However, a few numbers of studies have found low adiponectin levels in hypothyroid subjects [37]. Also, human studies evaluating the circulating adiponectin in thyroid hyperfunction S. Seifi et al. have shown variable results. High adiponectin levels have been reported accompanying the elevation of thyroid hormone concentrations in hyperthyroid patients by some investigators [26, 29], whereas other authors have found no significant differences in serum adiponectin between euthyroid subjects and hyperthyroid patients [18, 25, 27]. Most of the above studies measured only plasma adiponectin levels and thus, could not precisely identify the molecular mechanism of regulation of adiponectin gene expression by thyroid hormones. At the present time, little is known about the effects of thyroid hormones on adiponectin gene expression in adipose tissue and present data are conflicting. For example, Fujimoto found that in cultures of brown adipose tissue, thyroid hormone presented a small stimulatory effect on adiponectin mRNA expression and on hormone secretion [16]. However, T3 treatment did not have any effect on adiponectin gene expression in 3T3-L1 adipocytes [11]. Up to now, the level of adiponectin gene expression in experimental animal models of hyper- or hypothyroidism in adipose tissue has not been studied. A more complete understanding of the synthesis and regulation of adiponectin secretion by thyroid hormones will likely lead to better approaches for the management of obesity, type 2 diabetes, atherosclerosis and cardiovascular diseases. The studies described herein were intended to examine the mechanism of regulation of adiponectin gene expression in rat adipose tissue in both hypo- and hyperthyroidism. We further evaluated the possible relationship between adiponectin gene expression in adipose tissue and some metabolic factors in different thyroid dysfunctions by measurement of plasma lipoproteins, glucose and NEFA. Materials and methods Animal and experimental design Sixty male adult Sprague–Dawley rats (initial body weight 200± 50 g) were obtained from the breeding colony of the animal house of Shiraz Medical University. Care and use of the laboratory animals were in accordance with NIH guidelines. They had free access to commercial chow and tap water, in a temperature-controlled room (23± 1°C) Author's personal copy Regulation of adiponectin expression by thyroid hormones with a 12 h light:12 h darkness cycle (lights on at 07:00 h). The rats were allowed to acclimatize for 1 week before the beginning of the experiment. They were randomly assigned to one of the three groups: control or euthyroid (n=20), methimazoltreated group (hypothyroid group) (n = 20) and levothyroxine-treated group (hyperthyroid group) (n=20). Based on the duration of hypo- and hyperthyroidism, animals in each treated group were divided into four subgroups, each composed of five rats. These subgroups were named as Hyper 15 (hyperthyroidism for 15 days), Hyper 28 (hyperthyroidism for 28 days), Hyper 42 (hyperthyroidism for 42 days), Hypercut (2 weeks after levothyroxine cessation), Hypo 15 (hypothyroidism for 15 days), Hypo 28 (hypothyroidism for 28 days), Hypo 42 (hypothyroidism for 42 days) and Hypocut (2 weeks after methimazol cessation). Hyperthyroidism was induced by a daily administration of a 12-mg/l solution of levothyroxine in drinking water during the experiment. To stimulate the hypothyroid state, 250 mg/l of methimazole was administered orally every day in drinking water over the period of experiment. Body weight was measured at the beginning and 42 days after treatment. Tissue and serum isolation Hypothyroid, hyperthyroid and euthyroid rats were anesthetized (80 mg/kg ketamine hydrochloride and 10 mg/kg xylazine) and killed by decapitation. Five milliliters of blood was collected by cardiac puncture and immediately placed into tubes containing EDTA. The plasma samples were separated by centrifuging blood samples at 3,000 rpm for 30 min at 4°C and were stored at −80°C for the subsequent assays. The retroperitoneal (RET) white adipose tissues were removed completely and weighed, immediately frozen in liquid nitrogen, stored at −80°C and finally used for adiponectin mRNA quantification. Hormone assay Levels of total T3 and T4 and free T3 (fT3) and free T4 (fT4) in serum of experimental animals were determined with the radioimmunoassay kits (Immunotech., Radiová, Czech Republic) according to the manufacturer’s recommendations. Hormone concentrations were expressed as nanomole per liter for total 195 T3 and T4 and as picomole per liter for fT3 and fT4. The limit of detection was 0.5 pmol/l for both fT3 and fT4. The limit of detection was 0.5 pmol/l for both fT3 and fT4. The intraassay coefficients of variation of fT3 and fT4 were 6.4% and 8.3%, respectively. The interassay coefficients of variation of fT3 and fT4 were 5.5% and 7.5%, respectively. The limits of detection of total T3 and T4 were 0.1 nmol/l and 13 nmol/l, respectively. The intraassay and interassay coefficients of variation were less than 6.2% and 9%, respectively. Measurement of serum lipids and glucose Blood glucose was determined by glucose oxidase method (Ziest Chem, Tehran, Iran). Plasma NEFA concentration was determined by colorimetric enzymatic assay (RANDOX Laboratories Ltd., Ardmore, United Kingdom). Plasma triglycerides were measured by GPO-Trinder method (Ziest Chem, Tehran, Iran) and total cholesterol was measured by CHOD– PAP method (Eram Teb, Tehran, Iran). Following precipitation of apoB containing lipoproteins, the concentration of HDL-cholesterol (HDL-C) was measured by enzymatic colorimetric assay (Ziest Chem, Tehran, Iran). After dissociation of HDL and VLDL from LDL by precipitation, the concentration of LDLcholesterol was measured by subtraction of total cholesterol from HDL and VLDL-cholesterol as recommended by manufacturer’s procedure (Eram Teb, Tehran, Iran). Inter- and intracoefficient of variation (CV) for all parameters (except HDL) were <3%. For HDL, inter and intraCV were <5%. RNA isolation Total RNA was extracted from collected rat adipose tissue using RNX-Plus reagent according to the manufacturer’s procedure (Cinnagen Inc., Tehran, Iran). RNA was treated with DNase I (Fermentas Inc., Vilnius, Lithuania) to remove any possible DNA contamination, quantitated by spectrophotometry at 260 nm using the Biophotometer (Eppendorf, Hamburg, Germany) and finally frozen at −70°C. Reverse transcription–polymerase chain reaction Reverse transcription was done in 20-μl volume using RevertAid M-MuLV reverse transcriptase (Fermentas Inc., Vilnius, Lithuania) as recommended by the Author's personal copy 196 S. Seifi et al. manufacturer. PCRs were performed in a 25-μl reaction using Taq DNA polymerase and an MJ Mini thermal cycler (Bio-Rad Laboratories, Hercules, CA, USA). Specific sets of primers (Macrogen, Seoul, South Korea) that were used for amplification of rat adiponectin and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as calibrators are detailed in Table 1. Thermal conditions for amplification of adiponectin and GAPDH were 35 cycles consisting of denaturing at 94°C for 30 s, specific annealing for 35 s, and extension at 72°C for 30 s with an initial denaturing step at 94°C for 5 min and a final extension step at 72°C for 5 min. The annealing temperatures were 61.5 and 60°C for adiponectin and GAPDH, respectively. PCR reactions for each gene were performed at the same time and with the same batch of Taq DNA polymerase to reduce the variations in PCR efficiency. A reaction without cDNA was used as negative control. PCR product was visualized in an agarose gel (2.5%) and purified using QIAquick gel extraction kit (Qiagen, Hilden, Germany), sequenced in both directions (Macrogen), and its characteristics were determined using Basic Local Alignment Search Tool (nBLAST) at http://www.ncbi.nlm.nih.gov. Quantitative real-time PCR with SYBR Green I® To evaluate the level of adiponectin gene exprsession in adipose tissue of different treated animals, quantitative real-time PCR (qRT-PCR) was performed using the Mini Opticon real-time PCR detection system (Bio-Rad Laboratories, USA) and qPCR™ Green Master Kit for SYBR Green I® (Jena Biosciense, Germany). Relative expression level of adiponectin transcript was normalized to RNA loading for each sample using GAPDH mRNA. The characteristics of primers for qRT-PCR were described in Table 1. PCR reactions were performed in a final volume of 20 μl in a 96-well plate containing 2 μl cDNA, 1× buffer Table 1 Sequences of adiponectin and GAPDH primers used in this study Gene Adiponectin GAPDH F forward primer, R reverse primer (10×), 1.5 mM MgCl2, 200 μM dNTPs, sense and antisense primers (300 nM), 0.025 U/μl Taq DNA polymerase and 1:66,000 SYBR Green I®. The reactions were performed with the following settings: 10 min of preincubation at 95°C followed by 40 cycles for 15 s at 95°C and 1 min at 60°C. Reactions were performed in triplicate. A reaction without cDNA was performed in parallel as negative control. Data analysis using the 2−ΔΔCt method In this work, relative quantification was performed according to the comparative 2−ΔΔCt method. This method allows estimating gene copy numbers in unknown samples and requires a housekeeping gene of constant copy number in all samples, which permits normalization of the quantitative data. In this work, GAPDH served as the housekeeping gene in all experiments. The ΔΔCt calculation for the relative quantification of adiponecin gene in different treated groups was used as follows ΔΔCt=(Ct, target gene− CtX, GAPDH)x − (Ctc, target gene − Ct, GAPDH), where x is the unknown sample in treated group and c is the control sample. After validation of the method, results for each sample were expressed in N-fold changes in adiponectin gene expression of group×copies, normalized to GAPDH. The result for the gene expression was given by a unitless value through the formula 2−ΔΔCt [24]. Validation of assay It was necessary to check that the primers for the housekeeping gene (GAPDH) and adiponectin had similar amplification efficiencies. Therefore, each primer set was prepared with serially diluted cDNA (1, 1:2, 1:4, 1:6, and 1:8) followed by real-time PCR in separate tubes. The difference of Ct values (ΔCt) between the genes of interest and GAPDH for each Sequence Accession number Product size (bp) NM_144744 139 61.5 NM_017008 101 60 F AATCCTGCCCAGTCATGAAG R CATCTCCTGGGTCACCCTTA F AGTTCAACGGCACAGTCAAG R TACTCAGCACCAGCATCACC Tm (°C) 61.5 60 Author's personal copy Regulation of adiponectin expression by thyroid hormones dilution was calculated and the resultant ΔCt values were plotted against log dilutions. If the slope of the plot of ΔCt values versus log cDNA dilutions for each primer set was similar and approximately zero, the amplification reactions of all genes had the same efficiency and thus, the ΔΔCt calculation could be applied (Dorak, 2006). 197 means followed by posthoc Tukey test. Correlation between adiponectin expression and metabolic factors were analyzed using Spearman rank correlation coefficients. All experimental data were presented as the mean±SD. The level of significance for all tests was set at P<0.05. Softwares Results For DNA sequence analyses and for PCR primer and probe designing, nBLAST (http://www.ncbi.nlm.nih. gov) and Beacon designer 7.01 (PREMIER Biosoft International, Palo Alto,CA, USA) were used, respectively. To analyze qRT-PCR results based on ΔΔCt method, Opticon Monitor 3 software was used. Statistical analyses Data analyses were done using the SPSS 14.0 software package (SPSS Inc., Chicago, IL, USA). One-way ANOVA was used to test differences between various Fig. 1 Adipose tissue adiponectin gene expression in hypothyroid (a) and hyperthyroid (b) rats at days 15 (n=5), 28 (n=5), 42 (n=5) and 2 weeks after treatment cessation (n=5) in comparison to control (untreated) groups. Different letters above each bar represent significant difference at P<.05 Quantitation of adiponectin mRNA levels in adipose tissue of hyper- and hypothyroid rats by quantitative real-time PCR revealed that thyroid hormones significantly change adiponectin gene expression. As shown in Fig. 1a, the level of adipose tissue adiponectin mRNA in the hypothyroidism rats was decreased during the 6-week treatment (P<0.05). The levels of adiponectin mRNA in treated rats were decreased by about 115% after 15 days, 162% after 28 days and 196% after 42 days, of those found in control rats, respectively (P<0.05). Author's personal copy 198 S. Seifi et al. To determine whether the changes in adiponectin gene expression by hypothyroidism were reversible, treatment cessation was done 15 days after the last oral administration of methimazole. Adiponectin mRNA levels in these rats increased significantly by 114% and 145% in comparison to methimazol-treated rats for 28 and 42 days, respectively (P<0.05) (Fig. 1). During the 6-week treatment period, the hypothyroidism group treated with methimazole presented a significantly (P<0.05) decreased T3, T4, fT3 and fT4 concentrations compared to the control group with the progression of time (Table 2). Fifteen days after treatment cessation, there was a remarkable elevation in T3, T4, fT3 and fT4 concentrations (P<0.05) (Table 2). As shown in Fig. 1b, the levels of adipose tissue adiponectin mRNA in the hyperthyroidism rats was increased during the 6-week treatment with the progression of time (P<0.05). The levels of adiponectin mRNA in treated rats were increased by 126% after 15 days, 145% after 28 days and 175% after 42 days, of those found in control rats, respectively (P<0.05). To determine whether hyperthyroidism plays a role in the elevation of adiponectin mRNA in adipose tissue of levothyroxine-treated rats, treatment cessation was done 15 days after the last oral administration of levothyroxine. As shown in Fig. 1b, adiponectin mRNA levels (P<0.05) decreased significantly by 122%, 143% and 163% after treatment cessation in comparison to days 15, 28 and 42 of levothyroxine treatment, respectively. Hyperthyroid rats significantly (P<0.05) increased their T3, T4, fT3 and fT4 concentrations after 15, 28 and 42 days of treatment (Table 3). Fifteen days after treatment cessation, there was a remarkable reduction Table 2 The mean±SD of thyroid hormone concentrations in hypothyroid rats at days 15 (n=5), 28 (n=5), 42 (n=5) and 2 weeks after treatment cessation (n=5) in comparison to control (untreated) groups Day 15 Control Day 28 Within a column, means with different superscripts are significantly different (P<0.05) Hypo Control Day 42 a,b,c,d,e Hypo Day 55 in T3, T4, fT3 and fT4 concentrations (P<0.05) (Table 3). These changes in thyroid hormone concentrations after hyperthyroidism induction and cessation were in accordance with changes in adiponectin mRNA levels in adipose tissue of treated rats. The concentrations of plasma cholesterol, LDL and triglycerides were increased (P<0.05) by treatment with methimazole, while treatment with levothyroxine resulted in reduction (P<0.05) of plasma concentrations of these components after 28 and 42 days of treatment. The concentrations of these components decreased (P<0.05) in hypothyroid rats and increased (P<0.05) in hyperthyroid rats 15 days after treatment cessation. The concentrations of plasma HDL and NEFA were decreased (P<0.05) in hypothyroid rats (Table 4), while in hyperthyroid animals, the plasma concentrations of these components increased (P<0.05) after 28 and 42 days of treatment (Table 5). Treatment cessation for 15 days caused an elevation (P<0.05) of plasma concentrations of HDL and NEFA in methimazole-treated rats (Table 4). The opposite changes of these plasma components were shown in levothyroxine treated groups 15 days after treatment cessation (Table 5). In hypothyroid rats, plasma glucose concentration significantly decreased during the treatment (Table 4), while in hyperthyroid rats, this plasma component significantly (P<0.05) increased after 28 and 42 days of treatment (Table 5). Treatment cessation for 15 days caused an increase (P < 0.05) in plasma glucose concentration in the hypothyroid group (Table 4) and a decrease (P < 0.05) in this component in hyperthyroid rats (Table 5). Adiponectin gene expression levels in adipose tissue of hypothyroid rats correlated positively with T3 (nmol/l) T4 (nmol/l) fT3 (pmol/l) fT4 (pmol/l) 1.02±0.21a 70.66±13.05a 2.29±0.92a 25.51±7.72a b 0.97±0.27 c 0.55±0.20 b 0.93±0.27 3.92±.87 b 58.11±16.30 a 66.13±26.85 22.21±6.71a c 16.12±4.68b b 22.73±8.70a d 1.50±0.49 3.69±0.94 0.31±0.10 28.60±12.85 1.17±0.69 10.01±4.60c Control 1.03±0.39b 68.50±10.60a 3.99±1.49b 21.55±6.15a e b a 22.52±6.52a b 20.78±3.54a Control 0.83±0.29 b 0.96±0.28 c b Hypo Hypocessation d 68.33±.95 a 60.07±21.08 66.27±13.11 a 2.25±0.78 3.48±0.74 Author's personal copy Regulation of adiponectin expression by thyroid hormones Table 3 The mean±SD of thyroid hormones concentrations in hyperthyroid rats at days 15 (n=5), 28 (n=5), 42 (n=5) and 2 weeks after treatment cessation (n=5) in comparison to control (untreated) groups 199 T3 (nmol/l) Day 15 Hyper Control Day 28 Day 42 Within a column, means with different superscripts are significantly different (P<0.05) Day 55 fT3 (pmol/l) fT4 (pmol/l) 1.42±0.27a 106±11.31a 2.65±0.82a 23±9.05a b b b 22.2±6.71b c 4.75±1.96 36.75±8.69c 22.73±8.70b 0.97±0.27 68.33±17.95 c a 1.88±0.41 Control 0.93±0.27b 64±26.85b 3.69±0.94b d c d 45.70±10.64d b 21.55±6.15b b 21.43±4.93b b 20.78±3.54b Hyper 117.2±24.75 3.92±0.87 Hyper 2.63±0.49 159.6±32.88 b Control a,b,c,d T4 (nmol/l) b 1.03±0.39 Hypercessation 68.50±10.60 a d 1.16±0.21 87.66±21.54 b Control b 0.96 ±0.28 T3 (r=0.525, P=0.039), T4 (r=0.564, P=0.023), fT3 (r = 0.497, P = 0.05), fT4 (r = 0.535, P = 0.033) (Table 6). In hyperthyroid rats, there were significant correlations between adiponectin gene expression levels in adipose tissue and T3 (r=0.808, P=0.01), T4 (r=0.708, P=0.005), fT3 (r=0.716, P=0.002), fT4 (r=0.760, P=0.002) (Table 6). Although plasma cholesterol concentrations had negative correlation with adiponectin gene expression levels in hypothyroid (r= −0.321, P=0.226) and hyperthyroid rats (r=−0.450, P=0.106), these correlations were not significant (Table 6). Adiponectin gene expression levels in adipose tissue of hypothyroid rats showed significant negative correlations with concentrations of LDL (r=−0.806, P=0.001), triglyceride (r=−0.825, P=0.001) and significant positive correlations with concentrations of glucose (r=0.674, P=0.004) and HDL (r=0.755, P=0.001) (Table 6). Highly significant positive correlations were found between adiponectin gene expression levels in adipose tissue of hyperthyroid rats and plasma 63.27±13.11 6.9±2.08 3.99±1.49 3.84±0.55 3.48±0.74 concentrations of glucose (r=0.866, P=0.001) and HDL (r=0.839, P=0.001) (Table 6). In addition, plasma concentrations of LDL (r=−0.749, P=0.002) and triglycerides (r=−0.824, P=0.001) had significant positive correlations with adiponectin gene expression levels in adipose tissue of hyperthyroid rats (Table 6). Although hypothyroid and hyperthyroid rats had lower and higher body weights in comparison with euthyroid rats, respectively, these differences were not significant. Discussion Although at the present time, there are numerous data from clinical and experimental studies about the changes of serum adiponectin concentrations in different thyroid dysfunction, these data are conflicting and little is known about the molecular relationship between thyroid hormones actions and the gene expression pattern of adiponectin in different Table 4 The mean±SD of serum cholesterol, LDL, HDL, triglyceride, NEFA and glucose concentrations in hypothyroid rats at days 15 (n=5), 28 (n=5), 42 (n=5) and 2 weeks after treatment cessation (n=5) in comparison to control (untreated) groups Cholesterol (mg/dl) LDL (mg/dl) HDL (mg/dl) Triglyceride (mg/dl) Glucose (mg/dl) NEFA (nmol/l) Day 15 Hypo Control Day 28 Hypo Control Day 42 Hypo Control Day 55 Hypocessation Control a,b,c,d 60.18±1.97a 42.21±0.94a 37.49±1.46a 52.9±3.92a 69.96±1.43a 0.38±0.025a 41.03±1.42b 41.22±0.54a 38.44±0.77a 44.9±2.35b 70.27±1.88a 0.42±0.015b c b 27.14±5.48 b c b 0.25±0.036c 40.10±5.48 a a 0.44±0.02b 25.34±2.28 b a 76.44±2.72 b 40.77±1.31 d 115.9±21.3 b 53.8±1.04 a 42.23±1.01 c 58.02±0.84 a 69.02±4.87 62.11±2.52 b 69.46±0.72 d c 43.86±0.59 92.85±5.43 b 0.2±0.026d 56.31±2.7 43.36±0.72 a 71.71±3.43 0.43±0.007b 0.24±0.026c 41.19±0.78 39.98±0.28 37.03±0.72 96.16±10.05e 42.14±1.6a 33.33±1.15a 53.74±5.13a 68.39±2.74a a b a b 39.65±1.74 a 40.26±1.23 37.24±1.65 71.28±2.32 Within a column, means with different superscripts are significantly different (P<0.05) 71.28±2.32 0.43±0.03b Author's personal copy 200 S. Seifi et al. Table 5 The mean±SD of serum cholesterol, LDL, HDL, triglyceride, NEFA and glucose concentrations in hyperthyroid rats at days 15 (n=5), 28 (n=5), 42 (n=5) and 2 weeks after treatment cessation (n=5) in comparison to control (untreated) groups Cholesterol (mg/dl) LDL (mg/dl) HDL (mg/dl) Triglyceride (mg/dl) Glucose (mg/dl) NEFA (nmol/l) 39.42±0.63a Day 15 Hyper Control b 41.03±1.42 41.22±0.54 34.2±1.71b Day 28 Hyper b 40.77±1.31 42.23±1.01 c Day 42 Hyper b 39.98±0.28 b a 32.18±1.25 38.1±1.2 39.65±1.74a Control 73.19±2.16a 0.49±0.021a b 44.9±2.35 71.27±1.88 a 0.42±0.015b 34.64±2.03c 79.29±1.92b 0.57±0.029c b 69.46±0.72 a 0.44±0.02b 85.37±3.02 c 0.64±0.031d 73.71±3.43 a 0.43±0.007b 39.11±1.47 73.21±2.88 a 0.54±0.032c 42.28±1.65b 71.28±2.32a 38.44±0.77 b 40.10±5.48 d 33.12±2.41 a 41.19±0.78 Day 55 Hypercessation 40.04±0.33a b c 28.73±1.45 Control 45.34±1.72a 32.07±1.23c 54.67±1.77c a Control a,b,c,d 36.62±0.7a a 62.1±1.76 b 37.03±0.72 50.36±2.52 40.26±1.23b 37.24±1.65b Table 6 Multiple correlations performed between adipose tissue adiponectin gene expression and T3, T4, fT3, fT4, cholesterol, LDL, HDL, triglyceride, NEFA and glucose concentrations in hypo- and hyperthyroid rats. Correlation coefficient (r) and statistical significance (P) are indicated Adipose tissue adiponectin mRNA Variables Hypothyroidism Hyperthyroidism r r p p T3 (nmol/l) 0.525* 0.039 0.808** 0.01 T4 (nmol/l) * 0.564 0.023 0.708** 0.005 fT3 (pmol/l) 0.497 0.05 0.716** 0.002 fT4 (pmol/l) 0.535* 0.033 0.760** 0.002 Cholesterol (mg/dl) −0.321 0.226 −0.450 0.106 LDL (mg/dl) −0.806** 0.001 −0.749** 0.002 HDL (mg/dl) 0.755** 0.001 0.839** 0.001 −0.825** 0.001 −0.824** 0.001 0.367 0.161 0.757** 0.002 0.004 ** 0.001 Triglyceride (mg/dl) NEFA (nmol/l) Glucose (mg/dl) ** 0.674 P=0.05 (statistical significance) ** c 33.69±1.28 b 43.36±0.72 a 0.43±0.03b Within a column, means with different superscripts are significantly different (P<0.05) tissues. To our knowledge, this is the first in vivo study determining whether the expression of adiponectin is altered in adipose tissue by experimental hypo- and hyperthyroidism. We observed that adiponectin gene expression level in adipose tissue of hypothyroid rats decreased by the 6-week methimazol treatment. Two weeks after treatment cessation, the level of adiponectin gene expression in adipose tissue of these animals begin to rise. This response is probably due to either a direct * c 43.86±0.59 P=0.01 (statistical significance) 0.866 effect of thyroid hormones on adiponectin regulation or to weight changes induced by thyroid hormones. The latter seems unlikely, since in our hypo- and hyperthyroid rats, a significant weight change was not observed. Our results indicate that hyperthyroidism induction by the 6-week levothyroxine treatment resulted in a concomitant increase in adiponectin gene expression level in rat adipose tissue. These changes in adiponectin mRNA level following hyperthyroidism induction were reversible after 2-week treatment cessation. Changes in adiponectin mRNA levels in adipose tissue of hypo- and hyperthyroid rats were in accordance with changes in thyroid hormone concentrations after hypo- and hyperthyroidism induction and cessation. The concentrations of serum thyroid hormones including T3, T4, fT3 and fT4 increased during the 6-week hypothyroid state progression and begin to decline 2 weeks after hypothyroidism cessation. We observed opposite patterns in thyroid hormone concentrations in hyperthyroid rats. These changes in adiponectin gene expression in adipose tissue of hypo- and hyperthyroid rats suggest that thyroid hormones act at the translation level to regulate the adiponectin production in vivo. Few studies have shown that thyroid hormones had different, and sometimes, opposite effects on adiponectin gene expression in different adipose cell lines. In agreement with our data, Fujimoto et al. found that in cultures of brown adipose tissue, thyroid hormone presented a small stimulatory effect on adiponectin messenger RNA expression and on hormone secretion [16]. However Fasshauer reported that addition of T3 to the culture medium of 3T3-L1 adipocytes did not have any effect on adiponectin gene expression [11]. Author's personal copy Regulation of adiponectin expression by thyroid hormones It has been reported that thyroid hormones can induce the expression of different signal transduction regulatory factors including peroxisome proliferator-activated receptors (PPARs) [32], mature sterol regulatory element-binding protein-1 (SREBP-1) [39] and adipocyte determination and differentiation-dependent factor 1/sterol regulatory element-binding protein 1c transcription factor (ADD1/SREBP1c) [39]. These regulatory factors can bind the promoter regions of several lipogenic genes such as adiponectin and can controls adiponectin gene expression in differentiated adipocytes [28, 38]. For example, PPARγ stimulation increases serum adiponectin by transcriptional induction in adipose tissue because there is a functional PPARresponsive element in human adiponectin promoter [38]. With this background, we hypothesize that changes in adiponectin gene expression that occurs during the experimental hypo- and hyperthyroidism in adipose tissue may be due to direct action of thyroid hormones on PPARs, SREBP-1 and ADD1/SREBP1c expression. To date, no previous studies have evaluated the effects of thyroid hormones on adiponectin gene expression; however, there are numerous conflicting reports about the effects of hypo- and hyperthyroidism on the serum adiponectin in human and animal. For example, human studies have shown that healthy subjects with high adiponectin levels had higher serum-free T4 levels [12]. In rats with propylthiouracil-induced hypothyroidism, serum adiponectin levels were significantly increased as compared to untreated rats [3, 20]. These serum adiponectin increases in hypothyroid rats may be as an adaptive response to reduce body weight associated with thyroid hormone changes because adiponectin concentrations have inverse relationship with body weight changes [4, 17]. Experimental hypothyroidism induced by methimazole treatment in rats was not accompanied by any significant change in serum adiponectin concentrations [3]. Serum adiponectin concentrations have been studied in patients with hypothyroidism, and most of the authors have reported that adiponectin levels remain unmodified in patients with thyroid hypofunction in comparison with euthyroid subjects [5, 18, 27]. However, a few numbers of studies have found low adiponectin levels in hypothyroid subjects [25, 27]. Iglesias et al . reported that in hypothyroid subjects, restoration of normal thyroid hormone levels after levothyroxine therapy was not accompanied by significant changes in circulating adiponectin levels [18]. 201 Human studies evaluating to circulating adiponectin in thyroid hyperfunction have shown variable results. High adiponectin levels have been reported accompanying the elevation of thyroid hormone concentrations in hyperthyroid patients by some investigators [26, 29, 37], whereas other authors have found no significant differences in serum adiponectin between euthyroid and hyperthyroid patients [2, 18, 25]. Data from animal investigation showed that serum adiponectin levels in levothyroxine-treated rats increased in comparison to euthyroid rats [3], whereas Kokkinos et al. reported that serum adiponectin levels were not significantly altered in the plasma of the hyperthyroid rats [20]. These results demonstrate that adipocytes show different responses to thyroid hormone in different in vivo and in vitro conditions. In addition, discrepancies among the studies in humans, as mentioned above, may be due to different etiology of thyroid dysfunction in the analyzed population. Thyroid hormones appear to be important regulators of lipid and carbohydrate metabolism. Hyper- or hypocholestremia, triglyceride and glucose level changes are usually associated with thyroid dysfunction in human and animals [33, 36]. However, precise molecular mechanisms of these disturbances are still poorly understood. One major finding of our study was the decrease in the serum concentrations of cholesterol, LDL, triglyceride and glucose and the increase of HDL serum concentrations in parallel with the increase in thyroid hormone concentrations and adiponectin gene expression levels in hyperthyroid rat. As far as we know, adiponectin can induce the stimulation of glucose uptake in muscle, fatty acid oxidation in muscle and liver and can inhibit hepatic glucose production, cholesterol and triglyceride synthesis and lipogenesis [8, 13, 36, 38]. Taking these findings together, we hypothesized that, in part, some biological effects of thyroid hormones on lipid and carbohydrate metabolism are modulated by changes in adiponectin production from adipose tissue. In agreement with this hypothesis, we found that a decrease in adiponectin gene expression in adipose tissue of hypothyroid rats was associated with increased plasma cholesterol, LDL, triglycerides and glucose concentrations and with decreased serum HDL concentration. This view is supported by recent reports in which low adiponectin levels significantly predict the risk to develop lipid and carbohydrate Author's personal copy 202 disturbances such as insulin resistance and type 2 diabetes [21–23]. Numerous evidence supports that hypothyroidism is associated with atherosclerosis, ischemic heart diseases, atherogenic lipid profile, diastolic hypertension and impaired endothelial function [1, 9, 15]. Recent in vivo studies have shown that adiponectin attenuate formation of atherosclerotic plaques in the injured vessel wall by suppression of the expression of VCAM-1 and class A scavenger receptors [36] and endothelial nitric oxide (NO) generation [6]. Based on our data and the above-mentioned evidence, we suggest that decreased adiponectin gene expression in adipose tissue of hypothyroid subjects is likely to be important in the pathophysiology of atherosclerosis in these patients. The current study provides evidence that adiponectin gene expression in adipose tissue is regulated by thyroid hormones at the translation level. In addition, we observed a close relationship between adipose adiponectin gene expression in thyroid dysfunctions with serum carbohydrate and lipid disturbances. This finding supports the notion that induction or suppression of adiponectin gene expression or secretion in patients with thyroid dysfunction may be a candidate novel therapeutic protocol in these patients. Moreover, additional research is needed to confirm whether adiponectin and its receptor gene expression are regulated in different tissues such as muscle and liver by thyroid hormones. Acknowledgment This study was financially supported by the Shahid Chamran University of Ahvaz (Grant No. 89/3/02/ 44305) and Shiraz Unuversity. References 1. Agdeppa D, Macaron C, Mallik T, Schnuda ND (1979) Plasma high density lipoprotein cholesterol in thyroid disease. J Clin Endocrinol Metnb 49:726–729 2. Altinova AE, Toruner FB, Akturk M, Bukan N, Cakir N, Ayvaz G, Arslan M (2006) Adiponectin levels and cardiovascular risk factors in hypothyroidism and hyperthyroidism. Clin Endocrinol 65:530–535 3. Aragao CN, Souza LL, Cabanelas A, Oliveira KJ, PazosMoura CC (2007) Effect of experimental hypo- and hyperthyroidism on serum adiponectin. Metabolism 56:6– 11 4. Berg AH, Combs TP, Scherer PE (2002) ACRP30/ adiponectin: an adipokine regulating glucose and lipid metabolism. Trends Endocrinol Metab 13:84–89 S. Seifi et al. 5. Botella-Carretero JI, Alvarez-Blasco F, Sancho J, EscobarMorreale HF (2006) Effects of thyroid hormones on serum levels of adipokines as studied in patients with differentiated thyroid carcinoma during thyroxine withdrawal. Thyroid 16:397–402 6. Chen H, Montagnani M, Funahashi T, Shimomura I, Quon MJ (2003) Adiponectin stimulates production of nitric oxide in vascular endothelial cells. J Biol Chem 278:45021–45026 7. Dimitriadis G, Baxter B, Marsh H, Mandarino L, Rizza R, Bergman R, Haymond M, Gerich J (1985) Effect of thyroid hormone excess on action, secretion, and metabolism of insulin in human. Am J Physiol 248:593–601 8. Dogru T, Sonmez A, Tasci I, Yilmaz MI, Kilic S, Ozgurtas T, Eyileten T, Erbil MK, Kocar IH (2006) Plasma adiponectin and insulin resistance in new onset hypertension. Endocrine 29:405–408 9. Dunajska K, Milewicz A, Jcedrzejuk D, Szymczak J, Kuliczkowski W, Salomon P, Biały D, Poczcatek K, Nowicki P (2004) Plasma adiponectin concentration in relation to severity of coronary atherosclerosis and cardiovascular risk factors in middle-aged men. Endocrine 25:215–221 10. Duntas LH (2002) Thyroid disease and lipids. Thyroid 12:287–293 11. Fasshauer M, Klein J, Neumann S, Eszlinger M, Paschke R (2002) Hormonal regulation of adiponectin gene expression in 3T3-L1 adipocytes. Biochem Biophys Res Commun 290:1084–1089 12. Fernández-Real JM, López-Bermejo A, Casamitjana R, Ricart W (2003) Novel interactions of adiponectin with the endocrine system and inflammatory parameters. J Clin Endocrinol Metab 88:2714–2718 13. Fruebis J, Tsao TS, Javorschi S, Ebbets-Reed D, Erickson MR, Yen FT, Bihain BE, Lodish HF (2001) Proteolitic cleavage product of 30-kDa adipocyte complement-related protein increases fatty acid oxidation in muscle and causes weight loss in mice. Proc Natl Acad Sci USA 98:2005– 2010 14. Fruhbeck G, Gomez-Ambrosi J, Muruzabal FJ, Burrell MA (2001) The adipocyte: a model for integration of endocrine and metabolic signaling in energy metabolism regulation. Am J Physiol 280:827–847 15. Fortuño A, Rodríguez A, Gómez-Ambrosi J, Frühbeck G, Díez J (2003) Adipose tissue as an endocrine organ: role of leptin and adiponectin in the pathogenesis of cardiovascular diseases. J Physio Biochem 59:51–60 16. Fujimoto N, Matsuo N, Sumiyoshi H, Yamaguchi K, Saikawa T, Yoshimatsu H, Yoshioka H (2005) Adiponectin is expressed in the brown adipose tissue and surrounding immature tissues in mouse embryos. Biochim Biophys Acta 1731:1–12 17. Heilbronn LK, Smith SR, Ravussin E (2003) The insulinsensitizing role of the fat derived hormone adiponectin. Curr Pharm Des 9:1411–1418 18. Iglesias P, Alvarez FP, Codoceo R, Diez JJ (2003) Serum concentrations of adipocytokines in patients with hyperthyroidism and hypothyroidism before and after control of thyroid function. Clin Endocrinol 59:621–629 19. Kershaw EE, Flier JS (2004) Adipose tissue as an endocrine organ. J Clin Endocrinol Metab 89:2548–2556 Author's personal copy Regulation of adiponectin expression by thyroid hormones 20. Kokkinos A, Mourouzis I, Kyriaki D, Pantos C, Katsilambros N, Cokkinos DV (2007) Possible implications of leptin, adiponectin and ghrelin in the regulation of energy homeostasis by thyroid hormone. Endocr 32:30–32 21. Kubota N, Terauchi Y, Yamauchi T, Kubota T, Moroi M, Matsui J, Eto K, Yamashita T, Kamon J, Satoh H, Yano W, Nagai R, Kimura S, Kadowaki T, Noda T (2002) Disruption of adiponectin causes insulin resistance and neointimal formation. J Biol Chem 277:25863–25866 22. Okamoto Y, Kihara S, Ouchi N, Nishida M, Arita Y, Kumada M, Ohashi K, Sakai N, Shimomura I, Kobayashi H, Terasaka N, Inaba T, Funahashi T, Matsuzawa Y (2002) Adiponectin reduces atherosclerosis in apolipoprotein Edeficient mice. Circulation 106:2767–2770 23. Pérez-Echarri N, Pérez-Matute P, Martínez JA, Marti A, Moreno-Aliaga MJ (2005) Serum and gene expression levels of leptin and adiponectin in rats susceptible or resistant to dietinduced obesity. J Physio Biochem 61:333–342 24. Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29:45 25. Pontikides N, Krassas GE (2007) Basic endocrine products of adipose tissue in states of thyroid dysfunction. Thyroid 17:421–431 26. Saito T, Kawano T, Saito T, Ikoma A, Namai K, Tamemoto H, Kawakami M, Ishikawa S (2005) Elevation of serum adiponectin levels in Basedow disease. Metabolism 54:1461–1466 27. Santini F, Marsili A, Mammoli C, Valeriano R, Scartabelli G, Pelosini C, Giannetti M, Centoni R, Vitti P, Pinchera A (2004) Serum concentrations of adiponectin and leptin in patients with thyroid dysfunctions. J Endocrinol Invest 27:5–7 28. Seo JB, Moon HM, Noh MJ, Lee YS, Jeong HW, Yoo EJ, Kim WS, Park J, Youn BS, Kim JW, Park SD, Kim JB (2004) Adipocyte determination- and differentiationdependent factor 1/sterol regulatory element-binding protein 1c regulates mouse adiponectin expression. J Biol Chem 279:22108–22117 29. Sieminska L, Niedziolka D, Pillich A, Kos-Kudla B, Marek B, Nowak M, Borgiel-Marek H (2008) Serum concentrations of adiponectin and resistin in hyperthyroid Graves’ disease patients. J Endocrinol Invest 31:745–749 30. Soltys BJ, Kang D, Gupta RS (2000) Localization of P32 protein (gC1q-R) in mitochondria and at specific extramitochondrial locations in normal tissues. Histochem Cell Biol 114:245–55 203 31. Tabandeh MR, Hosseini A, Saeb M, Kafi M, Saeb S (2010) Changes in the gene expression of adiponectin and adiponectin receptors (AdipoR1 and AdipoR2) in ovarian follicular cells of dairy cow at different stages of development. Theriogenology 73:659–669 32. Weitzel JM, Hamman S, Jauk M, Lacey M, Filbry A, Radtke C, Iwen KA, Kutz S, Harneit A, Lizardi PM, Seitz HJ (2003) Hepatic gene expression patterns in thyroid hormone-treated hypothyroid rats. J Mol Endocrinol 31:291–303 33. Wilcox HG, Keyes WG, Hale TA, Frank R, Morgan DW, Heimberg M (1982) Effects of triiodothyronine and propylthiouracil on plasma lipoproteins in male rats. J Lipid Res 23:1159–1166 34. Wu X, Motoshima H, Mahadev K, Stalker TJ, Scalia R, Goldstein BJ (2003) Involvement of AMP-activated protein kinase in glucose uptake stimulated by the globular domain of adiponectin in primary rat adipocytes. Diabetes 52:1355–1363 35. Yamauchi T, Kamon J, Minokoshi Y, Ito Y, Waki H, Uchida S, Yamashita S, Noda M, Kita S, Ueki K, Eto K, Akanuma Y, Froguel P, Foufelle F, Ferre P, Carling D, Kimura S, Nagai R, Kahn BB, Kadowaki T (2002) Adiponectin stimulates glucose utilization and fatty-acid oxidation by activating AMP-activated protein kinase. Nature Med 8:1288–1295 36. Yamauchi T, Kamon J, Waki H, Imai Y, Shimozawa N, Hioki K, Uchida S, Ito Y, Takakuwa K, Matsui J, Takata M, Eto K, Terauchi Y, Komeda K, Tsunoda M, Murakami K, Ohnishi Y, Naitoh T, Yamamura K, Ueyama Y, Froguel P, Kimura S, Nagai R, Kadowaki T (2003) Globular adiponectin protected ob/ob mice from diabetes and apoEdeficient mice from atherosclerosis. J Biol Chem 278:2461–2468 37. Yaturu S, Prado S, Grimes SR (2004) Changes in adipocyte hormones leptin, resistin, and adiponectin in thyroid dysfunction. J Cell Biochem 93:491–496 38. Yilmaz MI, Sonmez A, Caglar K, Gok DE, Eyileten T, Yenicesu M, Acikel C, Bingol N, Kilic S, Oguz Y (2004) Peroxisome proliferator-activated receptor γ (PPAR-γ) agonist increases plasma adiponectin levels in type 2 diabetic patients with proteinuria. Endocrine 25:207–214 39. Zhang Y, Yin L, Hillgartner FB (2003) SREBP-1 integrates the actions of thyroid hormone, insulin, cAMP, and medium-chain fatty acids on ACCalpha transcription in hepatocytes. J Lipid Res 44:356–368