* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download B - Computational Systems Biology Group
Copy-number variation wikipedia , lookup
Transposable element wikipedia , lookup
Genetic engineering wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Gene therapy wikipedia , lookup
Metagenomics wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
X-inactivation wikipedia , lookup
Epigenetics in learning and memory wikipedia , lookup
Oncogenomics wikipedia , lookup
Long non-coding RNA wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Gene nomenclature wikipedia , lookup
Quantitative trait locus wikipedia , lookup
Epigenetics of diabetes Type 2 wikipedia , lookup
Gene desert wikipedia , lookup
Essential gene wikipedia , lookup
Pathogenomics wikipedia , lookup
History of genetic engineering wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Public health genomics wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
The Selfish Gene wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Genome evolution wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Minimal genome wikipedia , lookup
Genome (book) wikipedia , lookup
Genomic imprinting wikipedia , lookup
Gene expression programming wikipedia , lookup
Microevolution wikipedia , lookup
Ridge (biology) wikipedia , lookup
Biology and consumer behaviour wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Designer baby wikipedia , lookup
Functional genomics and gene expression data analysis Joaquín Dopazo Bioinformatics Unit, Centro Nacional de Investigaciones Oncológicas (CNIO), Spain. http://bioinfo.cnio.es The use of high throughput methodologies allows us to query our systems in a new way but, at the same time, generates new challenges for data analysis and requires from us a change in our data management habits National Institute of Bioinformatics, Functional Genomics node Now: 23531 (NCBI 34 assembly 02/04) Recent estimations: 20.000 to 100.000. 50% mRNAs do not code for proteins (mouse) 50% display alternative splicing Genes in the DNA... 25%-60% unknown …whose final effect can be different because of the variability. >protein kinase acctgttgatggcgacagggactgtatgctgatct atgctgatgcatgcatgctgactactgatgtgggg gctattgacttgatgtctatc.... …are expressed and constitute the transcriptome... A typical tissue is expressing among 5000 and 10000 genes More than 4 millon SNPs have been mapped From genotype to phenotype. (only the genetic component) … which accounts for the function providing they are expressed in the proper moment and place... …conforming complex interaction networks (metabolome)... …in cooperation with other proteins (interactome) … ...and code for proteins (proteome) that... Each protein has an average of 8 interactions Pre-genomics scenario in the lab >protein kunase acctgttgatggcgacagggactgtatgctga tctatgctgatgcatgcatgctgactactgatg tgggggctattgacttgatgtctatc.... Bioinformatics tools for pre-genomic sequence data analysis Phylogenetic tree Information Sequence Molecular databases Motif databases Search results Motif Conserved region The aim: Extracting as much information as possible for one single data alignment Secondary and tertiary protein structure Post-genomic vision Who? Genome sequencing Literature, databases 2-hybrid systems Mass spectrometry for protein complexes What do we know? And who else? SNPs Expression Arrays http://www.ncbi.nlm.nih.gov/Genbank/genbankstats.html Where, when and how much? In what way? Post-genomic vision genes Information The new tools: interactions Clustering Feature selection Data integration Information mining Information Databases polimorphisms Gene expression Gene expression profiling. The rationale, what we would like and related problems Differences at phenotype level are the visible cause of differences at molecular level which, in many cases, can be detected by measuring the levels of gene expression. The same holds for different experiments, treatments, etc. • Classification of phenotypes / experiments (Can I distinguish among classes, values of variables, etc. using molecular gene expression data?) • Selection of differentially expressed genes among the phenotypes / experiments (did I select the relevant genes, all the relevant genes and nothing but the relevant genes?) • Biological roles the genes are playing in the cell (what general biological roles are really represented in the set of relevant genes?) A note of caution: Genome-wide technologies allows us to produce vast amounts of data. But... data is not knowledge Misunderstanding of this has lead to “new” (not necessarily good) ways of asking (scientific) questions Question Experiment test Is gene A involved in process B? Experiment (sometimes) test Question Is there any gene (or set of genes) involved in any process? Gene expression analysis using DNA microarrays There are two dominant technologies: spotted arrays and oligo arrays although new players are arriving to the arena Cy5 Cy3 cDNA arrays Oligonucleotide arrays Transforming images into data Test sample labeled red (Cy5) Reference sample labeled green (Cy3) Red : gene overexpressed in test sample Green : gene underexpressed in test sample Yellow - equally expressed red/green - ratio of expression Normalisation A There are many sources of error that can affect and seriously biass the interpretation of the results. Differences in the efficience of labeling, the hibridisation, local effects, etc. B Normalisation is a necessary step before proceeding with the analysis C Before (left) and after (right) normalization. A) BoxPlots, B) BoxPlots of subarrays and C) MA plots (ratio versus intensity) (a) After normalization by average (b) after print-tip lowess normalization (c) after normalization taking into account spatial effects The data ... A Genes (thousands) B C Different classes of experimental conditions, e.g. Cancer types, tissues, drug treatments, time survival, etc. Expression profile of all the genes for a experimental condition (array) Expression profile of a gene across the experimental conditions Experimental conditions (from tens up to no more than a few houndreds) Characteristics of the data: • Many more variables (genes) than measurements (experiments / arrays) • Low signal to noise ratio • High redundancy and intra-gene correlations • Most of the genes are not informative with respect to the trait we are studying (account forunrelated physiological conditions, etc.) • Many genes have no annotation!! Multiple array experiments. Can we find groups of experiments with similar gene expression profiles? Unsupervised Different phenotypes... Supervised Reverse engineering Molecular classification of samples Co-expressing genes... What genes are responsible for? What do they have in common? B Genes interacting in a network (A,B,C..)... How is the network? A C D E Unsupervised clustering methods: Useful for class discovery (we do not have any a priori knowledge on classes) Non hierarchical K-means, PCA SOM hierarchical UPGMA SOTA Different levels of information quick and robust An unsupervised problem: clustering of genes. •Gene clusters are unknown beforehand •Distance function •Cluster gene expression patterns based uniquely on their similarities. •Results are subjected to further interpretation (if possible) Clustering of experiments: The rationale If enough genes have their expression levels altered in the different experiments, we might be able of finding these classes by comparing gene expression profiles. Distinctive gene expression patterns in human mammary epithelial cells and breast cancers Overview of the combined in vitro and breast tissue specimen cluster diagram. A scaled-down representation of the 1,247-gene cluster diagram The black bars show the positions of the clusters discussed in the text: (A) proliferation-associated, (B) IFNregulated, (C) B lymphocytes, and (D) stromal cells. Perou et al., PNAS 96 (1999) Clustering of experiments: The problems Any gene (regardeless its relevance for the classification) has the same weight in the comparison. If relevant genes are not in overwhelming majority it produces: Noise and/or irrelevant trends Supervised analysis. If we already have information on the classes, our question to the data should use it. Class prediction based on gene expression profiles: A B C Problems: How can classes A, B, C... be distiguished based on the corresponding profiles of gene expression? Genes (thousands) Predictor How a continuous phenotypic trait (resistence to drugs, survival, etc.) can be predicted? And Which genes among the thousands analysed are relevant for the classification? Experimental conditions (from tens up to no more than a few houndreds) Gene selection Gene selection. We are interested in selecting those genes showing differential expression among the classes studied. • Contingency table (Fisher's test) For discrete data (presence/absence, etc). • T-test We could compare gene expression data between two types of patients. • ANOVA Analysis of variance. We compare between two or more groups the value of an interval data. The pomelo tool Gene selection and class discrimination 10 cases 10 controls Genes differentially expressed among classes (t-test or ANOVA), with p-value < 0.05 Sorry... the data was a collection of random numbers labelled for two classes This is a multiple-testing statistic contrast. Adjusted p-values must be used! Gene selection NE between normal endometrium (ne) and endometrioid endometrial carcinomas (eec) Hierarchical Clustering of 86 genes with different expression patterns between Normal Endometrium and Endometrioid Endometrial Carcinoma (p<0.05) selected among the ~7000 genes in the CNIO oncochip Moreno et al., BREAST AND GYNAECOLOGICAL CANCER LABORATORY, Molecular Pathology Programme, CNIO NE EEC EEC G Symbol A Number And, genes are not only related to discrete classes... Pomelo: a tool for finding differentially expressed genes • Among classes • Survival • Related to a continuous parameter Of predictors and molecular signatures A B 1 Training Model, or classificator (with internal and/or external CV) A/B? Unknown sample A CV A/B? 2. Classification / prediction Predictor of clinical outcome in breast cancer Genes are arranged to their correlation eith the pronostic groups Pronostic classifier with optimal accuracy van’t Veer et al., Nature, 2002 Information mining My data... How are structured? What are these groups? What is this gen? ? Cell cycle... DBs Information Clustering Information mining Links Information mining applications. 1) use of biological information as a validation criteria Information mining of DNA array data. Allows quick assignation of function, biological role and subcellular location to groups of genes. Used to understand why genes differ in their expression between two different conditions Sources of information: • Free text • Curated terms (ontologies, etc.) Gene OntologyCONSORTIUM http://www.geneontology.org • The objective of GO is to provide controlled vocabularies for the description of the molecular function, biological process and cellular component of gene products. • These terms are to be used as attributes of gene products by collaborating databases, facilitating uniform queries across them. • The controlled vocabularies of terms are structured to allow both attribution and querying to be at different levels of granularity. FatiGO: GO-driven data analysis The aim: to develop a statistical framework able to deal with multiple-testing questions GO: source of information. A reduced number of curated terms The Gene Ontology Consortium. 2000. Gene Ontology: tool for the unification of biology. Nature Genetics 25: 25-29 How does FatiGO work? Compares two sets of genes (query and reference) Has Ontology information [Process, Function and Component] on different organisms Select level [2-5]. Important: annotations are upgraded to the level chosen. This increases the power of the test: there are less terms to be tested and more genes by term. Remove genes repeated Cluster Genes Query in Cluster Query Remove genes repeated between Clusters Cluster Genes Reference Search GO term at level and ontology selected Remove genes repeated in Cluster Reference Distribution Of GO Terms In Query Cluster Clean Cluster Query Clean Cluster Reference p-value multiple test GO – DB Distribution Of GO Terms In Reference Cluster Important: since we are performing as many tests as GO terms, multiple-testing adjustment must be used FatiGO Results The application extracts biological relevant terms (showing a significant differential distribution) for a set of genes Number Genes with GO Term at level and ontology selected for each Cluster Unadjusted p-value Step-down min p adjusted p-value FDR (indep.) adjusted p-value FDR (arbitrary depend.) adjusted p-value Tables GO Term – Genes Genes of old versions (Unigene) Genes without result Repeated Genes GO Tree with diferent levels of information C PTL LB Understanding why genes differ in their expression between two different phenotypes Limphomas from mature lymphocytes (LB) and precursor T-lymphocyte (PTL). Genes differentially expressed, selected among the ~7000 genes in the CNIO oncochip Genes differentially expressed among both groups were mainly related to immune response (activated in mature lymphocytes) Martinez et al., Human Genetics Laboratory. Molecular Pathology Programme, CNIO Biological processes shown by the genes differentially expressed among PTL-LB Martinez et al., Human Genetics Laboratory. Molecular Pathology Programme, CNIO Looking for significant differences. Statistical approaches Don’t worry, be happy 2-fold increase/decrease Hundred of differentially expressed genes Individual test Hardly a few differentially expressed genes (or even none) Panic Bonferroni FWER Looking for more heuristic and/or realistic ways of finding differentially expressed genes False Discovery Rate (FDR), controls the expected number of false rejections among the rejected hypotheses (differentially expressed genes), instead of the more conservative FWER, that controls the probability that one of more of the rejected hypotheses is true. Use of external information 1. 2. Use of biological information as a validation criteria Use of biological information as part of the algorithm Necessity of a tool and the appropriate statistical framework for the management of the information Applications 2) Use of biological information as a threshold criteria The problem: We might be interested in understanding, e.g., which genes differ between tissues, diseases, etc. A B B Typically: We examine each gene selecting only those that show significant differences using an appropriate statistical model, and correcting for multiple testing. Use biological information as a validation criteria Metabolism Transport ... Reproduction The threshold, thus, is based on expression values in absence of any other information. Conventional levels (e.g., Type I error rate of 0.05) attending exclusively to statistical criteria are used. A Use of biological information as a threshold criteria Information-driven approach We examine the GO terms associated to each gene and see, correcting for multiple testing, if some of them are overrepresented A B B A Metabolism Transport ... Reproduction The threshold is based on levels (e.g., Type I error rate of 0.05) of distribution of GO terms The rationale: genes are differentially expressed because some biological reason GO terms The procedure becomes more sensitive Present Absent Comparing genes differentially expressed between organs testis kidney Díaz-Uriarte et al., CAMDA 02 Other approaches that include information in the algorithm: GSEA Figure 1: Schematic overview of GSEA. The goal of GSEA is to determine whether any a priori defined gene sets (step 1) are enriched at the top of a list of genes ordered on the basis of expression difference between two classes (for example, highly expressed in individuals with NGT versus those with DM2). Genes R1,...RN are ordered on the basis of expression difference (step 2) using an appropriate difference measure (for example, SNR). To determine whether the members of a gene set S are enriched at the top of this list (step 3), a Kolmogorov-Smirnov (K-S) running sum statistic is computed: beginning with the top-ranking gene, the running sum increases when a gene annotated to be a member of gene set S is encountered and decreases otherwise. The ES for a single gene set is defined as the greatest positive deviation of the running sum across all N genes. When many members of S appear at the top of the list, ES is high. The ES is computed for every gene set using actual data, and the MES achieved is recorded (step 4). To determine whether one or more of the gene sets are enriched in one diagnostic class relative to the other (step 5), the entire procedure (steps 2– 4) is repeated 1,000 times, using permuted diagnostic assignments and building a histogram of the maximum ES achieved by any pathway in a given permutation. The MES achieved using the actual data is then compared to this histogram (step 6, red arrow), providing us with a global P value for assessing whether any gene set is associated with the diagnostic categorization. Mootha et al., Nat Genet. 2003 Jul;34(3):267-73 ISW applied to a dataset for which no genes differentially expressed could be found ISW detects 5 pathways arrangement Pathways over- and underrepresented Mootha et al., Nat Genet. 2003 17 NTG vs. 8 IGT 18 DM2 No differentially expressed genes between both conditions were found. Gene Set Enrichment Analysis detects Oxidative phosphorylation IGT + Diabetic Normal tolerance to glucose Algorithms are used if they are available in programs. External tools GEPAS, a package for DNAEP, array data analysis In silico CGH HAPI Scanning, Array Image processing Two-conditions comparison Normalization Gene selection DNMAD Two-classes Multiple classes Unsupervised clustering Hierarchical SOM SOTA SomTree Preprocessor + hub Continuous variable Categorical variable survival Predictor tnasas Supervised clustering SVM Datamining FatiGO FatiWise Viewers SOTATree TreeView SOMplot A G E F B C D Bioinformatics Group, CNIO From left to right: Lucía Conde, Joaquín Dopazo, Alvaro Mateos, Fátima Al-Shahrour, Víctor Calzado, Hernán Dopazo, Javier Herrero, Javier Santoyo, Ramón Díaz, Michal Karzinstky & Juanma Vaquerizas http://bioinfo.cnio.es http://gepas.bioinfo.cnio.es http://fatigo.bioinfo.cnio.es