Download Demonstration by single-cell PCR that Reed–Sternberg cells and

Journal
of General Virology (2001), 82, 1169–1174. Printed in Great Britain
...................................................................................................................................................................................................................................................................................
Demonstration by single-cell PCR that Reed–Sternberg cells
and bystander B lymphocytes are infected by different
Epstein–Barr virus strains in Hodgkin’s disease
Nathalie Faumont, Talal Al Saati, Pierre Brousset, Claudie Offer, Georges Delsol
and Fabienne Meggetto
Unite! de Physiopathologie Cellulaire et Mole! culaire, UPR 2163-CNRS, CHU-Purpan, Avenue de Grande-Bretagne, 31059 Toulouse Ce! dex,
France
Epstein–Barr virus (EBV) is associated with Hodgkin’s disease (HD). However, EBV-positive
Reed–Sternberg (RS) cells and EBV-positive B lymphocytes co-exist in the same EBV-positive
lymph node affected by HD. In a previous report, using total lymph node DNA, the presence of two
distinct EBV strains was demonstrated, but their cellular localization (i.e. RS cells vs B lymphocytes)
could not be determined. To address this question, three patients with EBV-associated HD were
selected in the present study and single-cell PCR of the latent membrane protein-1 (LMP-1) gene
from isolated RS cells was performed. In one case, it was clear that RS cells and B lymphocytes were
infected by different EBV strains. In the two remaining cases, only one band was detected from total
lymph node DNA. However, single-cell PCR showed that RS cells in each sample were infected by
single EBV strains, which were different from those detected in lymphoblastoid cell lines derived
from EBV-positive B lymphocytes of lymph node cell suspensions from these two patients.
Introduction
Epstein–Barr virus (EBV) is now firmly associated with
Hodgkin’s disease (HD), and a monoclonal and circular
episomal form of the EBV genome is found in Reed–Sternberg
(RS) cells of more than 50 % of patients with HD (Brousset et
al., 1993 ; Herbst et al., 1990 ; Weiss et al., 1987, 1989). EBVpositive RS cells express latent membrane protein-1 (LMP-1)
(Delsol et al., 1992 ; Herbst et al., 1991), which has oncogenic
properties (Baichwal & Sugden, 1988 ; Wang et al., 1985).
Sequences from the carboxy terminus influence cell growth,
differentiation and apoptosis by interacting with the tumour
necrosis factor receptor-associated signalling factors (TRAFs)
and the NF-κB family of transcriptional regulators (Izumi &
Kieff, 1997 ; Kaye et al., 1996). However, in most EBV-positive
cases of HD, affected lymph nodes also contain rare, EBVpositive bystander B lymphocytes (Brousset et al., 1993 ;
Hummel et al., 1992). In a previous report, using total DNA
extracted from lymph nodes affected by HD, we demonstrated
the presence of two distinct EBV strains in the same HD biopsy
(Meggetto et al., 1997). However, their cellular localization (i.e.
Author for correspondence : Fabienne Meggetto.
Fax j33 5 61 49 90 36. e-mail fabienne.meggetto!immgen.cnrs.fr
0001-7395 # 2001 SGM
RS cells vs bystander B lymphocytes) could not be determined
clearly.
In the present study, we studied 13 patients with EBVassociated HD in which EBV-positive RS cells co-existed with
rare, EBV-positive bystander small lymphocytes. Of these
cases, frozen specimens were available for three cases and in
two of them we also had the corresponding lymphoblastoid
cell lines. These cases are different from those reported
previously, which were not included in the present study
because frozen lymph node biopsy specimens were exhausted
(Meggetto et al., 1997). In each case, we performed a PCR
assay to determine the LMP-1 gene sequence, using DNA
extracted from (i) whole lymph node cells and (ii) single RS
cells isolated from tissue sections by micromanipulation. The
analysis of LMP-1 sequence polymorphism using single-cell
PCR demonstrates that, in each case, all RS cells were infected
by the same EBV genome, which may be different from that
infecting bystander B lymphocytes.
Methods
Detection of EBV. EBV was detected by in situ hybridization with
an EBV-(EBER)-PNA probe\FITC kit (DAKO).
PCR analysis of the LMP-1 gene. Total DNA extracted from
lymph node biopsies affected by HD was amplified by the PCR strategy
Downloaded from www.microbiologyresearch.org by
IP: 78.47.27.170
On: Tue, 25 Oct 2016 13:36:34
BBGJ
N. Faumont and others
described by Mehl et al. (1998). Briefly, LMP-1 PCR products were
amplified by nested PCR with two sets of primers. For the 5h-fragment,
the primers were as follows : 8617 (5h GGTCCGTCGCCGGCTCCACTCACGAGCAGG 3h ; B95.8 coordinates 168617–168646) and 9580
(5h CCAAGAAACACGCGTTACTCTGACGTAGCC 3h ; 169551–
169580) ; for nested PCR, 8667 (5h GTTAGAGTCAGATTCATGGCCAGAATCATCG 3h ; 168667–168697) and 9494 (5h CCTGACACACTGCCCTCGAGG 3h ; 169471–169494). For the 3h-fragment, the
primers were as follows : 7832 (5h GCCTGGTAGTTGTGTTGTGCAGAGGTC 3h ; 167832–167858) and 8785 (5h CGATTTTAATCTGGATGTATTACCATGG 3h ; 168758–168785) ; for nested PCR, 7901 (5h
GGCGGAGTCTGGCAACGCCCGGGTCCTTG 3h ; 167901–167929)
and 8702 (5h GCTACCGATGATTCTGGCCATGAATCTGAC 3h ;
168673–168702).
PCR amplification was performed in a final volume of 50 µl containing
1 µl of each primer (50 µM), 5 µl 10i polymerase buffer, 8 µl each dNTP
(1n25 mM), 5 µl DMSO, 500 ng genomic DNA and 1n25 U AmpliTaq
Gold polymerase (Perkin Elmer). Reaction mixtures were covered with
mineral oil, placed in a 480 thermal cycler (Perkin Elmer) and subjected to
the following program : 35 cycles at 94 mC for 1 min, 65 mC (or 55 mC for
the nested PCR) for 1 min and 72 mC for 1 min. For all PCR amplifications,
a pre-PCR heating step at 94 mC for 10 min to activate the AmpliTaq
Gold enzyme and a final period of 10 min at 72 mC to complete the
reaction were included. PCR products were analysed by agarose gel
electrophoresis.
DNA sequencing. Fifty ng of each PCR product was sequenced
with an ABI PRISM dye terminator kit (Perkin Elmer) supplemented with
7n5 pmol of each primer. Reaction mixtures were placed in a 2400 thermal
cycler (Perkin Elmer) and subjected to a program that followed the
manufacturer’s recommendations. Sequence analysis was performed with
the OMIGA software. In addition to the primers used for amplification,
internal primers used for sequencing were : LMP-2 (5h GACTGGACTGGAGGAGCCCTC 3h ; B95.8 coordinates 169319–169339), LMP-4
bis (5h CTCTCTGGAATTTGCACGGA 3h ; 169091–169110), LMP-9S
(5h ATCATTTCCAGCAGAGTCGC 3h ; 168370–168389), LMP-13AS
(5h AACGAGGGCAGACACCACCT 3h ; 168644–168663) and LMP11AS (5h TGATTAGCTAAGGCATTCCCT 3h ; 168075–168095).
Extraction of DNA from single cells. Each isolated cell was
placed in a tube containing 12 µl extraction solution (50 mM Tris–HCl,
pH 8, 10 mM EDTA, 100 mM NaCl, 200 µg\ml proteinase K). After an
overnight proteinase K digestion at 37 mC followed by 10 min inactivation of the proteolytic enzyme at 95 mC, the extracted DNA was
used for PCR amplification.
Results and Discussion
Characterization of different isoforms of the LMP-1
gene in total DNA from lymph node biopsies affected
by HD
All lymph node biopsies affected by HD showed EBVpositive RS cells and bystander B lymphocytes (data not
shown). No other populations of cells in the lymph node were
EBV-positive.
PCR amplifications of the 5h-segment of the LMP-1 gene of
total DNA extracted from the lymph node of the three cases
yielded single fragments. PCR amplification of the 3h region of
cases 2 and 3 yielded only single fragments, whereas two
distinct fragments were obtained for case 1 (designated Ta and
Tb), which were cloned into pGEM-T. Fragments Ta and Tb
BBHA
Table 1. EBV sequences obtained from lymph node
biopsies and lymphoblastoid cell lines
All initial lymph node biopsies contained EBV-positive RS cells and
small B lymphocytes, as demonstrated by EBER1\2 in situ
hybridization. Single RS cells were then isolated from tissue sections
by micromanipulation after immunostaining with anti-LMP-1 antibody
(CS1-4). For each patient, eight single cells were picked for PCR
amplification.
Sequence
T1
Ta and Tb
T2
L2
T3
L3
Characteristics
Fragment produced by PCR amplification of the 5h
region of the LMP-1 gene from total DNA of
patient 1
Fragments produced by PCR amplification of the 3h
region of the LMP-1 gene from total DNA of
patient 1
Unique sequence produced by PCR amplification of
the 5h and 3h regions of the LMP-1 gene from total
DNA of patient 2
Unique sequence produced by PCR amplification
from DNA of a lymphoblastoid cell line generated
from a lymph node suspension from patient 2
Unique sequence produced by PCR amplification of
the 5h and 3h regions of the LMP-1 gene from total
DNA of patient 3
Unique sequence produced by PCR amplification
from DNA of a lymphoblastoid cell line generated
from a lymph node suspension from patient 3
were of different sizes compared with the 3h-fragment amplified
from the standard B95.8 used as a control. These results
suggested that the lymph node of case 1 contained two EBV
strains (Table 1).
In order to substantiate this hypothesis further, the 5h
region (fragment T1) and the 3h regions of both fragments Ta
and Tb of the LMP-1 gene were sequenced after purification
from agarose gel. Fifty ng of each fragment was sequenced.
Except for the presence of the 30 bp deletion, possibly
associated with an increased transforming potential of the
LMP-1 protein (Li et al., 1996), the Ta and Tb fragments
showed different sequences. The Tb fragment contained five
repeats of the 33 bp motif, whereas the Ta fragment contained
only three repeats (the corresponding fragment amplified from
the standard B95.8 isolate contains 4n5 repeats of the 33 bp
motif ; Baer et al., 1984). Most importantly, sequence differences
observed between the two fragments Ta and Tb involved not
only the number of 33 bp repeats but also several point
mutations. In effect, whilst the 5h regions of the genes that
yielded fragments Ta and Tb were identical (i.e. the T1
fragment), four different point mutations (positions 229, 309,
334, 366 and 382) were found in fragment Tb relative to the
B95.8 sequence, whereas two point mutations (positions 338
and 382) were found in fragment Ta (Table 2). These mutations
were responsible for amino acid changes in comparison with
Downloaded from www.microbiologyresearch.org by
IP: 78.47.27.170
On: Tue, 25 Oct 2016 13:36:34
Table 2. Substitutions and deletions in the amino acid sequence of LMP-1 identified in EBV strains infecting RS cells in lymph nodes from patients 1–3
and lymphoblastoid cell lines derived from patients 2 and 3
Results are presented in comparison with the B95.8 reference strain ; only point mutations are shown, in the form nucleotide\encoded amino acid. PCR amplification of the 5h region of the
LMP-1 gene was performed on total DNA from the three patients. The 3h region of the LMP-1 gene was identified from both total DNA extracts and DNA from single RS cells. PCR
amplification of the 3h region of the LMP-1 gene from total DNA of patient 1 yielded two fragments, Ta and Tb. PCR amplification of the 5h region from this patient yield fragment T1.
PCR amplification of the 5h and 3h regions of the LMP-1 gene from total DNA of patients 2 and 3 yielded sequences T2 and T3 and sequences L2 and L3 were obtained by PCR from the
corresponding cell lines. , Not applicable.
B95.8 sequence
Nucleotide position
Nucleotide
382
366
352–343
338
334
322
319
319
309
304
293
282
234
233
231
229
C
T
30 bp deletion
T
A
C
G
GGC
G
C
A
A
G
A
C
G
129
122
110
106
85
G
A
G
T
T
Amino acid
T1
Ta
Tb
T2
L2
T3
L3
Leu
Ser

Leu
Gln
Gln
Gly
Gly
Ser
Asp
Asp
Asp
Gly
Asp
Ala
Ser
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
T\Pro
T\Pro
A\Thr
Deleted
Not deleted
Not deleted
A\Thr
Deleted
Not deleted
Met
Ile
Val
Phe
Ile
T\Ile
A\Tyr
C\Leu
Deleted
C\Ser
G\Arg
G\Glu
A\Ser
ACG\Thr
A\Asn
C\Thr
–
–
–
–
–
–
–
–
–
–
BBHB
Downloaded from www.microbiologyresearch.org by
IP: 78.47.27.170
On: Tue, 25 Oct 2016 13:36:34
A\Asn
A\Glu
G\Gly
G\Gly
A\Arg
C\Ala
G\Gly
C\Thr
A\Asn
T\Ile
T\Ile
G\Gly
A\Arg
C\Leu
A\Tyr
C\Leu
C\Leu
A\Tyr
C\Leu
EBV strains in RS cells and B lymphocytes
3h Region
168175
168225
168265–168294
168308
168320
168357
168366
168365–168367
168395
168409
168443
168476
168621
168623
168629
168635
5h Region
168934
168957
168993
169005
168068
Codon
Sequence
N. Faumont and others
(a)
Fig. 1. PCR amplification of the 3h region of the LMP-1 gene of the virus
present in lymph nodes of patients 2 (T2) and 3 (T3) affected by HD and
in the corresponding lymphoblastoid cell lines (L2 and L3). PCR
amplification of the 3h region of the LMP-1 gene from the prototype B95.8
(953 bp) was used as a positive control (lane j). Amplification from
whole DNA extracted from a tumour tissue sample from patient 2 yielded
a fragment (T2 ; 953 bp) distinct from that obtained from its
corresponding lymphoblastoid cell line (L2 ; 986 bp). Similarly, the two
PCR fragments obtained from patient 3 (T3 and L3) were distinct in size
(938 and 953 bp). Lane k, negative control (EBV-negative T-cell
lymphoma) ; φ, molecular mass markers. Arrowheads indicate the various
fragments.
the standard B95.8 genome (Table 2). Interestingly, these point
mutations in the LMP-1 gene have already been described in
HD and nasopharyngeal carcinoma (Knecht et al., 1993). As
suggested in a previous report (Meggetto et al., 1997), the
results of the present study further support the suggestion that
two EBV stains are present in the lymph node affected by HD
from patient 1, but their cellular localization (RS cells vs
bystander B lymphocytes) cannot be determined from a total
DNA extract.
The results obtained after PCR amplification from DNA
extracts from whole lymph nodes of patients 2 and 3 are more
difficult to explain. In these cases, the lymph node biopsies
showed EBV-positive RS cells associated with scarce (compared to patient 1) EBV-positive bystander lymphocytes. In
contrast to our expectations, only single fragments were found
after five PCR amplification runs on each lymph node DNA
sample from these patients. One possible explanation is that
RS cells and bystander B lymphocytes are infected by the same
EBV strain. Alternatively, two different EBV strains were
present, but only the LMP-1 gene from the EBV that infected
RS cells was amplified in these cases, EBV-positive lymphocytes being too rare to allow amplification of the LMP-1 gene.
To answer this last question, we took advantage of our
previous findings that culture of cells isolated from lymph
nodes affected by HD induced lymphoblastoid–EBV cell lines
originating from bystander B lymphocytes and not from RS
cells (Meggetto et al., 1996). This led us to favour the latter
hypothesis (i.e. EBV-positive lymphocytes are too rare to
allow LMP-1 gene amplification), as PCR amplification of
DNA extracted from lymphoblastoid cell lines obtained from
EBV-positive B lymphocytes of patients 2 and 3 yielded
fragments different in size and sequence from those obtained
from the lymph node DNA (Fig. 1 ; Table 2). In addition, using
PCR for immunoglobulin and Southern blot analysis of the
BBHC
(b)
(c)
Fig. 2. Isolation of a single RS cell from a frozen section of a lymph node
affected by HD and immunostained with anti-LMP-1 antibody (CS1-4).
(a) Tissue section before picking of a single cell, showing closed glass
capillary close to an LMP-1-positive RS cell. Note the lack of staining of
surrounding small lymphocytes. (b) Tissue section after micromanipulation
of the nucleus of the RS cell (APAAP technique with nuclear
counterstaining). Magnification, i400. (c) The nucleus of the RS cell is
transferred by aspiration to an open glass capillary.
fused terminal repeat of the episomal EBV genome, we showed
that these cell lines were monoclonal (data not shown).
To determine further the identity of the EBV strain infecting
RS cells, we investigated the polymorphism of the 3h region by
single-cell PCR.
Single-cell PCR amplification of the LMP-1 gene in RS
cells
For this purpose, 8 µm frozen sections were immunostained
with monoclonal antibodies directed against the LMP-1
protein of EBV [anti-LMP-1 antibody (CS1-4) ; Dako] to
visualize EBV-positive RS cells by the alkaline phosphatase and
monoclonal anti-alkaline phosphatase (APAAP) technique (Fig.
2 a) (Cordell et al., 1984). After overlaying the frozen section
with PBS, eight single cells were picked under the microscope
with a closed glass capillary using a hydraulic micromanipulator and then transferred by aspiration to an open glass
capillary with another micromanipulator (Fig. 2 b, c) (Gravel et
al., 1998). DNA was extracted from each isolated cell as
described in Methods and used for PCR amplification.
PCR amplification of the 3h-segment of the LMP-1 gene
from eight isolated RS cells of patient 1 yielded one fragment
(Fig. 3). The fragments obtained from each RS cell showed the
same size and sequence as the Tb fragment obtained from the
whole lymph node DNA (30 bp deletion, five repeats of the
33 bp motif and the same mutations at positions 229, 309, 334,
366 and 382 ; Table 2). As it is now clearly established that a
Downloaded from www.microbiologyresearch.org by
IP: 78.47.27.170
On: Tue, 25 Oct 2016 13:36:34
EBV strains in RS cells and B lymphocytes
φ + –
Patient 3
T 1
2 3
Patient 2
T 1
2
Patient 1
3 Ta Tb 1
2 3
Fig. 3. Single-cell PCR analysis of the 3h region of LMP-1 of the EBV strain
infecting RS cells. For each patient, eight single cells were picked but PCR
results are shown for only three single cells. Total DNA extracted from the
lymph node of patient 1 yielded two PCR products (Ta and Tb), which
were cloned into pGEM-T. Note that the PCR products from DNA of each
single RS cell from this patient (lanes 1–3) are the same size as the Tb
band (998 bp), indicating that these PCR products are related to
amplification of LMP-1 from the EBV strain infecting RS cells, whereas Ta
(863 bp) is related to bystander B lymphocytes. PCR amplification from
total DNA extracted from the lymph nodes of patient 2 and 3 (lanes T)
yielded only single bands (953 and 938 bp, respectively). These
fragments correspond to the LMP-1 gene of the EBV strain infecting RS
cells, as demonstrated by amplification from DNA of single RS cells (lanes
1–3). EBV-positive bystander lymphocytes were extremely scarce in these
cases and thus not detected by PCR from total DNA extracted from the
lymph node. Lane j, LMP-1 of B95.8 used as a positive control (953 bp
PCR product) ; k, negative control (EBV-negative T cell lymphoma) ; φ,
molecular mass markers. Arrowheads indicate the positions of fragments.
monoclonal EBV genome is localized specifically in the tumour
cells of HD (Anagnostopoulos et al., 1989 ; Weiss et al., 1989),
our results confirmed that RS cells and bystander B lymphocytes in the lymph node from patient 1 were infected by
different virus strains, corresponding to fragments Tb and Ta
(Fig. 3).
Single-cell PCR of the 3h-fragment of the LMP-1 gene from
the eight individual RS cells of the lymph node from patient 2
generated the same fragment (regarding size and sequence) as
that obtained after PCR amplification of total DNA extracts
(Fig. 3 ; Table 2). Of note, this fragment was different from that
obtained from the corresponding lymphoblastoid cell line, L2.
Comparable results were observed for patient 3. As discussed
previously, in the latter two cases, the LMP-1 gene was
amplified from total DNA only from EBV infecting RS cells,
EBV-positive lymphocytes being too rare to allow amplification of the LMP-1 gene.
In most cases of EBV-associated HD, EBV-positive RS cells
and rare, EBV-positive bystander B lymphocytes co-exist in
the same lymph node (Hummel et al., 1992 ; Brousset at al,
1993). In our previous study, based on two cases of EBVassociated HD, we amplified two fragments with a different
LMP-1 polymorphism (Meggetto et al., 1997). We showed a
dual EBV infection in lymph nodes affected by HD, but we
could not completely exclude the possibility that subsets of
tumour cells and small lymphocytes shared the same virus
strain. Using single-cell PCR and sequence analysis of the
LMP-1 gene, we now strengthen the argument that RS cells
and bystander B lymphocytes may be infected by different
EBV isolates.
In previous reports, EBV clonality in HD was based on
RFLP analysis of EBV terminal repeats (Raab-Traub, 1989).
However, we now know that two different EBV strains may
have the same number of terminal repeats (Sato et al., 1990).
On the basis of the LMP-1 sequence, the results of the present
study further confirm that, in RS cells, the EBV genome is
clonal. Our findings are in keeping with those reported by
other groups, which demonstrated by single-cell PCR that RS
cells showed clonal Ig gene rearrangement (Kuppers et al.,
1998 ; Stein & Hummel, 1999).
The question arises as to the origin of these two strains and
whether they could be derived from a unique strain by
accumulation of mutations and recombination events. Coinfection with multiple EBV genotypes is commonly found in
human immunodeficiency virus-positive patients (Berger et al.,
1999 ; Sixbey et al., 1989), but the identification of multiple
virus isolates has not been documented in lymphocytes from
non-immunocompromised patients. Our preliminary results
suggest that EBV strains infecting RS and bystander lymphocytes are phylogenetically related but different from those
found in reactive lymph nodes from patients with nonneoplastic lymphoproliferative disorders (unpublished data).
Whatever the origin of the EBV strains infecting RS cells, it
is possible to speculate that LMP-1 sequence variations may
alter the oncogenic properties and\or the immunogenicity of
the LMP-1 protein.
This work was supported by the Association pour la Recherche sur le
Cancer (ARC contract no. 9312).
References
Anagnostopoulos, I., Herbst, H., Niedobitek, G. & Stein, H. (1989).
Demonstration of monoclonal EBV genomes in Hodgkin’s disease and
Ki-1-positive anaplastic large cell lymphoma by combined Southern blot
and in situ hybridization. Blood 74, 810–816.
Baer, R., Bankier, A. T., Biggin, M. D., Deininger, P. L., Farrell, P. J.,
Gibson, T. J., Hatfull, G., Hudson, G. S., Satchwell, S. C., Seguin, C. and
others (1984). DNA sequence and expression of the B95-8 Epstein–Barr
virus genome. Nature 310, 207–211.
Baichwal, V. R. & Sugden, B. (1988). Transformation of Balb 3T3 cells
by the BNLF-1 gene of Epstein–Barr virus. Oncogene 2, 461–467.
Berger, C., van Baarle, D., Kersten, M. J., Klein, M. R., Al-Homsi, A. S.,
Dunn, B., McQuain, C., van Oers, R. & Knecht, H. (1999). Carboxy
terminal variants of Epstein–Barr virus-encoded latent membrane protein
1 during long-term human immunodeficiency virus infection : reliable
markers for individual strain identification. Journal of Infectious Diseases
179, 240–244.
Brousset, P., Meggetto, F., Chittal, S., Bibeau, F., Arnaud, J., Rubin, B.
& Delsol, G. (1993). Assessment of the methods for the detection of
Epstein–Barr virus nucleic acids and related gene products in Hodgkin’s
disease. Laboratory Investigation 69, 483–490.
Cordell, J. L., Falini, B., Erber, W. N., Ghosh, A. K., Abdulaziz, Z.,
MacDonald, S., Pulford, K. A., Stein, H. & Mason, D. Y. (1984).
Immunoenzymatic labeling of monoclonal antibodies using immune
complexes of alkaline phosphatase and monoclonal anti-alkaline phosphatase (APAAP complexes). Journal of Histochemistry and Cytochemistry
32, 219–229.
Downloaded from www.microbiologyresearch.org by
IP: 78.47.27.170
On: Tue, 25 Oct 2016 13:36:34
BBHD
N. Faumont and others
Delsol, G., Brousset, P., Chittal, S. & Rigal-Huguet, F. (1992).
Correlation of the expression of Epstein–Barr virus latent membrane
protein and in situ hybridization with biotinylated BamHI-W probes in
Hodgkin’s disease. American Journal of Pathology 140, 247–253.
Gravel, S., Delsol, G. & Al Saati, T. (1998). Single-cell analysis of the
t(14 ; 18)(q32 ; q21) chromosomal translocation in Hodgkin’s disease
demonstrates the absence of this translocation in neoplastic Hodgkin and
Reed–Sternberg cells. Blood 91, 2866–2874.
Meggetto, F., Muller, C., Henry, S., Selves, J., Mariame, B., Brousset,
P., Al Saati, T. & Delsol, G. (1996). Epstein–Barr virus (EBV)-associated
lymphoproliferations in severe combined immunodeficient mice transplanted with Hodgkin’s disease lymph nodes : implications of EBVpositive bystander B lymphocytes rather than EBV-infected Reed–
Sternberg cells. Blood 87, 2435–2442.
Meggetto, F., Brousset, P., Selves, J., Delsol, G. & Mariame, B. (1997).
Herbst, H., Niedobitek, G., Kneba, M., Hummel, M., Finn, T.,
Anagnostopoulos, I., Bergholz, M., Krieger, G. & Stein, H. (1990).
Reed–Sternberg cells and ‘ bystander ’ lymphocytes in lymph nodes
affected by Hodgkin’s disease are infected with different strains of
Epstein–Barr virus. Journal of Virology 71, 2547–2549.
High incidence of Epstein–Barr virus genomes in Hodgkin’s disease.
American Journal of Pathology 137, 13–18.
Mehl, A. M., Fischer, N., Rowe, M., Hartmann, F., Daus, H., Trumper,
L., Pfreundschuh, M., Muller-Lantzsch, N. & Grasser, F. A. (1998).
Herbst, H., Dallenbach, F., Hummel, M., Niedobitek, G., Pileri, S.,
Muller-Lantzsch, N. & Stein, H. (1991). Epstein–Barr virus latent
Isolation and analysis of two strongly transforming isoforms of the
Epstein–Barr-virus (EBV)-encoded latent membrane protein-1 (LMP1)
from a single Hodgkin’s lymphoma. International Journal of Cancer 76,
194–200.
Raab-Traub, N. (1989). The human DNA tumor viruses : human
papilloma virus and Epstein–Barr virus. Cancer Treatment and Research 47,
285–302.
membrane protein expression in Hodgkin and Reed–Sternberg cells.
Proceedings of the National Academy of Sciences, USA 88, 4766–4770.
Hummel, M., Anagnostopoulos, I., Dallenbach, F., Korbjuhn, P.,
Dimmler, C. & Stein, H. (1992). EBV infection patterns in Hodgkin’s
disease and normal lymphoid tissue : expression and cellular localization
of EBV gene products. British Journal of Haematology 82, 689–694.
Izumi, K. M. & Kieff, E. D. (1997). The Epstein–Barr virus oncogene
product latent membrane protein 1 engages the tumor necrosis factor
receptor-associated death domain protein to mediate B lymphocyte
growth transformation and activate NF-κB. Proceedings of the National
Academy of Sciences, USA 94, 12592–12597.
Kaye, K. M., Devergne, O., Harada, J. N., Izumi, K. M., Yalamanchili, R.,
Kieff, E. & Mosialos, G. (1996). Tumor necrosis factor receptor
associated factor 2 is a mediator of NF-κB activation by latent infection
membrane protein 1, the Epstein–Barr virus transforming protein.
Proceedings of the National Academy of Sciences, USA 93, 11085–11090.
Knecht, H., Bachmann, E., Brousset, P., Sandvej, K., Nadal, D.,
Bachmann, F., Odermatt, B. F., Delsol, G. & Pallesen, G. (1993).
Deletions within the LMP1 oncogene of Epstein–Barr virus are clustered
in Hodgkin’s disease and identical to those observed in nasopharyngeal
carcinoma. Blood 82, 2937–2942.
Kuppers, R., Hansmann, M. L. & Rajewsky, K. (1998). Clonality and
germinal centre B-cell derivation of Hodgkin\Reed–Sternberg cells in
Hodgkin’s disease. Annals of Oncology 9 (Suppl. 5), S17–S20.
Li, S. N., Chang, Y. S. & Liu, S. T. (1996). Effect of a 10-amino acid
deletion on the oncogenic activity of latent membrane protein 1 of
Epstein–Barr virus. Oncogene 12, 2129–2135.
BBHE
Sato, H., Takimoto, T., Tanaka, S., Tanaka, J. & Raab-Traub, N. (1990).
Concatameric replication of Epstein–Barr virus : structure of the termini in
virus-producer and newly transformed cell lines. Journal of Virology 64,
5295–5300.
Sixbey, J. W., Shirley, P., Chesney, P. J., Buntin, D. M. & Resnick, L.
(1989). Detection of a second widespread strain of Epstein–Barr virus.
Lancet ii, 761–765.
Stein, H. & Hummel, M. (1999). Cellular origin and clonality of classic
Hodgkin’s lymphoma : immunophenotypic and molecular studies.
Seminars in Hematology 36, 233–241.
Wang, D., Liebowitz, D. & Kieff, E. (1985). An EBV membrane protein
expressed in immortalized lymphocytes transforms established rodent
cells. Cell 43, 831–840.
Weiss, L. M., Strickler, J. G., Warnke, R. A., Purtilo, D. T. & Sklar, J.
(1987). Epstein–Barr viral DNA in tissues of Hodgkin’s disease. American
Journal of Pathology 129, 86–91.
Weiss, L. M., Movahed, L. A., Warnke, R. A. & Sklar, J. (1989).
Detection of Epstein–Barr viral genomes in Reed–Sternberg cells of
Hodgkin’s disease. New England Journal of Medicine 320, 502–506.
Received 7 September 2000 ; Accepted 22 December 2000
Downloaded from www.microbiologyresearch.org by
IP: 78.47.27.170
On: Tue, 25 Oct 2016 13:36:34