* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Identification of Pseudomonas proteins coordinately
Signal transduction wikipedia , lookup
Peptide synthesis wikipedia , lookup
Paracrine signalling wikipedia , lookup
Ribosomally synthesized and post-translationally modified peptides wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Interactome wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Gene regulatory network wikipedia , lookup
Metalloprotein wikipedia , lookup
Point mutation wikipedia , lookup
Protein–protein interaction wikipedia , lookup
Magnesium transporter wikipedia , lookup
Western blot wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Gene expression wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Expression vector wikipedia , lookup
Genetic code wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Biosynthesis wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Microbiology (2003), 149, 2909–2918 DOI 10.1099/mic.0.26454-0 Identification of Pseudomonas proteins coordinately induced by acidic amino acids and their amides: a two-dimensional electrophoresis study Avinash Sonawane,1 Ute Klöppner,1 Sven Hövel,2,3 Uwe Völker2,3,4 and Klaus-Heinrich Röhm1 Correspondence Klaus-Heinrich Röhm roehm@staff.uni-marburg.de 1 Philipps-University Marburg, Institute of Physiological Chemistry, D-35032 Marburg, Germany 2 Philipps-University Marburg, Department of Biology, Laboratory for Microbiology, D-35032, Marburg, Germany 3 Max-Planck-Institute for Terrestrial Microbiology, D-35043 Marburg, Germany 4 Ernst-Moritz-Arndt-University, Medical Faculty, Laboratory for Functional Genomics, D-17487 Greifswald, Germany Received 2 May 2003 Revised 14 July 2003 Accepted 14 July 2003 The acidic amino acids (Asp, Glu) and their amides (Asn, Gln) are excellent growth substrates for many pseudomonads. This paper presents proteomics data indicating that growth of Pseudomonas fluorescens ATCC 13525 and Pseudomonas putida KT2440 on these amino acids as sole source of carbon and nitrogen leads to the induction of a defined set of proteins. Using mass spectrometry and N-terminal sequencing, a number of these proteins were identified as enzymes and transporters involved in amino acid uptake and metabolism. Most of them depended on the alternative sigma factor s54 for expression and were subject to strong carbon catabolite repression by glucose and citrate cycle intermediates. For a subset of the identified proteins, the observed regulatory effects were independently confirmed by RT-PCR. The authors propose that the respective genes (together with others still to be identified) make up a regulon that mediates uptake and utilization of the abovementioned amino acids. INTRODUCTION Plant-growth-promoting rhizobacteria (PGPRs) are microorganisms with a potential to enhance crop yields. They can contribute to plant growth by biofertilization, by secretion of growth hormones or by the production of antibiotics that control pathogenic fungi and competing bacteria (Bloemberg & Lugtenberg, 2001). In recent years, several groups have initiated projects with the aim of elucidating the interactions between plant roots and rhizosphere microorganisms. In most of these studies, fluorescent pseudomonads have been used; these inhabit the rhizospheres of most crop plants. Although progress is still slow, it is now well established that root exudates play a central role in plant–PGPR interactions. Exudate components are thought to attract beneficial micro-organisms to the rhizosphere and also to promote their survival in this special environment. One approach to characterize the effects of exudate components on rhizobacteria is to search for bacterial genes that are differentially expressed in the rhizosphere, or in the Abbreviations: MALDI-PSD, -TOF, matrix-assisted laser desorption/ ionization-post source decay, -time-of-flight; PGA, periplasmic glutaminase/asparaginase. 0002-6454 G 2003 SGM presence of root exudates (van Overbeek & van Elsas, 1995; Bayliss et al., 1997). Although a number of such genes have been identified, the precise roles of most of them have remained elusive. The main organic components of root exudates are sugars, various organic acids and a number of amino acids (Fan et al., 1997). Although sugars account for most of the organic matter in exudates, there is no evidence indicating that they play a major role in plant–bacterial interactions. Lugtenberg et al. (1999) could not find a significant contribution of sugars to tomato root colonization by a well-studied Pseudomonas biocontrol strain. On the other hand, it was shown that root exudates can induce bacterial enzymes that are involved in the metabolism of amino acids such as proline (Vilchez et al., 2000a, b) or lysine (Espinosa-Urgel & Ramos, 2001). The predominant amino acids in root exudates are the acidic amino acids aspartate (Asp) and glutamate (Glu) and their amides asparagine (Asn) and glutamine (Gln) (Barber & Gunn, 1974; Jones & Darrah, 1993). Glu and Gln are key intermediates in nitrogen metabolism. In E. coli and other enterobacteria all nitrogen-containing compounds derive their nitrogen from Glu or Gln (Reitzer, 1996a, b). Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Tue, 09 May 2017 00:28:29 Printed in Great Britain 2909 A. Sonawane and others Nevertheless, Glu and Gln are inferior to NH+ 4 in supporting the growth of enteric bacteria. In pseudomonads the situation is different. We have recently shown that several strains of Pseudomonas fluorescens and Pseudomonas putida rapidly grow on acidic amino acids and their amides, even when supplied as the sole source of carbon and nitrogen (Sonawane et al., 2003). All of these amino acids strongly and specifically induce periplasmic glutaminase/asparaginase (PGA) (Hüser et al., 1999). On the other hand, PGA is subject to carbon catabolite repression by glucose and dicarboxylic acids such as succinate, fumarate and 2oxoglutarate. A PGA knockout mutant was unable to utilize Gln whereas growth on Glu, Asn and Asp was unimpaired. In order to examine whether the acidic amino acids and their amides, in addition to regulating PGA expression, induce a more general response in pseudomonads, we used two-dimensional polyacrylamide gel electrophoresis (2DPAGE) to compare gene expression in pseudomonads in the presence and absence of these amino acids. METHODS Protein identification by N-terminal sequencing. Spots of Bacterial strains and growth conditions. P. fluorescens ATCC 13525 or P. putida KT2440 (Bagdasarian & Timmis, 1982) and an isogenic rpoN-null mutant of the latter strain (Köhler et al., 1989) were used for the experiments. The cells were cultivated with shaking at 30 uC in LB broth or in M9 minimal medium (Sambrook et al., 1989) supplemented with various carbon and nitrogen sources. To investigate the effect of nutrients on growth and enzyme activity, cultures were first pregrown overnight in M9 medium supplemented with NH4Cl (19 mM) and glucose (22 mM). Then the cells were washed and aliquots transferred to fresh M9 medium supplemented with (a) NH+ 4 /glucose as above, (b) amino acids (10 mM) as the sole source of carbon and nitrogen, or (c) glutamate (10 mM)+alternative carbon sources (glucose, sucrose, fumarate, 2-oxoglutarate, 10 mM each). PGA assay. Glutaminase/asparaginase (PGA) activities were measured with L-aspartic b-hydroxamate as the substrate (Derst et al., 1992). Briefly, 20 ml enzyme solution was added to 30 ml of 1 mM substrate in 50 mM MOPS, pH 7?0. After an incubation for 5–60 min at room temperature, the reaction was terminated and colour developed by adding 240 ml stop solution (1 M Na2CO3 containing 2 %, w/v, 8-hydroxyquinoline in dimethyl sulfoxide and 1 %, w/v, NaIO4). After 5 min, the A655 was measured in a Bio-Rad 3550-UV microplate reader. Protein concentrations were determined by the BCA method using bovine serum albumin as the standard. One unit of PGA activity is the amount of enzyme hydrolysing 1 mmol 21 L-aspartic acid b-hydroxamate min under these conditions. Sample preparation for 2D gel electrophoresis. Bacteria were usually harvested 4–6 h after transfer to fresh medium and collected by centrifugation. After washing with M9 salt solution, the pellet was resuspended in TE/PMFS buffer (10 mM Tris, 1 mM EDTA, 0?1 mM PMSF, pH 7?5) cooled on ice and disrupted by sonication (Sonoplus, Bandelin; 1564 s). The homogenate was centrifuged for 10 min at 10 000 r.p.m. and then twice for 30 min at 14 000 r.p.m. Proteins were precipitated by the addition of 5 vols ice-cold acetone (analytical grade), incubated overnight at 220 uC, and then collected by centrifugation at 0 uC. 2D gel electrophoresis. For isoelectric focussing (IEF), proteins were solubilized in a rehydration solution containing 8 M urea, 2 M 2910 thiourea, 4 % (w/v) CHAPS, 28 mM DTT, 1?3 % (v/v) Pharmalytes, pH 3–10 and bromophenol blue. After rehydration for 24 h under low-viscosity paraffin oil, Immobiline DryStrips (IPG strips 18 cm NL; Amersham Biosciences) covering a pH range of 3–10 were subjected to isoelectric focussing with the following voltage/time profile: linear increase from 0 to 500 V for 1000 V h, 500 V for 2000 V h, linear increase from 500 to 3500 V for 10 000 V h and a final phase of 3500 V for 35 000 V h up to a total of 48 000 V h. After IEF, the individual strips were consecutively incubated in equilibration solutions A and B, each for 15 min [50 mM Tris/HCl, pH 6?8, 6 M urea, 30 % (v/v) glycerol, 4 % (w/v) SDS, with 3?5 mg DTT ml21 (solution A); or 45 mg iodoacetamide ml21 instead of DTT (solution B)]. In the second dimension, proteins were separated on 12?5 % SDS-polyacrylamide gels with the Investigator System (Perkin Elmer Life Sciences) at 2 W per gel. For routine use proteins were visualized by silver staining. Gels intended for MALDI-TOF analysis were stained with PhastGel Coomassie R350 according to the manufacturer’s instructions (Amersham BioSciences). Scanned images were analysed with the Melanie3 software package (Bio-Rad) to facilitate identification of differentially expressed spots. For quantitative densitometry the BandLeader program (Magnitec) was used. Separate gels of each condition were analysed and only spots were labelled that displayed the same pattern (i.e. up- or down-regulation) in all replicates. interest were transferred to a PVDF membrane by electroblotting using the semi-dry method (Kyhse-Anderson, 1984). Sequencing was performed by Dr D. Linder, Giessen. Protein identification by peptide mass fingerprinting. Protein spots were excised from stained 2D gels. Pooled extracts from three to nine gels were destained and digested with trypsin (Promega). Peptides were extracted according to Otto et al. (1996). They were purified with C18 tips according to the manufacturer’s instructions (Millipore) and eluted with 75 % acetonitrile/2 % trifluoroacetic acid (v/v). Peptide solutions were mixed with an equal volume of saturated a-cyano-3-hydroxycinnamic acid solution in 50 % acetonitrile/ 0?1 % trifluoroacetic acid (v/v) and applied to a sample template for a MALDI-TOF (matrix-assisted laser desorption/ionization time-offlight) mass spectrometer. Peptide masses were determined in the positive ion reflector mode in a Voyager DE RP mass spectrometer (PerSeptive Biosystems) with internal calibration. Mass accuracy was usually in the range between 10 and 50 p.p.m. Peptide mass fingerprints were compared to databases using the program MS-Fit (http://prospector.ucsf.edu). Spots that could not be identified by the above method were further analysed by MALDI-Post Source Decay (PSD) sequencing (Protagen AG, Bochum, Germany). Semi-quantitative RT-PCR. RNA was isolated from mid-exponential- phase cells using the RNeasy minikit (Qiagen). Residual DNA was removed by digestion for 30 min at 37 uC with 1 U ml21 RNase-free DNase (Promega). The reaction was stopped by adding 1 ml RQ1 DNase stop solution and incubated at 65 uC for 10 min. The reverse transcription was carried out using 1 mg RNA in a 20 ml reaction mixture containing 16 RT buffer, 0?1 mM dNTP, 50 pmol oligo(dT) primer, 5 mM MgCl2, 20 mM DTT, 2 U RNaseOUT Recombinant RNase inhibitor, 0?25 U SUPERSCRIPT II RT (Invitrogen). PCR was carried out in 50 ml reaction mixtures, containing 2 ml of the RT reaction as template for Pfu Turbo DNA polymerase (0?5 U, Stratagene), 100 pmol of each primer (Table 1), 0?2 mM dNTP, and amplified for 26 cycles. The PCR sequence used was: 94 uC, 60 s; 54 uC, 30 s; 72 uC, 4 min and 72 uC, 5 min. cDNA-specific primers (listed in Table 1) were derived from the P. putida KT2440 genome (Nelson et al., 2002). Ten microlitres of RT-PCR products was then subjected to electrophoresis in a 1?5 % agarose gel and visualized by staining with ethidium bromide. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Tue, 09 May 2017 00:28:29 Microbiology 149 Pseudomonas protein induction by amino acids Table 1. Oligonucleotides used for RT-PCR experiments in this study (for, forward; rev, reverse) Protein Rho factor Glutaminase/asparaginase (PGA) ABC transporter ATP-binding protein Gene rho ansB ? Aspartase aspA Porin D oprD Fumarase C fumC RESULTS Selection of strains In a previous study we adressed the question whether amino acids in root exudates are involved in the communication between root-colonizing pseudomonads and their host plants. We compared type strains of P. fluorescens and P. putida and a number of root-colonizing pseudomonads as to their ability to utilize amino acids as sources of carbon and/or nitrogen (Sonawane et al., 2003). Extracts from P. fluorescens ATCC 13525 were then used to study proteins differentially expressed in the presence of amino acids. While these experiments were in progress, the full genome sequence of the efficient root colonizer P. putida KT2440 became available (Nelson et al., 2002). For this reason P. putida KT2440 was selected for further 2D-PAGE experiments. Primers for: rev: for: rev: for: rev: for: rev: for: rev: for: rev: ATCCTGCTGGACTCGATCAC GAGCGGTTGATGTTGATGG CTGTCCTGGGTCTTGGTCAT GTATGGCTATGGCAACGTCA CACATCATGGTCATGCCTTC ACCTGACCATCACCGAGAAC GGTTGATTTCGGTCAGCAGT ACCTGCACCCTAACAACGAC AGACCCGCATGCTGTATTTC ACTGGTCACCCACTTTCAGC ATACGGCCAGTACCCACGTA GTAGCTGCTTGACTGCACCA as a repressor. As described elsewhere (Sonawane et al., 2003), PGA induction by Asn and Asp is delayed as compared to that by Glu and Gln. Therefore, full PGA induction by Asp or Asn was only seen in samples taken after 24 h. Protein production during growth of P. fluorescens ATCC 13525 on amino acids In order to identify further proteins differentially expressed in the presence of acidic amino acids and/or their amides, we Regulation of PGA expression by amino acids and alternative carbon sources As reported previously, the expression of periplasmic glutaminase/asparaginase (PGA) in pseudomonads is strongly and specifically enhanced by acidic amino acids and their amides, while good carbon sources such as glucose or tricarboxylic acid cycle intermediates repress PGA production (Hüser et al., 1999). Surprisingly, in P. fluorescens ATCC 13525, Asp and Glu rather than Asn and Gln were found to be the actual inducers, while in P. putida KT2440 the time-courses of PGA induction by Asn and Asp on the one hand, or Gln and Glu on the other, were almost the same (Sonawane et al., 2003). As in P. fluorescens ATCC 13525, the expression of PGA in P. putida KT2440 is subject to carbon catabolite repression by good carbon sources. Fig. 1 shows the effects of sugars (glucose, sucrose) and intermediates of the citric acid cycle (2-oxoglutarate, fumarate) on PGA expression. Glucose, fumarate and 2-oxoglutarate almost completely prevented PGA induction by Glu, while sucrose, which is not metabolized by P. putida KT2440, was much less effective http://mic.sgmjournals.org Fig. 1. Regulation of PGA activity in P. putida KT2440. Cells were pre-grown overnight in M9 medium containing 22 mM glucose and 19 mM NH4Cl (NH+ 4 /Glc), washed and transferred to the same medium or M9 medium containing 10 mM each of glutamate (Glu), glutamine (Gln), aspartate (Asp) or asparagine (Asn) as sole source of C and N. Other cultures were supplied with 10 mM glutamate and 22 mM glucose (Glu+Glc), 10 mM glutamate and 10 mM sucrose (Glu+Sucr), 10 mM glutamate and 10 mM fumarate (Glu+Fum) or 10 mM glutamate and 10 mM 2-oxoglutarate (Glu+2-OG). Specific activities of PGA were measured 6 h (open bars) and 24 h (filled bars) after transfer. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Tue, 09 May 2017 00:28:29 2911 A. Sonawane and others performed 2D-PAGE experiments with cell extracts prepared at different times (2–6 h) after transfer from NHz4 / glucose to media containing amino acids alone or in combination with fumarate. Fig. 2 shows such gels obtained with P. fluorescens ATCC 13525. The extracts were prepared 6 h after transfer from NHz4 /glucose to the same medium (Fig. 2a) or to M9 containing L-Asn (Fig. 2b), L-Asp (Fig. 2c) or L-Asn in combination with 10 mM fumarate (Fig. 2d). Major spots upregulated under these conditions (Pf1–Pf6, Pf for P. fluorescens) are marked by squares and circles. Two of the spots marked in Fig. 2 could be assigned to known proteins. By MALDI-TOF mass spectrometry, protein Pf1 was identified as PGA. N-terminal sequencing of Pf2 yielded the sequence AELTGTLKKINDXGT, which closely matches the N-termini of several periplasmic binding proteins associated with ABC transporters. They include (a) (b) (c) (d) Fig. 2. Two-dimensional electrophoresis maps (pH 4–9) of soluble proteins expressed by P. fluorescencs ATCC 13525 during growth on M9 medium containing 5 mM NH4Cl and 22 mM glucose (NH+ 4 /Glc, a), M9 medium supplemented with 10 mM L-asparagine (Asn, b), with 10 mM L-aspartate (Asp, c), or with 10 mM Asn and 10 mM fumarate (Asp+Fum, d). Major protein spots upregulated in each case are marked by squares (a) or circles (b–d). Spots used as references in densitometric measurements (see Fig. 3) are marked by arrows in (a). 2912 Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Tue, 09 May 2017 00:28:29 Microbiology 149 Pseudomonas protein induction by amino acids Spots Pf1–Pf6 responded in a similar fashion to different carbon and nitrogen sources. Fig. 3 compares their relative densities estimated by quantitative densitometry. Although the extent of induction and carbon catabolite repressions varied to some extent, the same general pattern was seen with all spots examined. As compared to growth on NHz4 / glucose, their expression was strongly upregulated by Asn and Asp, while the effect of Asn was markedly reduced by fumarate. Density (arbitrary units) 6000 5000 4000 3000 2000 1000 Pf1 Pf2 Pf3 Pf4 Pf5 Pf6 Fig. 3. Differential protein expression during growth of P. fluorescens ATCC 13525 on different media: M9 minimal medium supplemented with 5 mM NH4Cl and 22 mM glucose (NH+ 4/ Glc), with 10 mM asparagine (Asn), with 10 mM aspartate (Asp), or with 10 mM asparagine and 10 mM fumarate (Asn+Fum). Cell extracts containing equal amounts of protein were analysed by 2D gel electrophoresis. Spots Pf1–Pf6 (see Fig. 2) of each gel were quantified by densitometry. The figure shows integrated densities of these spots as estimated by the program BandLeader. They were calibrated by reference to spots not significantly affected by medium composition (marked by arrows in Fig. 2a). the P. aeruginosa PA1342 gene product, the product of the P. putida KT2440 gene PP1071 as well as putative Gln-binding proteins from Bacillus subtilis (Wu & Welker, 1991) and Rhodospirillum rubrum (glnA, [gi:2599566]). Identification of Glu-induced proteins in P. putida KT2440 2D gels loaded with extracts from P. putida KT2440 yielded comparable results to those seen with P. aeruginosa. A group of 8–10 major spots were coordinately upregulated by Glu and repressed by good carbon sources. Other proteins were more strongly expressed in cells grown on NH+ 4/ glucose. In the experiment illustrated in Fig. 4, a total of 13 spots (Pp1–Pp13, Pp for P. putida) were selected, extracted from several gels, pooled, digested with trypsin and analysed by MALDI-TOF or MALDI-PSD mass spectrocopy. Except for Pp2 and Pp7, all spots could be identified and assigned to proteins deduced from the P. putida KT2440 genome. Table 2 summarizes the results of the mass spectrometric analysis. The table lists the names of the encoding genes, their known or putative functions, as well as isoelectric points, and molecular masses calculated from the genome data. In addition, the dependency of induction/repression on the presence of the alternative sigma factor RpoN and the Fig. 4. Two-dimensional electrophoresis maps (pH 4–9) of soluble proteins expressed by P. putida KT2440 during growth on M9 medium containing 5 mM NH4Cl and 22 mM glucose (NH+ 4 /Glc) and M9 medium supplemented with 10 mM glutamate (Glu) as the sole source of C and N. Selected proteins upregulated during growth on Glu (Pp1–Pp9) and NH+ 4 /Glc (Pp10–Pp13) are marked by circles. http://mic.sgmjournals.org Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Tue, 09 May 2017 00:28:29 2913 A. Sonawane and others Table 2. Characteristics of differentially expressed protein spots in P. fluorescens ATCC 13525 (Pfn) and P. putida KT2440 (Ppn) Spot Identified as Identified by* Locus Induced during growth on Glu in P. fluorescens ATCC 13525 Pf1 Glutaminase/asparaginase (PGA) PM (7) ansB Pf2 ABC transporter amino-acid-binding protein Seq (PP1071) Induced during growth on Glu in P. putida KT2440 Pp1 Transcription termination factor Rho PSD (12) rho (PP5214) Pp2 Not identified Pp3, Pp4 Glutaminase/asparaginase (PGA) PM (11) ansB (PP2453) Pp5 ABC transporter ATP-binding protein PSD (2) ? (PP1068) Pp6 Aspartate ammonia-lyase (aspartase) PSD (7) aspA (PP5338) Pp7 Not identified Pp8 Outer-membrane porin D PSD (2) oprD (PP 1206) Pp9 Carboxyphosphonoenolpyruvate phosphonoPSD (3) ? (PP1389) mutase (putative) Induced during growth on glucose+NH4Cl in P. putida KT2440 Pp10 2,4-Diaminobutyrate-2-oxoglutarate transaminase PSD (4) gabT (PP4223) Pp11 Fumarase PM (7) fumC (PP0944) Pp12 Sugar ABC transporter sugar-binding protein PSD (6) (PP1015) Pp13 Putrescine ABC transporter putrescine-binding PSD (2) potF (PP5181) protein pIcalc Masscalc (kDa) Expressed in RpoN” strain Repressed by fumarate 6?6 7?0 36?2D 30?7D 2 2 + + 7?7 47?0 6?6 8?2 5?7 36?1D 28?1 51?5 4?8 5?1 46?1D 31?8 2 2 2 2 + 2 2 2 + 2 + + (2) (+) + + 6?5 5?7 5?7 6?1 48?8 48 45?4 40?1 (+) + + + (2) 2 2 2 *PM (n), identified from peptide masses (n=number of peptides). PSD (n), identified by MALDI-PDS (n=number of matching peptides). Seq, identified by N-terminal sequencing. DMass calculated without leader peptide. influence of carbon catabolite repression elicited by the presence of fumarate in the growth medium are indicated. RT-PCR analysis of Glu-induced gene expression in P. putida KT2440 To ascertain whether the effects of Glu detected at the protein level are indeed taking place at the level of transcription, we used RT-PCR to examine the levels of mRNA for several of the proteins differentially expressed in the absence or presence of Glu. Total RNA was isolated from cells grown on NH+ 4 /Glc or Glu and transcribed into cDNA, which was then amplified by PCR. Care was taken to use equal amounts of cells (based on protein content) and identical reaction conditions in PCR for all samples. The primers used were derived from the KT2440 genome data. The observed effects of Glu on the amounts of RT-PCR amplificates (Fig. 5) showed the same general pattern as the changes of the respective spot densities in 2D-PAGE. Glu-responsive proteins previously identified in 2D gels (cf. Table 2) seemed to be up-regulated on the transcriptional level as well. The RT-PCR products corresponding to the ABC transporter ATP-binding protein (Pp5) and aspartase (Pp6) were not seen during growth on NH+ 4 /Glc but were readily detected during growth on Glu. The mRNAs for PGA (Pp3), the outer-membrane porin D (Pp8) and the Rho Fig. 5. RT-PCR analysis of gene expression in P. putida KT2440. Total RNA was extracted from cells grown on M9 medium containing 5 mM NH4Cl and 22 mM glucose (NH+ 4 /Glc) and M9 medium supplemented with 10 mM glutamate (Glu) as the sole source of C and N. RT-PCR of the genes indicated was carried out as described in Methods. See Table 1 for identities of proteins. 2914 Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Tue, 09 May 2017 00:28:29 Microbiology 149 Pseudomonas protein induction by amino acids Fig. 6. Effect of Glu on protein expression in P. putida KT2440 wild-type (wt, left panel) and a mutant defective in the alternative sigma factor s54 (RpoN”, right panel). Protein spots upregulated by Glu in the wild-type are marked by solid circles. The corresponding spots in the mutant strain are highlighted by dashed circles. termination factor (Pp1) were also detected in the absence of Glu but greatly increased when the amino acid was present. The formation of fumarase mRNA (Pp11), on the other hand, was strongly suppressed by Glu. However, as we used only one pair of primers per gene and did not include a Glu-independent control gene in the RT-PCR experiments, the results shown in Fig. 5 are still qualitative rather than quantitative. Many of the Glu-inducible genes require s54 for expression rpoN encodes the alternative sigma factor s54 (sN) which is required for the expression of genes involved in the utilization of alternative nitrogen and carbon sources as well as diverse other functions (Merrick, 1993). Therefore, a comparative proteome analysis of the wild-type strain KT2440 (Fig. 6a) and its isogenic rpoN mutant (Fig. 6b) was performed to investigate the rpoN-dependency of the changes in the protein profile discussed above. As reported by Köhler et al. (1989), an rpoN mutant of strain KT2440 displayed a severe growth defect when amino acids were given as sole source of carbon and nitrogen. The data presented in Fig. 6 clearly show that the accumulation of Glu-responsive proteins was almost completely prevented in the strain lacking RpoN, supporting the notion that induction of their genes following transfer from NH+ 4 /Glc medium to Glu medium requires s54. The only exception was Pp6 (aspartase), the spot density of which was similar in the mutant (see Fig. 6). http://mic.sgmjournals.org To corroborate our conclusion that the Glu-responsive proteins identified in the present study all depend on s54 for expression, we screened the P. putida KT2440 genome to localize potential s54 recognition sequences in the upstream regions of the respective genes using the program PROMSCAN (Studholme et al., 2000). s54 recognition sequences are typically located at 212/224 relative to the start of transcription. In the consensus sequence (see Table 3) a GG and a TG pair, both separated by 9 nucleotides, are strictly conserved (Buck et al., 2000). For all Glu-responsive genes identified here, sequences with the expected properties were Table 3. Putative s54 recognition sites of Glu-responsive genes in P. putida KT2440 Protein Pf2 Potential s54-binding site Gln-binding protein TGGCACgactcATGCC* TGGTACgcgctTTGCAD Pp1 Rho termination factor GGCCACgttttTTGCT Pp3/4 Glutaminase/asparaginase TGGTACgaaaaATGCCD (PGA) TGGTACaaatcCTGCT* Pp6 Aspartate ammonia lyase TGGCACggtgcTTGGCD Pp8 Outer-membrane porin D cggcacgacatctgcaD Pp9 Phosphoenolpyruvate mutase CGGTGCgcacgTTGCGD Consensus sequence: TGGCACGnnnnTTGCT *In P. fluorescens. DIn P. putida KT2440. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Tue, 09 May 2017 00:28:29 2915 A. Sonawane and others found at a reasonable distance (i.e. within 200 bp) from the respective translation start sites. Of course, for an unequivocal identification of these sites it will be necessary to locate the transcription start in each case. So far, this has only been done for the ansB gene of P. fluorescens ATCC 13525 (Hüser et al., 1999). The Rho protein (spot Pp1) is known to participate in the regulation of tryptophanase expression in E. coli: tryptophan enhances the transcription of tryptophanase by Rhomediated antitermination (Konan & Yanofsky, 2000). It is unknown whether comparable mechnisms also operate in the regulation of Gln and Glu metabolism of other bacteria. The essential role of PGA (Pf2; Pp3/4) in the utilization of Gln by P. putida KT2440 has been established previously (Sonawane et al., 2003). The origin of the minor spot Pp4 (cf. Fig. 4) has not yet been investigated in detail. It may correspond to a PGA variant in which one or more Asn or Gln residues have been degraded to the respective dicarboxylates. However, the existence of a phosphorylated or otherwise covalently modified form of the enzyme cannot be excluded. amino-acid-binding protein Pf2 (encoded by PP10171 in P. putida KT2440) and the ATP-binding protein Pp5 (endoded by PP1068) could both belong to such a transport system of the ABC type which possibly mediates the uptake of the acidic amino acids and/or their amides. This assumption is based on the genetic organization of certain Glu-related genes in P. aeruginosa, P. putida and P. fluorescens (see Fig. 7). In P. aeruginosa PAO1, a series of eight consecutive genes (PA1342–PA1335) encode proteins that all appear to be involved in the uptake and utilization of acidic amino acids. PA1342–1339 code for an ABC transporter that, by sequence similarity, mediates amino acid uptake. Two subsequent genes, PA1338 and PA1337, encode a c-glutamyltransferase and PGA (ansB), respectively, while PA1336 and PA1335 encode a two-component system with strong similarity to dctBD, a system controlling dicarboxylate utilization in rhizobia (Wang et al., 1989). In P. putida KT2440, the genes for a closely related twocomponent system (PP1067–1066) are immediately adjacent to those encoding the ABC transporter mentioned above (PP1071–1068) while the ansB gene (PP2453) and the c-glutamyltransferase gene (PP4659) are located elsewhere. The sequence identity between the ABC transporters of the two strains (PP1071–1068 and PA1342–1339) is 85 % at the protein level while the two-component systems (PP1067–1066 and PA1336–1335) have 76 % of the amino acid residues in common. A similar arrangement of genes for an ABC transporter and a two-component system was detected in the unfinished genome data of P. fluorescens SBW25 (available at the Sanger Institute, http://www. sanger.ac.uk/Projects/P_fluorescens/). The respective open reading frames which are contained in fragment Pflu346g05.q1kb show a very high degree of sequence similarity to PP1065–1071. The predicted amino acid sequence of gene 2 (see Fig. 7), which encodes a periplasmic solute-binding protein, contains the complete N-terminal sequence determined for spot Pf2 (i.e. AELTGTLKKINDXGT, see Table 2), and the predicted sequence of gene 5 (the ATPbinding component of the ABC transporter) shows 93 % identity with the predicted sequence of PP1068. PGA hydrolyses Asn and Gln at similar rates and thus can generate both dicarboxylates (Glu and Asp) for uptake by transport systems in the inner membrane. The Aspartate ammonia lyase (aspartase, Pp6) converts aspartate to fumarate and ammonia. Under aerobic conditions this reaction feeds the tricarboxylic acid cycle with the carbon DISCUSSION In the present communication we show that the growth of P. fluorescens ATCC 13525 and P. putida KT2440 on acidic amino acids and their amides as sole source of carbon and nitrogen leads to the coordinated expression of a welldefined set of genes. Our data suggest (but do not prove) that in both organisms all four amino acids (Asn, Asp, Gln and Glu) induce the same proteins. Most of the genes induced during growth on amino acids of this group are also subject to carbon catabolite repression by intermediates of the citric acid cycle and other good carbon sources. Many of the proteins differentially expressed upon transfer from glucose/NH+ 4 to amino acids as sole carbon and nitrogen source were shown either to be involved in sugar metabolism or to perform functions that relate them to amino acid uptake and metabolism. Fig. 7. Genetic organization of Glu-related genes in the genomes of P. putida KT2440, P. aeruginosa PAO1 and P. fluorescens SBW25 (see text). 2916 Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Tue, 09 May 2017 00:28:29 Microbiology 149 Pseudomonas protein induction by amino acids skeletons of Asn and Asp. In E. coli and other enterobacteria, the enzyme also assists in anerobic fumarate respiration by providing fumarate from aspartate. Unlike the other spots induced by Glu, Pp6 was also expressed in the rpoN mutant and only weakly repressed by fumarate. The outer-membrane porin D (Pp8) facilitates the uptake of amino acids and/or peptides by P. aeruginosa (Trias & Nikaido, 1990). Ochs et al. (1999) further showed that oprD expression in this organism is strongly enhanced by amino acids (including Glu, Arg and Ala) and repressed by succinate. The arginine-mediated induction of oprD was mediated by the regulatory protein ArgR, whereas the Glu-induced expression of OprD was independent of ArgR, indicating the presence of more than a single activation mechanism. Unlike the proteins discussed above, Pp9, a putative carboxyphosphonoenolpyruvate phosphonomutase, has no apparent relation to amino acid metabolism. The only known function of this enzyme is to catalyse a step in the biosynthesis of the antibiotic bialaphos in Streptomyces hygroscopicus (Lee et al., 1995). However, the deduced amino acid sequence of Pp9 also shows similarity to more common phosphopyruvate hydratases from intermediary metabolism (e.g. enolase; Lee et al., 1995). Thus, the annotation of PP1389 as a PEP phosphonomutase may be erroneous. Further experiments are required to characterize the role of Pp9 in P. putida KT2440. The proteins upregulated during growth on NHz 4 /glucose (Pp10–Pp13) can be related to the uptake and degradation of glucose (Pp11, Pp12) or diamines, respectively (Pp10 and Pp13). The transaminase Pp10 was shown to catalyse a step in the biosynthesis of 1,3-diaminopropane by Acinetobacter baumannii (Ikai & Yamamoto, 1997). However, other functions appear to be possible as well, for instance the synthesis of Glu from 2,4-diaminobutyrate. The increased synthesis of a sugar uptake system during growth on glucose (spot Pp12) is not surprising, while the upregulation of putrescine uptake (Pp13, gene: potF) is more difficult to explain. Putrescine, a component of root exudates, was shown to inhibit growth of P. fluorescens WCS365 and its ability to colonize tomato roots (Kuiper et al., 2001). Sauer & Camper (2001), studying changes in gene expression during attachment of P. putida to surfaces, found that 15 proteins were upregulated following bacterial adhesion and 30 proteins were downregulated. The downregulated proteins include the potF gene product (Pp13) as well as PGA (Pp3/4) and other proteins involved in amino acid uptake and metabolism. Although these findings are difficult to interpret at present, they support the notion that profound changes in the metabolism of amino acids and polyamines accompany the change from free-living to sessile growth in pseudomonads. Our present data further indicate that most of the proteins upregulated by Glu depend on the alternative sigma factor http://mic.sgmjournals.org s54 (RpoN) for expression. With the possible exception of aspartase (Pp6), none of the Glu-responsive proteins was synthesized in an RpoN2 mutant of strain KT2440. As a result of this diminished presence of amino-acid-metabolizing enzymes, this strain exhibits a severe growth defect in media lacking glucose and NH4Cl (Köhler et al., 1989). It is now well established that activation of the s54–RNA polymerase holoenzyme requires additional enhancerbinding proteins with ATPase activity to stimulate transcription (Buck et al., 2000). The function of these proteins is to facilitate conversion of the closed promoter complex to an open one. Usually the enhancer proteins are so-called response regulators i.e. proteins that transmit environmental signals from a membrane-bound sensor kinase to the transcription complex (Chang & Stewart, 1998). A set of individual genes and/or operons controlled by one and the same response regulator is called a regulon. In our opinion, the present data indicate that the P. putida proteins upregulated by acidic amino acids and their amides (and other proteins not yet identified) may all be products of a regulon responsible for their uptake and metabolism. In order to substantiate this hypothesis, it has to be demonstrated that a single response regulator binds to and enhances transcription of these genes. Experiments aiming at the identification of such a response regulator are now under way in our laboratory. REFERENCES Bagdasarian, M. & Timmis, K. N. (1982). Host-vector systems for gene cloning in Pseudomonas. Curr Top Microbiol Immunol 96, 47–67. Barber, D. A. & Gunn, K. B. (1974). The effect of mechanical forces on the exudation of organic substances by the roots of cereal plants grown under sterile conditions. New Phytol 73, 39–45. Bayliss, C., Bent, E., Culham, D. E., MacLellan, S., Clarke, A. J., Brown, G. L. & Wood, J. M. (1997). Bacterial genetic loci implicated in the Pseudomonas putida GR12–2R3-canola mutualism: identification of an exudate-inducible sugar transporter. Can J Microbiol 43, 809–818. Bloemberg, G. V. & Lugtenberg, B. J. (2001). Molecular basis of plant growth promotion and biocontrol by rhizobacteria. Curr Opin Plant Biol 4, 343–350. Buck, M., Gallegos, M. T., Studholme, D. J., Guo, Y. & Gralla, J. D. (2000). The bacterial enhancer-dependent s54 (sN) transcription factor. J Bacteriol 182, 4129–4136. Chang, C. & Stewart, R. C. (1998). The two-component system. Regulation of diverse signaling pathways in prokaryotes and eukaryotes. Plant Physiol 117, 723–731. Derst, C., Henseling, J. & Röhm, K. H. (1992). Probing the role of threonine and serine residues of E. coli asparaginase II by site specific mutagenesis. Protein Eng 5, 785–789. Espinosa-Urgel, M. & Ramos, J. L. (2001). Expression of a Pseudomonas putida aminotransferase involved in lysine catabolism is induced in the rhizosphere. Appl Environ Microbiol 67, 5219–5224. Fan, T. W., Lane, A. N., Pedler, J., Crowley, D. & Higashi, R. M. (1997). Comprehensive analysis of organic ligands in whole root exudates using nuclear magnetic resonance and gas chromatographymass spectrometry. Anal Biochem 251, 57–68. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Tue, 09 May 2017 00:28:29 2917 A. Sonawane and others Hüser, A., Klöppner, U. & Röhm, K. H. (1999). Cloning, sequence analysis, and expression of ansB from Pseudomonas fluorescens, encoding periplasmic glutaminase/asparaginase. FEMS Microbiol Lett 178, 327–335. Ikai, H. & Yamamoto, S. (1997). Identification and analysis of a gene encoding L-2,4-diaminobutyrate: 2-ketoglutarate 4-aminotransferase involved in the 1,3-diaminopropane production pathway in Acinetobacter baumannii. J Bacteriol 179, 5118–5125. Jones, D. L. & Darrah, P. R. (1993). Influx and efflux of amino acids from Zea mays L. roots and their implications for N-nutrition and the rhizosphere. Plant Soil 155, 87–90. Köhler, T., Harayama, S., Ramos, J. L. & Timmis, K. N. (1989). Involvement of Pseudomonas putida RpoN s factor in regulation of various metabolic functions. J Bacteriol 171, 4326–4333. Konan, K. V. & Yanofsky, C. (2000). Rho-dependent transcription termination in the tna operon of Escherichia coli: roles of the boxA sequence and the rut site. J Bacteriol 182, 3981–3988. Kuiper, I., Bloemberg, G. V., Noreen, S., Thomas-Oates, J. E. & Lugtenberg, B. J. (2001). Increased uptake of putrescine in the rhizosphere inhibits competitive root colonization by Pseudomonas fluorescens strain WCS365. Mol Plant–Microbe Interact 14, 1096–1104. Kyhse-Anderson, J. (1984). Electroblotting of multiple gels. A simple apparatus with buffer tank for rapid transfer of proteins from polyacrylamide to nitrocellulose. J Biochem Biophys Methods 10, 105–132. Lee, S. H., Hidaka, T., Nakashita, H. & Seto, H. (1995). The carboxyphosphonoenolpyruvate synthase-encoding gene from the bialaphos-producing organism Streptomyces hygroscopicus. Gene 153, 143–144. Lugtenberg, B. J., Kravchenko, L. V. & Simons, M. (1999). Tomato seed and root exudate sugars: composition, utilization by Pseudomonas biocontrol strains and role in rhizosphere colonization. Environ Microbiol 1, 439–446. Merrick, M. J. (1993). In a class of its own – the RNA polymerase sigma factor s54 (sN). Mol Microbiol 10, 903–909. Nelson, K., Paulsen, I., Weinel, C. & 39 other authors (2002). Complete genome sequence and comparative analysis of the metabolically versatile Pseudomonas putida KT2440. Environ Microbiol 4, 799–808. Ochs, M. M., Lu, C. D., Hancock, R. E. & Abdelal, A. T. (1999). Amino acid-mediated induction of the basic amino acid-specific outer membrane porin OprD from Pseudomonas aeruginosa. J Bacteriol 181, 5426–5432. Otto, A., Thiede, B., Müller, E. C., Scheler, C., Wittmann-Liebold, B. & Jungblut, P. (1996). Identification of human myocardial proteins 2918 separated by two-dimensional electrophoresis using an effective sample preparation for mass spectrometry. Electrophoresis 17, 1643–1650. Reitzer, J. L. (1996a). Sources of nitrogen and their utilization. In Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology, 2nd edn, pp. 380–390. Washington, DC: American Society for Microbiology. Reitzer, L. J. (1996b). Ammonia assimilation and the biosynthesis of glutamine, glutamate, aspartate, asparagine, L-alanine, and D-alanine. In Escherichia coli and Salmonella: Cellular and Molecular Biology, 2nd edn. Washington, DC: American Society for Microbiology. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. Sauer, K. & Camper, A. K. (2001). Characterization of phenotypic changes in Pseudomonas putida in response to surface-associated growth. J Bacteriol 183, 6579–6589. Sonawane, A., Klöppner, U., Derst, C. & Röhm, K. H. (2003). Utilization of acidic amino acids and their amides by pseudomonads: role of periplasmic glutaminase-asparaginase. Arch Microbiol 179, 151–159. Studholme, D. J., Buck, M. & Nixon, T. (2000). Identification of potential sN-dependent promoters in bacterial genomes. Microbiology 146, 3021–3023. Trias, J. & Nikaido, H. (1990). Protein D2 channel of the Pseudomonas aeruginosa outer membrane has a binding site for basic amino acids and peptides. J Biol Chem 265, 15680–15684. van Overbeek, L. S. & van Elsas, J. D. (1995). Root exudate-induced promoter activity in Pseudomonas fluorescens mutants in the wheat rhizosphere. Appl Environ Microbiol 61, 890–898. Vilchez, S., Manzanera, M. & Ramos, J. L. (2000a). Control of expression of divergent Pseudomonas putida put promoters for proline catabolism. Appl Environ Microbiol 66, 5221–5225. Vilchez, S., Molina, L., Ramos, C. & Ramos, J. L. (2000b). Proline catabolism by Pseudomonas putida: cloning, characterization, and expression of the put genes in the presence of root exudates. J Bacteriol 182, 91–99. Wang, Y. P., Birkenhead, K., Boesten, B., Manian, S. & O’Gara, F. (1989). Genetic analysis and regulation of the Rhizobium meliloti genes controlling C4-dicarboxylic acid transport. Gene 85, 135–144. Wu, L. & Welker, N. E. (1991). Cloning and characterization of a glutamine transport operon of Bacillus stearothermophilus NUB36: effect of temperature on regulation of transcription. J Bacteriol 173, 4877–4888. Downloaded from www.microbiologyresearch.org by IP: 88.99.165.207 On: Tue, 09 May 2017 00:28:29 Microbiology 149