Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
1 Murine gammaherpesvirus 68 open reading frame 35 is required for efficient lytic 2 replication and latency 3 4 Running title: Characterization of MHV68 ORF35 5 6 The Contents Category for the paper: Animal Viruses – Large DNA 7 8 Shin-ichi Hikita, Yusuke Yanagi, and Shinji Ohno 9 10 Department of Virology, Faculty of Medicine, Kyushu University, Fukuoka 812-8582, 11 Japan 12 13 # 14 Mailing address 15 Shinji Ohno 16 Department of Virology, Faculty of Medicine, Kyushu University, Fukuoka 812-8582, 17 Japan; TEL: +81-92-642-6138 / FAX: +81-92-642-6140; 18 E-mail: soono@virology.med.kyushu-u.ac.jp Corresponding author: 19 20 21 22 23 24 25 26 Summary: 231 words, Text: 4872 words, Tables and figures : 7 27 SUMMARY 28 Murine gammaherpesvirus (MHV) 68, a natural pathogen of field mice, is related to 29 human gammaherpesviruses, Epstein-Barr virus (EBV) and Kaposi's sarcoma-associated 30 herpesvirus (KSHV). The open reading frame (ORF) 35 of MHV68 and its homologues 31 of EBV and KSHV are located in the gene cluster composed of ORF34 to ORF38 in 32 which each gene overlaps with adjacent ones. Although MHV68 ORF35 was reported to 33 be an essential gene, its function during infection is presently unknown. In this study, we 34 show, by analyzing ORF35-transfected cells, that three serine residues in the C-terminus 35 are responsible for the phosphorylation, and that the ORF35 protein forms 36 homo-oligomers via a predicted coiled-coil motif. The ORF35 protein expressed by 37 transfection was preferentially located in the cytoplasm of cells uninfected or infected 38 with MVH68. The recombinant virus lacking ORF35 (35S virus) exhibited the genome 39 replication and expression of lytic proteins comparable to those of the wild-type (WT) 40 virus, but reduced levels of virus production, suggesting that the ORF35 protein acts at 41 the virion assembly and/or egress step. Lytic replication in the lung after intranasal 42 infection and the frequency of ex vivo reactivation from latency after intraperitoneal 43 infection were lower in 35S virus-infected mice than those in mice infected with the WT 44 or marker-reverted virus. Our results indicate that ORF35 is not essential for MHV68 45 lytic replication, but plays an important role in efficient viral replication and reactivation 46 from latency. 47 48 49 50 51 52 INTRODUCTION Human gammaherpesviruses, Epstein-Barr virus (EBV) and Kaposi's sarcoma 53 associated virus (KSHV), are involved in a number of malignant diseases. EBV causes 54 Burkitt's lymphoma, Hodgkin lymphoma, nasopharyngeal carcinoma, and gastric 55 carcinoma (Burke et al., 1990; Epstein et al., 1964; Longnecker et al., 2013; Nonoyama 56 et al., 1973; Weiss et al., 1987), whereas KSHV is a causative agent of Kaposi's sarcoma, 57 multicentric Castleman's disease, and primary effusion lymphoma (Chang et al., 1994; 58 Damania & Cesarman, 2013; Said et al., 1996; Soulier et al., 1995). The narrow host 59 range of EBV and KSHV makes it difficult to study molecular mechanisms of their lytic 60 replication and latency in experimental animals. 61 Murine gammaherpesvirus (MHV) 68, isolated from field mice such as bank 62 voles and wood mice (Blaskovic et al., 1980), is a member of 2-herpesviruses (or 63 Rhadinovirus) and shares sequence homology with the human gammaherpesviruses 64 (Efstathiou et al., 1990; Virgin et al., 1997). Because of the biological and genetic 65 similarity, MHV68 infection is considered to be a useful animal model of human 66 gammaherpesviruses (Barton et al., 2011; Simas & Efstathiou, 1998). In addition, 67 MHV68 lytically infects cells of various species (Svobodova et al., 1982), allowing us to 68 study the lytic infection of gammaherpesviruses. 69 MHV68 has at least 80 genes (Virgin et al., 1997), and shares many genes 70 involved in DNA replication and virion assembly with other herpesviruses (Dunn et al., 71 2003; Virgin et al., 1997; Yu et al., 2003). The open reading frame (ORF) 35 is 72 conserved among gammaherpesviruses including KSHV (Russo et al., 1996), herpesvirus 73 saimili (Albrecht et al., 1992), EBV (Baer et al., 1984), and equine herpesvirus 2 (Telford 74 et al., 1995). The ORF35 gene has been shown to be essential for MHV68 lytic infection, 75 by a signature-tagged mutagenesis screening (Song et al., 2005), but its function in 76 MHV68 replication has not been determined. 77 Although KSHV ORF35 protein is predominantly localized in the cytoplasm 78 (Masa et al., 2008), its role during lytic infection is also poorly understood. In herpes 79 simplex virus (HSV)-1 and -2, UL14, a homologue of ORF35 (Dolan et al., 1998; 80 McGeoch et al., 1988; Mills et al., 2003), exists as a minor component of the virion 81 particle (Cunningham et al., 2000; Wada et al., 1999) and exerts multiple functions 82 including apoptosis inhibition (Yamauchi et al., 2003) and chaperone activity (Yamauchi 83 et al., 2002). An HSV-1 UL14 mutant virus exhibits lower growth efficiency in vitro and 84 lower pathogenicity in experimental mice (Cunningham et al., 2000). 85 In this study, we characterized the properties of MHV68 ORF35. Our results 86 show that ORF35 is not essential for MHV68 replication but plays an important role after 87 the expression of late viral proteins. Intranasal infection of mice with MHV68 lacking 88 ORF35 resulted in lower virus yield during acute replication in the lung. Further, the 89 mutant virus had a defect in reactivation from infected splenocytes. 90 91 92 RESULTS 93 ORF35 is a phosphorylated protein. 94 To characterize the ORF35 protein, we prepared a plasmid expressing ORF35 tagged 95 with the Flag epitope at the N-terminus. Immunoblotting analysis with anti-Flag antibody 96 revealed two specific bands at 26 kD and 28 kD in transfected HEK293T cells (Fig. 1a). 97 We then examined three ORF35 mutants in which 25, 32, or 55 residues from the 98 C-terminus were truncated (C25, C32 and C55) (Fig. 1b and 1c). C25 exhibited two 99 bands like the full-length ORF35, while only a single band was detected in C32- or 100 C55-expressing cells (Fig. 1c). MHV68 ORF35 includes 11 serine and 4 threonine 101 residues which are predicted to be phosphorylated when analyzed by NetPhos 2.0 Server 102 (Center for Biological Sequence Analysis, Technical University of Denmark 103 [http://www.cbs.dtu.dk/services/NetPhos/]) (Fig. 1b). As both C32 and C55 lacked 104 three serine residues at positions 124, 126, and 129 which were phosphorylation 105 candidates (Fig. 1b), we hypothesized that the upper band of full-length ORF35 could be 106 caused by phosphorylation at these serine residues. We constructed the AAA mutant that 107 has all of the three serine residues replaced with alanine. As expected, the AAA mutant 108 gave a single band with the similar molecular weight to that of the lower band of the 109 full-length ORF35 (Fig. 1d), indicating that the upper band is a phosphorylated ORF35 at 110 these serine residues. We evaluated which serine residues of the three were important for 111 the phosphorylation, but the results indicated that all of the three serine residues influence 112 the phosphorylation status to some extent (data not shown). To examine the involvement 113 of other residues in the phosphorylation, we treated the full-length ORF35 or the AAA 114 mutant with alkaline phosphatase. The treatment diminished the upper band of the 115 full-length ORF35 (Fig. 1d). However, the phosphatase did not affect the mobility of the 116 26kD bands of the full-length ORF35 and the AAA mutant, indicating that the three 117 serine residues are solely responsible for the phosphorylation of ORF35. 118 119 A putative coiled-coil motif in ORF35 mediates homo-oligomerization. 120 MHV68 ORF35 protein is predicted to have two coiled-coil motifs (amino acid positions 121 41-73 and 100-112) according to ISREC-Server (SIB ExPASy Bioformatics Resources 122 Portal [http://embnet.vital-it.ch/software/TMPRED_form.html]) (Fig. 2a). As the motif is 123 known to mediate protein-protein interactions, we investigated the oligomer formation of 124 the ORF35 protein. Co-immunoprecipitation (Co-IP) assay using Flag- and HA-tagged 125 ORF35 proteins revealed the interaction between ORF35 proteins (Fig. 2b lane 2 and Fig. 126 2c lane 2). To determine the region(s) responsible for the interaction, we prepared a series 127 of the N- or C-terminus truncated mutants (N17, N26, N33, N56, N76, C16, 128 C25, C32, and C55), and investigated the interaction between the full-length ORF35 129 and each of the truncation mutants or the AAA mutant. The results showed that the 130 residues at positions 34 to 76 were critical, but the phosphorylation was dispensable, for 131 the interaction (Fig. 2b and 2c). Similar results were obtained by Blue-Native (BN) 132 polyacrylamide gel electrophoresis (PAGE). The full length ORF35 and N17, N26 and 133 N33 mutants exhibited two bands around 18 kD and 66 kD likely corresponding to 134 monomer and multimer forms, respectively (Fig. 2d). N56 had the diminished band 135 around 66 kD and formed much smaller complexes. Truncation of N-terminus 76 136 residues almost abolished the complex formation (Fig. 2d). The data implicate the first 137 predicted coiled-coil motif at positions 41 to 73 in oligomer formation of ORF35. 138 Interestingly, the C-terminus truncation mutants tended to efficiently make complexes for 139 unknown reasons (Fig. 2c). 140 141 Repeats of 7 amino acid residues, usually expressed as (a-b-c-d-e-f-g)n , are required to 142 form the coiled-coil motif. In general, nonpolar residues at positions a and d facilitate 143 hydrophobic interactions, whereas polar residues at positions e and g provide binding 144 specificity through electrostatic interactions (Fig. 2a). We analyzed the importance of the 145 charged residues at positions e and g for oligomerization using three substitution mutants; 146 K44E/E49R, R56E/H58E/E63R, and K105E/E107R (Fig.2a). By Co-IP assay, we found 147 that the K44E/E49R and R56E/H58E/E63R exhibited reduced ability to oligemerize with 148 the full-length ORF35, whereas the K105E/E107R still interacted efficiently (Fig. 2c). 149 Taken together, the charged amino acid residues in the first putative coiled-coil motif are 150 likely critical for the homo-oligomerization of the ORF35 protein. 151 152 ORF35 is mainly localized in the cytoplasm. 153 Next, we performed immunofluorescence staining to investigate the subcellular 154 localization of ORF35. When expressed by plasmid-mediated transfection, Flag-ORF35 155 was localized predominantly in the cytoplasm, and only a small part was detected in the 156 nucleus (Fig. 3a and 3b). ORF35-HA and the AAA mutant were also similarly distributed 157 (data not shown). This pattern of the subcellular distribution is similar to that of KSHV 158 ORF35 in transfected cells (Masa et al., 2008). Further, the localization of Flag-ORF35 159 expressed by transfection was not affected by MHV68 infection (Fig. 3b and 3c). 160 161 ORF35 is required for efficient replication in vitro. 162 To examine the role of ORF35 in the life cycle of MHV68, we constructed a bacterial 163 artificial chromosome (BAC) clone encoding the ORF35 stop mutant (35S) virus, which 164 possesses an ectopic stop codon, a frameshift mutation, and a SacI recognition site after 165 the overlapping sequence with ORF34 (Fig. S1a). We also produced a BAC clone to 166 generate the recombinant virus expressing unphosphorylated ORF35 (AAA virus) (Fig. 167 1d). Restriction enzyme digestion and agarose gel electrophoresis confirmed the expected 168 structures for these BAC-cloned genomes (Fig. S1b). 169 170 ORF35 has been reported to be an essential gene (Song et al., 2005). However, NIH3T3 171 cells transfected with BAC-35S developed cytopathic effect (CPE) (data not shown), 172 suggesting that the gene may not be an essential gene. There was no unexpected mutation 173 in the targeted region of the virus genome in the infected cells (data not shown). We also 174 excluded the contamination of 35S with the WT virus, by SacI digestion (Fig.S1c). The 175 SacI marker-reverted (35R) virus and the AAA virus were also recovered without 176 difficulty. After removal of the BAC cassette, all these viruses were used for further 177 experiments. 178 179 Next, we analyzed the growth of the recombinant viruses. The titers of the cell-associated 180 and cell-free 35S virus were around 20-30 times lower than those of WT virus at later 181 time points regardless of M.O.I. (Fig. 4a and 4b). On the other hand, the yield of the 35S 182 virus in NIH3T3/F35 cells stably expressing Flag-ORF35 (Fig S2) was several times 183 higher than that in parental NIH3T3 cells (Fig. 4c), indicating that ORF35 is indeed 184 required for efficient virus growth. Further, the 35R virus exhibited growth kinetics 185 closely similar to WT virus, ascertaining that the attenuated growth of the 35S virus was 186 not due to unexpected mutations in other genes. The phosphorylation of ORF35 appears 187 to exhibit no effect on virus growth, as the AAA virus grew as efficiently as WT and 35R 188 viruses (Fig. 4a and 4b). Taken together, the data indicate that ORF35 is necessary for 189 efficient virus growth. 190 191 The 35S virus exhibits normal genome replication and lytic protein expression. 192 To determine which step(s) in replication of 35S virus was disturbed, we analyzed the 193 genome replication in virus-infected cells. In WT virus-infected cells, the amount of the 194 viral genome at 24 h after infection was around ten times higher than that at 3 h after 195 infection (Fig. 5a). When infected cells were treated with phosphonoacetic acid (PAA), a 196 viral DNA polymerase inhibitor, no genome replication was observed, as expected. All of 197 35S, 35R, AAA and WT viruses exhibited similar levels of the genome amplification 198 (Fig. 5a), indicating that ORF35 does not function before the DNA replication step. 199 200 Next, the expression of virus proteins in infected cells was also analyzed. In WT 201 virus-infected cells, many peptide bands were detected with anti-MHV68 serum at 24 h 202 after infection, and most of them disappeared when the cells were treated with PAA (Fig. 203 5b). Thus, most of the signals seen in WT virus-infected cells were likely viral late 204 proteins, as the expression of these proteins is known to be dependent on viral DNA 205 replication (Johnson & Everett, 1986; Mavromara-Nazos & Roizman, 1987). In 35S 206 virus- or AAA virus-infected cells, the pattern and intensity of the bands detected were 207 almost identical to those in WT virus-infected cells. The data indicate that the lack of 208 ORF35 does not affect the expression of late proteins. 209 210 ORF35 is needed for efficient lytic replication and latency in mice. 211 To examine the growth of recombinant viruses in vivo, anesthetized C57BL/6 mice were 212 intranasally infected with them, and virus titers in the lung were determined at 3 and 6 213 days post-infection. At each time point, the titer of the 35S virus was more than hundred 214 times lower than that of the WT virus, whereas 35R and AAA viruses grew comparably 215 to the WT virus (Fig.6a). The data indicate that ORF35 plays an important role in 216 efficient virus production in vivo. Again, there was no apparent effect of the ORF35 217 phosphorylation on lytic replication in vivo. 218 219 Next, we examined infected mice at the latent phase of infection. Splenomegaly as 220 evaluated by spleen weight, viral genomic copy number in splenocytes, and the frequency 221 of ex vivo reactivation from splenocytes were analyzed at 17 and 24 days after infection. 222 The mean spleen weight of 35S virus-infected mice was lower than that of WT, 35R, or 223 AAA virus-infected mice at 17 and 24 days after intranasal infection (though not 224 statistically significant at the latter time point), possibly reflecting reduced growth of the 225 35S virus in the lung. By contrast, the difference in spleen weight was not observed 226 among mice infected intraperitoneally with these 4 types of viruses (Fig. 6b). The mean 227 genome copy number of 35S virus-infected mice was significantly reduced as compared 228 with that of mice infected with the other types of viruses after intranasal infection (Fig. 229 6c). Again, the difference was not observed when mice were infected intraperitoneally 230 with these viruses. The data indicate that the 35S virus is able to establish latent infection 231 in the spleen almost as efficiently as the WT virus when inoculated intraperitoneally. 232 Notably, the reactivation frequency of the 35S virus was below the detection limit 233 independent of the route of infection (Fig. 6d), indicating that the 35S virus could not be 234 reactivated from the latent state. As preformed infectious viruses in disrupted splenocytes 235 were below the detection limit for any mouse group regardless of the infection route (data 236 not shown), the CPEs observed were caused not by preformed viruses, but by reactivation. 237 Taking together, we conclude that ORF35 also influences reactivation of MHV68 from 238 latency. 239 240 DISCUSSION 241 MHV68 ORF35 has been shown to be essential for lytic infection (Song et al., 2005), but 242 our data using the 35S virus indicate that the gene is not essential but necessary for 243 efficient lytic infection in vitro and in vivo. What accounts for the discrepancy? ORF35 244 homologues are located in the gene cluster comprising ORF34 to ORF38 (Baer et al., 245 1984; Russo et al., 1996; Virgin et al., 1997). In KSHV-infected cells, two polycistronic 246 transcripts are synthesized from the gene cluster, the 3.4 kb mRNA encoding ORF35 to 247 ORF37 and 4.2 kb mRNA encoding ORF34 to ORF37 (Haque et al., 2006; Masa et al., 248 2008). As MHV68 ORF35 is also encoded in a similar manner (data not shown), the 249 insertion of transposons into ORF35 may have affected the stability of the polycistronic 250 mRNA, thereby affecting the expression of the genes (ORF35 to ORF38) encoded in the 251 transcript. Although ORF36, ORF37 and ORF38 were shown to be nonessential 252 (knockout of ORF36 resulted in an attenuated phenotype) (Song et al., 2005), the 253 combined defect of ORF35 to ORF38 may have been lethal for MHV68. Alternatively, a 254 transcriptional control region for an essential gene(s) nearby such as ORF34 may be 255 present in the ORF35 coding region. 256 257 Since the genome replication and expression of lytic proteins in 35S virus-infected cells 258 were comparable to those in WT and 35R virus-infected cells, ORF35 likely functions in 259 the assembly and/or egress step after the production of late proteins. Our finding is 260 consistent with the previous report that HSV-1 UL14, a homologue of ORF35 (Mills et 261 al., 2003), is necessary for the efficient nucleocapsid egress from the nucleus 262 (Cunningham et al., 2000). It is estimated that HSV 1 UL14 is present at no more than a 263 few dozen molecules per virion (Cunningham et al., 2000). ORF35 homologues have not 264 been detected in virions of MHV68, KSHV, and EBV (Bortz et al., 2003; Johannsen et 265 al., 2004; Vidick et al., 2013; Zhu et al., 2005) although ORF35 of rhesus monkey 266 rhadinovirus was found in the virion (O'Connor & Kedes, 2006). 267 268 The 35S virus was able to replicate lytically in NIH3T3 cells in vitro and the mouse lung 269 in vivo (albeit at lower efficiencies) and exhibited virus genomic load similar to those of 270 the other recombinant viruses in splenocytes after intraperitoneal infection, but it failed to 271 reactivate from splenocytes. Since ORF35 is not detected in latently infected cells 272 (Ebrahimi et al., 2003; Martinez-Guzman et al., 2003), it may function at a step(s) after 273 reactivation triggering. The MHV68 lytic replication in myeloma cells was reported to be 274 inefficient (Forrest & Speck, 2008; Sunil-Chandra et al., 1993). This low permissivity of 275 B cells to MHV68 may be a reason for the inability of the 35S virus to reactivate from 276 latently infected cells, because even mild growth impairment of the 35S virus, as 277 compared with the WT virus, would become highly significant in this context. 278 279 Structural analysis revealed that there are two putative coiled-coil motifs in ORF35. The 280 coiled-coil motif is known to mediate protein-protein interactions for such functions as 281 transcription, intracellular transport, and virus entry (Mason & Arndt, 2004; Wang et al., 282 2012). Charged amino acid residues at positions e and g in the coiled-coil motif usually 283 determine the binding specificity for target proteins, and recruit viral or host proteins by 284 making complexes. The first motif was found to be involved in homo-oligomerization of 285 ORF35. The second motif may also have some roles in the function of ORF35. To 286 explore this possibility, we are currently studying host proteins interacting with ORF35. 287 288 MATERIALS AND METHODS 289 Plasmid constructions. The putative ORF35 coding region (Virgin et al., 1997) was 290 tagged with the Flag-epitope at the N-terminus, and subcloned into an expression vector 291 pCA7, a derivative of pCAGGS (Niwa et al., 1991), or a retrovirus vector pMXs-IP 292 (Kitamura et al., 2003). ORF35 tagged with the influenza hemagglutinin (HA) epitope at 293 the C-terminus was subcloned into pCA7. All truncation and amino acid substitution 294 mutants were generated by PCR-based mutagenesis, tagged with the Flag epitope, and 295 subcloned into pCA7. Primer sequences used for subcloning and mutagenesis will be 296 provided upon request. The coding sequence of the P1 bacteriophage cre-recombinase 297 was subcloned into pMXs-IP. 298 299 Cells. HEK293T and NIH3T3 cells were maintained in Dulbecco’s Modified Medium 300 supplemented with 10% FBS and Penicillin/Streptomycin referred to here as culture 301 medium (CM). Plat-E cells, a retrovirus packaging cell line (Morita et al., 2000), were 302 maintained in CM supplemented with 1 g Puromycin ml-1 (InvivoGen) and 10 g 303 Blasticidin ml-1 (InvivoGen). NIH3T3 cells stably expressing Flag-tagged ORF35 304 (NIH3T3/F35 cells) and cre-recombinase (NIH3T3/Cre cells) were generated by 305 infecting the cells with respective retroviruses generated form Plat-E cells transfected 306 with appropriate retrovirus plasmids, followed by 1 g Puromycin ml-1 selection and 307 limiting dilution. 308 309 Viruses. To prepare virus stocks, NIH3T3 cells were infected with each of the 310 recombinant viruses, and both cells and culture medium were collected when CPE was 311 complete. The harvested samples were centrifuged, and the pellets were suspended in CM. 312 After freezing and thawing twice, the samples were centrifuged and the supernatant was 313 kept at -80C. Infectious viruses were titrated by limiting dilution assay using NIH3T3 314 cells and expressed as TCID50. Virus titers of the 35S virus stock were comparable when 315 examined by limiting dilution assay using NIH3T3 and NIH3T3/F35 cells. 316 317 Antibodies and antiserum. Anti-MHV68 sera were harvested from three 318 MHV68-infected mice and pooled. Rabbit anti-Flag polyclonal antibody (pAb) (Sigma; 319 F7425), mouse anti-Flag monoclonal antibody (mAb) (Sigma; F1804), Rabbit anti-HA 320 pAb (MBL; 561 ), rabbit anti-Lamin A pAb (Santa Cruz Biotech; sc-20680), mouse 321 anti-Tubulin mAb (Santa Cruz Biotech; sc-5286), goat anti-rabbit IgG conjugated with 322 horse radish peroxidase (HRP) (Amersham Biosciences), goat-anti mouse IgG conjugated 323 with HRP (Jackson ImmunoResearch), donkey anti-mouse IgG (H+L) conjugated with 324 Alexa Fluor 488 or 594 (Molecular Probes), and donkey anti-rabbit IgG (H+L) 325 conjugated with Alexa Fluor 488 or 594 (Molecular Probes) were purchased from 326 indicated suppliers. 327 328 Immunoprecipitaition. HEK293T cells were transfected with appropriate combinations 329 of expression plasmids. At 24 h after transfection, the cells were washed with PBS and 330 lysed with IP buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.5% Nonidet P-40, 1 mM 331 EDTA, 5% glycerol) supplemented with the protease inhibitor cocktail (Sigma). 332 Insoluble debris was removed by centrifugation, and a small amount of the supernatant 333 was kept as the whole cell lysate (WCL) sample. The remaining supernatant was 334 pre-cleared by incubating with Protein-A Sepharose (GE Healthcare), and then mixed 335 with fresh Protein-A Sepharose and appropriate antibody. After washing intensively with 336 IP buffer without the protease inhibitor cocktail, proteins in the precipitate were 337 solubilized in the SDS loading buffer (Ito et al., 2013) and boiled. 338 339 Dephosphorylation assay. Dephosphorylation assay was performed as previously 340 reported (Jia et al., 2005). HEK293T cells were transfected with the expression plasmid 341 of interest. At 48 h after transfection, the cells were re-suspended into NEB Buffer 3 (100 342 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT; New England BioLabs) 343 followed by freezing and thawing twice. Cell debris was removed by centrifugation and 344 the supernatant was treated with calf intestine alkaline phosphatase (New England 345 BioLabs) or mock treated. After adding the same volume of 2SDS loading buffer, the 346 sample was boiled. 347 348 Immunoblotting. NIH3T3 cells were infected with each of the recombinant viruses at an 349 M.O.I. of 0.5. Proteins in WCL at 24 h after infection were separated in 350 SDS-polyacrylamide gel, and transferred onto polyvinylidene difluoride (PVDF) 351 membranes. The membrane was blocked with Tris-buffered saline containing 0.05% 352 Tween-20 (TBS-T) and 5% skim milk, followed by the treatment with suitable 353 combinations of antibodies. After washing three times, the membrane was treated with 354 Chemi-Lumi One Super (Nacalai Tesque) for signal detection using VersaDoc 5000 355 imager (Bio-Rad). 356 357 BN- PAGE. HEK293T cells were transfected with appropriate expression plasmids. At 358 24 h after transfection, the cells were washed with PBS and lysed with NativePAGE 359 Sample Buffer (Invitrogen) supplemented with 5% n-dodecyl β-D-maltoside (DDM; 360 Invitrogen) and 0.05% Coomassie brilliant blue G250 (Invitrogen). Lysed proteins were 361 separated in 5-20% gradient gel, incubated with 20mM Tris-HCl (pH7.4) containing 362 150mM Glycine and 0.1% SDS at room temperature for 5 min, and then transferred onto 363 PVDF membranes. The membranes were incubated with 50mM Tris-HCl (pH7.4) 364 containing 2% SDS and 0.8% 2-mercaptoethanol at 55C for 30 min, and followed by 365 blocking and immunodetection as above. 366 367 Indirect immunofluorescent assay. NIH3T3 cells were infected with MHV68 for 1 h or 368 left uninfected. The supernatant was replaced with fresh medium and the cells were 369 transfected with pCA7-Flag-ORF35. At 17 h after transfection, the cells were stained 370 with appropriate combinations of antibodies (Ito et al., 2013). The stained cells were 371 observed under a confocal microscope (Radiance 2100; Bio-Rad). 372 373 Virus growth in cultured cells. NIH3T3 and NIH3T3/F35 cells were infected with each 374 of the recombinant viruses for 1 h at an M.O.I. of 0.05 or 3. At indicated days after 375 infection, infectious viruses in cells and supernatants were titrated, respectively. 376 377 Animal infection. All animal experiments were reviewed by the Institutional Committee 378 of Ethics on Animal Experiments of the Faculty of Medicine, Kyushu University, and the 379 facility guidelines for animal experiments and care were strictly followed. Sex- and 380 age-matched C57BL/6 mice were anesthetized by the mixture of medetomidine, 381 midazolam, and butorphanol, and then infected intranasally or intraperitoneally with 105 382 TCID50 of the recombinant viruses. The infected mice were housed in ventilated isolation 383 cages during infection. At 3 and 6 days after infection, virus titers in lung homogenates 384 were determined (Flach et al., 2009). At 17 and 24 days after infection, spleens were 385 harvested, weighed, and prepared for single cell suspensions. After removing red blood 386 cells, splenocytes were counted and used for the determination of reactivation frequency 387 and DNA isolation. 388 389 Ex vivo reactivation assay. A series of three-fold dilutions of splenocytes mixture 390 starting from 1.5 105 cells / well were overlaid on NIH3T3 cells seeded on 96-well 391 plate beforehand (Adler et al., 2001; Weck et al., 1996). The appearance of CPE in each 392 well was observed up to 2 weeks after overlay and the reactivation frequency of each 393 diluent was calculated. The presence of pre-formed infectious virus was checked 394 following the same procedure using splenocytes disrupted by freezing and thawing twice. 395 396 Measurement of viral genome copy number by real-time PCR. NIH3T3 cells infected 397 with each of the recombinant viruses were cultured with or without 200 g PAA (Sigma) 398 ml-1. DNA was extracted from virus-infected NIH3T3 cells at 3 h and 24 h after infection, 399 or mouse splenocytes using the GenElute Mammalian Genomic DNA Miniprep Kit 400 (Sigma) following the manufacturer's instructions. Quantitative PCR was carried out 401 using SYBR Premix Ex Taq II (Takara) and a Light Cycler 1.5 (Roche). A primer set for 402 ORF57 was used to quantify the virus genome and mouse ribosomal L8 gene (L8) was 403 also amplified for normalization (TABLE 1) (Flach et al., 2009). The PCR fragments of 404 ORF57 and L8 were subcloned and used as standard plasmids. For the copy number in 405 virus-infected NIH3T3 cells, data are shown as the copy number at 24 h after infection 406 relative to that at 3 h after infection. For the genomic load in splenocytes, the data are 407 shown as the copy number of ORF57 relative to 1000 copies of the ribosomal L8 gene. 408 409 Statistics. Statistical significance was analyzed using the unpaired Student’s t-test. 410 411 ACKNOWLEDGMENTS 412 We appreciate the technical assistance from The Research Support Center, Kyushu 413 University Graduate School of Medical Sciences. We also thank H. Adler and T. 414 Kitamura for generously providing the MHV68 BAC plasmid, and the retrovirus vector 415 and packaging cells, respectively. This study was supported in part by JSPS KAKENHI 416 grant 26460558. 417 418 REFERRENCES 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 Adler, H., Messerle, M. & Koszinowski, U. H. (2001). Virus Reconstituted from Infectious Bacterial Artificial Chromosome (BAC)-Cloned Murine Gammaherpesvirus 68 Acquires Wild-Type Properties In Vivo Only after Excision of BAC Vector Sequences. Journal of virology 75, 5692-5696. Albrecht, J. C., Nicholas, J., Biller, D., Cameron, K. R., Biesinger, B., Newman, C., Wittmann, S., Craxton, M. A., Coleman, H., Fleckenstein, B. & et al. (1992). Primary structure of the herpesvirus saimiri genome. Journal of virology 66, 5047-5058. Araujo, P. R., Yoon, K., Ko, D., Smith, A. D., Qiao, M., Suresh, U., Burns, S. C. & Penalva, L. O. (2012). Before It Gets Started: Regulating Translation at the 5' UTR. Comp Funct Genomics 2012, 475731. Baer, R., Bankier, A. T., Biggin, M. D., Deininger, P. L., Farrell, P. J., Gibson, T. J., Hatfull, G., Hudson, G. S., Satchwell, S. C., Seguin, C., Tuffnell, P. S. & Barrell, B. G. (1984). DNA-Sequence and Expression of the B95-8 Epstein-Barr Virus Genome. Nature 310, 207-211. Barton, E., Mandal, P. & Speck, S. H. (2011). Pathogenesis and host control of gammaherpesviruses: lessons from the mouse. Annual review of immunology 29, 351-397. Blaskovic, D., Stancekova, M., Svobodova, J. & Mistrikova, J. (1980). Isolation of five strains of herpesviruses from two species of free living small rodents. Acta virologica 24, 468. Bortz, E., Whitelegge, J. P., Jia, Q., Zhou, Z. H., Stewart, J. P., Wu, T. T. & Sun, R. (2003). Identification of proteins associated with murine gammaherpesvirus 68 virions. Journal of virology 77, 13425-13432. Burke, A. P., Yen, T. S., Shekitka, K. M. & Sobin, L. H. (1990). Lymphoepithelial carcinoma of the stomach with Epstein-Barr virus demonstrated by polymerase chain reaction. Modern pathology : an official journal of the United States and Canadian Academy of Pathology, Inc 3, 377-380. Calvo, S. E., Pagliarini, D. J. & Mootha, V. K. (2009). Upstream open reading frames cause widespread reduction of protein expression and are polymorphic among humans. Proceedings of the National Academy of Sciences 106, 7507-7512. Chang, Y., Cesarman, E., Pessin, M. S., Lee, F., Culpepper, J., Knowles, D. M. & Moore, P. S. (1994). Identification of Herpesvirus-Like DNA-Sequences in Aids-Associated Kaposis-Sarcoma. Science 266, 1865-1869. Cunningham, C., Davison, A. J., MacLean, A. R., Taus, N. S. & Baines, J. D. (2000). Herpes Simplex Virus Type 1 Gene UL14: Phenotype of a Null Mutant and Identification of the Encoded Protein. Journal of virology 74, 33-41. Damania, B. & Cesarman, E. (2013). Kaposi’s Sarcoma-Associated Herpesvirus, p2080-2128: In Knipe DM, Howley PM (ed), Fields Virology, 6th ed., Wolters Kluwer Health/Lippincott Williams & Wilkins Co, Philadelphia, PA. Dolan, A., Jamieson, F. E., Cunningham, C., Barnett, B. C. & McGeoch, D. J. (1998). The genome sequence of herpes simplex virus type 2. Journal of virology 72, 2010-2021. 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 Dunn, W., Chou, C., Li, H., Hai, R., Patterson, D., Stolc, V., Zhu, H. & Liu, F. (2003). Functional profiling of a human cytomegalovirus genome. Proceedings of the National Academy of Sciences 100, 14223-14228. Dutia, B. M., Clarke, C. J., Allen, D. J. & Nash, A. A. (1997). Pathological changes in the spleens of gamma interferon receptor-deficient mice infected with murine gammaherpesvirus: a role for CD8 T cells. Journal of virology 71, 4278-4283. Ebrahimi, B., Dutia, B. M., Roberts, K. L., Garcia-Ramirez, J. J., Dickinson, P., Stewart, J. P., Ghazal, P., Roy, D. J. & Nash, A. A. (2003). Transcriptome profile of murine gammaherpesvirus-68 lytic infection. The Journal of general virology 84, 99-109. Efstathiou, S., Ho, Y. M., Hall, S., Styles, C. J., Scott, S. D. & Gompels, U. A. (1990). Murine Herpesvirus 68 Is Genetically Related to the Gammaherpesviruses Epstein-Barr-Virus and Herpesvirus Saimiri. The Journal of general virology 71, 1365-1372. Epstein, M. A., Achong, B. G. & Barr, Y. M. (1964). Virus Particles in Cultured Lymphoblasts from Burkitts Lymphoma. Lancet 1, 702-703. Flach, B., Steer, B., Thakur, N. N., Haas, J. & Adler, H. (2009). The M10 locus of murine gammaherpesvirus 68 contributes to both the lytic and the latent phases of infection. Journal of virology 83, 8163-8172. Forrest, J. C. & Speck, S. H. (2008). Establishment of B-cell lines latently infected with reactivation-competent murine gammaherpesvirus 68 provides evidence for viral alteration of a DNA damage-signaling cascade. Journal of virology 82, 7688-7699. Haque, M., Wang, V., Davis, D. A., Zheng, Z. M. & Yarchoan, R. (2006). Genetic organization and hypoxic activation of the Kaposi's sarcoma-associated herpesvirus ORF34-37 gene cluster. Journal of virology 80, 7037-7051. Ito, M., Iwasaki, M., Takeda, M., Nakamura, T., Yanagi, Y. & Ohno, S. (2013). Measles Virus Nonstructural C Protein Modulates Viral RNA Polymerase Activity by Interacting with Host Protein SHCBP1. Journal of virology 87, 9633-9642. Jia, Q., Chernishof, V., Bortz, E., Mchardy, I., Wu, T.-T., Liao, H.-I. & Sun, R. (2005). Murine Gammaherpesvirus 68 Open Reading Frame 45 Plays an Essential Role during the Immediate-Early Phase of Viral Replication. Journal of virology 79, 5129-5141. Johannsen, E., Luftig, M., Chase, M. R., Weicksel, S., Cahir-McFarland, E., Illanes, D., Sarracino, D. & Kieff, E. (2004). Proteins of purified Epstein-Barr virus. Proceedings of the National Academy of Sciences of the United States of America 101, 16286-16291. Johnson, P. A. & Everett, R. D. (1986). DNA-Replication Is Required for Abundant Expression of a Plasmid-Borne Late Us11 Gene of Herpes-Simplex Virus Type-1. Nucleic acids research 14, 3609-3625. Kitamura, T., Koshino, Y., Shibata, F., Oki, T., Nakajima, H., Nosaka, T. & Kumagai, H. (2003). Retrovirus-mediated gene transfer and expression cloning: Powerful tools in functional genornics. Exp Hematol 31, 1007-1014. 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 Kronstad, L. M., Brulois, K. F., Jung, J. U. & Glaunsinger, B. A. (2013). Dual short upstream open reading frames control translation of a herpesviral polycistronic mRNA. Plos Pathog 9, e1003156. Kronstad, L. M., Brulois, K. F., Jung, J. U. & Glaunsinger, B. A. (2014). Reinitiation after Translation of Two Upstream Open Reading Frames (ORF) Governs Expression of the ORF35-37 Kaposi's Sarcoma-Associated Herpesvirus Polycistronic mRNA. Journal of virology 88, 6512-6518. Longnecker, R., Kieff, E. & Cohen, J. I. (2013). Epstein-Barr Virus, p1898-1959: In Knipe DM, Howley PM (ed), Fields Virology, 6th ed., Wolters Kluwer Health/Lippincott Williams & Wilkins Co, Philadelphia, PA. Martinez-Guzman, D., Rickabaugh, T., Wu, T. T., Brown, H., Cole, S., Song, M. J., Tong, L. & Sun, R. (2003). Transcription program of murine gammaherpesvirus 68. Journal of virology 77, 10488-10503. Masa, S.-R., Lando, R. & Sarid, R. (2008). Transcriptional regulation of the open reading frame 35 encoded by Kaposi's Sarcoma-associated herpesvirus. Virology 371, 14-31. Mason, J. M. & Arndt, K. M. (2004). Coiled coil domains: stability, specificity, and biological implications. Chembiochem : a European journal of chemical biology 5, 170-176. Mavromara-Nazos, P. & Roizman, B. (1987). Activation of herpes simplex virus 1 gamma 2 genes by viral DNA replication. Virology 161, 593-598. McGeoch, D. J., Dalrymple, M. A., Davison, A. J., Dolan, A., Frame, M. C., McNab, D., Perry, L. J., Scott, J. E. & Taylor, P. (1988). The complete DNA sequence of the long unique region in the genome of herpes simplex virus type 1. The Journal of general virology 69, 1531-1574. Mills, R., Rozanov, M., Lomsadze, A., Tatusova, T. & Borodovsky, M. (2003). Improving gene annotation of complete viral genomes. Nucleic acids research 31, 7041-7055. Morita, S., Kojima, T. & Kitamura, T. (2000). Plat-E: an efficient and stable system for transient packaging of retroviruses. Gene therapy 7, 1063-1066. Niwa, H., Yamamura, K. & Miyazaki, J. (1991). Efficient Selection for High-Expression Transfectants with a Novel Eukaryotic Vector. Gene 108, 193-199. Nonoyama, M., Huang, C. H., Pagano, J. S., Klein, G. & Singh, S. (1973). DNA of Epstein-Barr virus detected in tissue of Burkitt's lymphoma and nasopharyngeal carcinoma. Proceedings of the National Academy of Sciences of the United States of America 70, 3265-3268. O'Connor, C. M. & Kedes, D. H. (2006). Mass Spectrometric Analyses of Purified Rhesus Monkey Rhadinovirus Reveal 33 Virion-Associated Proteins. Journal of virology 80, 1574-1583. Russo, J. J., Bohenzky, R. A., Chien, M. C., Chen, J., Yan, M., Maddalena, D., Parry, J. P., Peruzzi, D., Edelman, I. S., Chang, Y. & Moore, P. S. (1996). Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus (HHV8). Proceedings of the National Academy of Sciences of the United States of America 93, 14862-14867. 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 Said, J. W., Chien, K., Takeuchi, S., Tasaka, T., Asou, H., Cho, S. K., deVos, S., Cesarman, E., Knowles, D. M. & Koeffler, H. P. (1996). Kaposi's sarcoma-associated herpesvirus (KSHV or HHV8) in primary effusion lymphoma: Ultrastructural demonstration of herpesvirus in lymphoma cells. Blood 87, 4937-4943. Simas, J. P. & Efstathiou, S. (1998). Murine gammaherpesvirus 68: a model for the study of gammaherpesvirus pathogenesis. Trends in microbiology 6, 276-282. Song, M. J., Hwang, S., Wong, W. H., Wu, T. T., Lee, S., Liao, H. I. & Sun, R. (2005). Identification of viral genes essential for replication of murine gamma-herpesvirus 68 using signature-tagged mutagenesis. Proceedings of the National Academy of Sciences of the United States of America 102, 3805-3810. Soulier, J., Grollet, L., Oksenhendler, E., Cacoub, P., Cazalshatem, D., Babinet, P., Dagay, M. F., Clauvel, J. P., Raphael, M., Degos, L. & Sigaux, F. (1995). Kaposi's sarcoma-associated herpesvirus-like DNA sequences in multicentric Castleman's disease. Blood 86, 1276-1280. Sunil-Chandra, N. P., Efstathiou, S. & Nash, A. A. (1993). Interactions of murine gammaherpesvirus 68 with B and T cell lines. Virology 193, 825-833. Svobodova, J., Blaskovic, D. & Mistrikova, J. (1982). Growth characteristics of herpesviruses isolated from free living small rodents. Acta virologica 26, 256-263. Telford, E. A., Watson, M. S., Aird, H. C., Perry, J. & Davison, A. J. (1995). The DNA sequence of equine herpesvirus 2. Journal of molecular biology 249, 520-528. Vidick, S., Leroy, B., Palmeira, L., Machiels, B., Mast, J., François, S., Wattiez, R., Vanderplasschen, A. & Gillet, L. (2013). Proteomic Characterization of Murid Herpesvirus 4 Extracellular Virions. PLoS ONE 8, e83842. Virgin, H. W. t., Latreille, P., Wamsley, P., Hallsworth, K., Weck, K. E., Dal Canto, A. J. & Speck, S. H. (1997). Complete sequence and genomic analysis of murine gammaherpesvirus 68. Journal of virology 71, 5894-5904. Wada, K., Goshima, F., Takakuwa, H., Yamada, H., Daikoku, T. & Nishiyama, Y. (1999). Identification and characterization of the UL14 gene product of herpes simplex virus type 2. The Journal of general virology 80, 2423-2431. Wang, Y., Zhang, X., Zhang, H., Lu, Y., Huang, H., Dong, X., Chen, J., Dong, J., Yang, X., Hang, H. & Jiang, T. (2012). Coiled-coil networking shapes cell molecular machinery. Molecular Biology of the Cell 23, 3911-3922. Weck, K. E., Barkon, M. L., Yoo, L. I., Speck, S. H. & Virgin HW, I. V. (1996). Mature B cells are required for acute splenic infection, but not for establishment of latency, by murine gammaherpesvirus 68. Journal of virology 70, 6775-6780. Weiss, L. M., Strickler, J. G., Warnke, R. A., Purtilo, D. T. & Sklar, J. (1987). Epstein-Barr viral DNA in tissues of Hodgkin's disease. The American journal of pathology 129, 86-91. Yamauchi, Y., Daikoku, T., Goshima, F. & Nishiyama, Y. (2003). Herpes Simplex Virus UL14 Protein Blocks Apoptosis. Microbiology and Immunology 47, 685-689. 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 Yamauchi, Y., Wada, K., Goshima, F., Daikoku, T., Ohtsuka, K. & Nishiyama, Y. (2002). Herpes simplex virus type 2 UL14 gene product has heat shock protein (HSP)-like functions. Journal of cell science 115, 2517-2527. Yu, D., Silva, M. C. & Shenk, T. (2003). Functional map of human cytomegalovirus AD169 defined by global mutational analysis. Proceedings of the National Academy of Sciences 100, 12396-12401. Zhu, F. X., Chong, J. M., Wu, L. & Yuan, Y. (2005). Virion proteins of Kaposi's sarcoma-associated herpesvirus. Journal of virology 79, 800-811. 622 623 624 TABLE TABLE. 1 Primer sequence used for quantitative PCR Name ORF57-upper ORF57-lower L8-upper L8-lower 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 5' CCTGAAGAGAACCCCTTGC CGCCTGGCTGATACTTTAGG CATCCCTTTGGAGGTGGTA CATCTCTTCGGATGGTGGA 3' 644 FIGURE LEGENDS 645 Fig. 1 ORF35 is a phosphorylated protein. (a) Expression of Flag-ORF35 protein. 646 HEK293T cells were transfected with the vector expressing Flag-ORF35 or empty 647 plasmid. Whole cell lysates at 24 h after transfection were immunoblotted using anti-Flag 648 pAb. The addition of the Flag epitope reduced the protein mobility in the SDS-PAGE. 649 (b) Putative phosphorylated residues in MHV68 ORF35. Amino acid sequence of ORF35 650 is shown with single letters. Putatively phosphorylated serine (S) and threonine (T) 651 residues are highlighted. Underlines indicate the deleted region of the truncation mutants. 652 aa; amino acid residues. (c) Expression of truncated ORF35 proteins. HEK293T cells 653 were transfected with each of expression vectors, and the expression of C-terminally 654 truncated ORF35 proteins tagged with Flag epitope was analyzed by immunoblotting 655 using anti-Flag pAb. (d) Dephosphorylation assay. HEK293T cells were transfected with 656 each of expression plasmids, and cell lysates were treated with calf intestine alkaline 657 phosphatase (ALP) or mock treated. The samples were analyzed by immunoblotting. 658 659 Fig. 2 A putative coiled-coil motif in ORF35 mediates homo-oligomerization. (a) A 660 schematic illustration of truncation mutants and the predicted coiled-coil motifs in 661 ORF35. ORF35 protein and Flag epitope are shown as white and dark-gray boxes, 662 respectively. The numbers indicate amino acid residue positions of ORF35 in the 663 full-length and mutant constructs. Amino acid sequences of predicted coiled-coil motifs 664 in ORF35 (positions 41 to 73 and 100 to 112) are shown with single capital letters. Small 665 letters above the residues indicate the tentative positions (a to g) in the coiled-coil motif. 666 Amino acid residues replaced in the mutants are highlighted. (b and c) Co-IP assay of 667 N-terminally truncated mutants and AAA mutant (b) and C-terminally truncated mutants 668 and mutants with amino acid substitutions (c). HEK293T cells were transfected with each 669 of expression plasmids along with the ORF35-HA expression vector. At 24 h after 670 transfection, proteins were precipitated with anti-Flag mAb and examined by 671 immunoblotting. (d) BN-PAGE analysis. HEK293T cells were transfected with each 672 expression plasmid. At 24 h after transfection, proteins were separated by BN-PAGE, 673 blotted onto PVDF membrane, and reacted with anti-Flag mAb. 674 675 Fig. 3 Subcellular localization of ORF35 protein. (a and b) NIH3T3 cells were 676 transfected with pCA7-Flag-ORF35. At 24 h after transfection, the Flag epitope (red) and 677 Tubulin (a) or Lamin A (b) (green) were doubly stained. (c) NIH3T3 cells were infected 678 with MHV68 at an M.O.I. of 3 for 1 h and then transfected with pCA7-Flag-ORF35. At 679 17 h after transfection, the Flag epitope (red) and Lamin A (green) were doubly stained. 680 681 Fig. 4 Growth kinetics of ORF35 mutant viruses in vitro. (a and b) Growth kinetics of 682 recombinant viruses. NIH3T3 cells were infected with each of the BAC-removed viruses 683 at an M.O.I. of 0.05 (a) or 3 (b), and infectious viruses in culture supernatant or 684 cell-associated virus were titrated at indicated days after infection. (c) Growth kinetics of 685 the 35S virus in NIH3T3 and NIH3T3/F35 cells. Respective cells were infected with the 686 35S virus at an M.O.I. of 0.05, and infectious viruses were titrated at indicated days after 687 infection. 688 689 Fig. 5 Genome replication and lytic protein expression in virus-infected cells. (a) 690 Genome replication in NIH3T3 cells. Cells were infected with indicated viruses at an 691 M.O.I. of 0.5 and incubated with or without PAA. At 3 h and 24 h after infection, DNAs 692 were isolated and analyzed by real-time PCR. The data were normalized by the cellular 693 ribosomal L8 gene and expressed as relative increase of the copy number at 24 h after 694 infection as compared with that at 3 h. (b) Expression of lytic proteins. NIH3T3 cells 695 were infected with indicated viruses at an M.O.I. of 0.5 and incubated with or without 696 PAA. Expression of lytic proteins was analyzed by immunoblotting using anti-MHV68 697 serum. 698 699 Fig. 6 Lytic replication and latency of recombinant viruses in mice. (a) Lytic 700 replication in the lung. C57BL/6 mice were infected intranasally with 105 TCID50 of 701 indicated viruses. At 3 and 6 days after infection, virus titers in the lung were determined. 702 Each symbol represents an individual mouse and the bar indicates the mean value. N; the 703 number of mice in each group. (b) Evaluation of splenomegaly at 17 and 24 days after 704 infection. Mean spleen weight with standard deviation is shown. N; the number of mice 705 in each group. (c) Viral genomic load in the spleen at 17 and 24 days after infection. The 706 copy number of ORF57 relative to 1000 copies of the ribosomal L8 gene is shown. Each 707 symbol represents an individual mouse and the bar indicates the mean value. N; the 708 number of mice in each group. (d) Ex vivo reactivation from splenocytes. Mice were 709 infected with 105 TCID50 of indicated viruses intranasally or intraperitoneally. At 17 and 710 24 days after infection, a set of three fold dilutions of splenocyte mixture were overlaid 711 onto NIH3T3 cells. Frequency of CPE positive well was calculated. N; the number of 712 mice analyzed in each group. 713 714