* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download DNA Sequences
Genetic engineering wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Silencer (genetics) wikipedia , lookup
DNA repair protein XRCC4 wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Promoter (genetics) wikipedia , lookup
DNA sequencing wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
Agarose gel electrophoresis wikipedia , lookup
Genomic library wikipedia , lookup
Restriction enzyme wikipedia , lookup
SNP genotyping wikipedia , lookup
DNA profiling wikipedia , lookup
Community fingerprinting wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Genetic code wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Molecular cloning wikipedia , lookup
Point mutation wikipedia , lookup
DNA supercoil wikipedia , lookup
Biosynthesis wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Non-coding DNA wikipedia , lookup
DNA Sequences • Deoxyribonucleic acid (DNA) is a nucleic acid that contains the genetic instructions used in the development and functioning of all known living organisms and some viruses. DNA Sequences ULM/HHIM Summer Program Project 3, Day 3, Part 1 • The main role of DNA is the long-term storage of information. 6/8/2011 Paul D. Wiedemeier, Ph.D. 1 6/8/2011 Paul D. Wiedemeier, Ph.D. 2 DNA Sequences DNA Sequences • DNA is often compared to a set of blueprints or a recipe, or a code, since it contains the instructions needed to construct other components of cells, such as proteins and RNA molecules. • The DNA segments that carry this genetic information are called genes, but other DNA sequences have structural purposes, or are involved in regulating the use of this genetic information. 6/8/2011 6/8/2011 Paul D. Wiedemeier, Ph.D. 3 DNA Sequences • It is the sequence of these four nucleotides along the polymer strands that encodes information. • These two strands run in opposite directions to each other and are therefore anti-parallel. Paul D. Wiedemeier, Ph.D. 4 DNA Sequences • Chemically, DNA consists of two long polymer strands of four simple units called nucleotides. 6/8/2011 Paul D. Wiedemeier, Ph.D. 5 – Adenine (A) – Cytosine (C) – Guanine (G) – Thymine (T) 6/8/2011 Paul D. Wiedemeier, Ph.D. 6 1 DNA Sequences DNA Sequences sense DNA strand • Adenine is matched with thymine. 5’ ATGACGGAGCTTCGGAGCTAG 3’ 3’ TACTGCCTCGAAGCCTCGATC 5’ antisense DNA strand – A-T or T-A • Cytosine is matched with guanine. – C-G or G-C 6/8/2011 Paul D. Wiedemeier, Ph.D. 7 6/8/2011 Paul D. Wiedemeier, Ph.D. 8 Central Dogma DNA Sequences DNA Sequences • Transcription DNA (DeoxyriboNucleic Acid) Transcription (of the 3’ – 5’ DNA strand) – Read the 3’ → 5’ DNA (antisense) strand. mRNA (messenger RiboNucleic Acid) – Complement the nucleotides read. Translation • T → A, C → G, and G → C • A → U (Uridine) Protein 6/8/2011 Paul D. Wiedemeier, Ph.D. 9 6/8/2011 DNA Sequences Paul D. Wiedemeier, Ph.D. 10 DNA Sequences antisense DNA strand • Once we have a mRNA sequence, it can be “translated” into amino acid codons. 3’ TACTGCCTCGAAGCCTCGATC 5’ 5’ AUGACGGAGCUUCGGAGCUAG 3’ mRNA 6/8/2011 Paul D. Wiedemeier, Ph.D. 11 6/8/2011 Paul D. Wiedemeier, Ph.D. 12 2 Second Nucleotide DNA Sequences U First Nucleotide • Sequences of codons are used to create amino acids. – There exist 64 codons – Most all codons are three nuleotides in length. – The 61 codons encode for one of the 20 amino acids. – The codon AUG is the start codon – The codons UAG, UGA, UAA. 6/8/2011 Paul D. Wiedemeier, Ph.D. C A G 13 6/8/2011 DNA Sequences U C A G UUU Phenylalanine (Phe) UCU Serine (Ser) UAU Tyrosine (Tyr) UGU Cysteine (Cys) UUC Phe UCC Ser UAC Tyr UUA Leucine (Leu) UCA Ser UAA STOP UGA STOP UGC Cys UUG Leu UCG Ser UAG STOP UGG Tryptophan (Trp) CUU Leucine (Leu) CCU Proline (Pro) CAU Histidine (His) CGU Arginine (Arg) CUC Leu CCC Pro CAC His CUA Leu CCA Pro CAA Glutamine (Gln) CGA Arg CUG Leu CCG Pro CAG Gln CGG Arg CGC Arg AUU Isoleucine (Ile) ACU Threonine (Thr) AAU Asparagine (Asn) AGU Serine (Ser) AUC Ile ACC Thr AAC Asn AGC Ser AUA Ile ACA Thr AAA Lysine (Lys) AGA Arginine (Arg) AUG Methionine (Met) or START ACG Thr AAG Lys AGG Arg GUU Valine Val GCU Alanine (Ala) GAU Aspartic acid (Asp) GGU Glycine (Gly) GUC (Val) GCC Ala GAC Asp GUA Val GCA Ala GAA Glutamic acid (Glu) GGA Gly GUG Val GCG Ala GAG Glu GGG Gly Paul D. Wiedemeier, Ph.D. GGC Gly 14 DNA Sequences mRNA • Sequences of amino acids are used to create proteins. 5’ AUGACGGAGCUUCGGAGCUAG 3’ StrThrGluLeuArgAlaStp codons 6/8/2011 Paul D. Wiedemeier, Ph.D. 15 6/8/2011 Paul D. Wiedemeier, Ph.D. 16 DNA Sequence Exercise 1 • Write your answers to the questions on the DNA Sequence Exercise 1 Answer Sheet. 6/8/2011 Paul D. Wiedemeier, Ph.D. 17 3