* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download - Wiley Online Library
Survey
Document related concepts
Transcript
DEVELOPMENTAL DYNAMICS 236:2993–3006, 2007 RESEARCH ARTICLE Rab23 GTPase Is Expressed Asymmetrically in Hensen’s Node and Plays a Role in the Dorsoventral Patterning of the Chick Neural Tube Naixin Li,1† Jean-Nicolas Volff,2,3 and Andrea Wizenmann*1,4,‡ The mouse Rab23 protein, a Ras-like GTPase, inhibits signaling through the Sonic hedgehog pathway and thus exerts a role in the dorsoventral patterning of the spinal cord. Rab23 mouse mutant embryos lack dorsal spinal cord cell types. We cloned the chicken Rab23 gene and studied its expression in the developing nervous system. Chick Rab23 mRNA is initially expressed in the entire neural tube but retracts to the dorsal alar plate. Unlike in mouse, we find Rab23 in chick already expressed asymmetrically during gastrulation. Ectopic expression of Rab23 in ventral midbrain induced dorsal genes (Pax3, Pax7) ectopically and reduced ventral genes (Nkx2.2 and Nkx6) without influencing cell proliferation or neurogenesis. Thus, in the developing brain of chick embryos Rab23 acts in the same manner as described for the caudal spinal cord in mouse. These data indicate that Rab23 plays an important role in patterning the dorso-ventral axis by dorsalizing the neural tube. Developmental Dynamics 236:2993–3006, 2007. © 2007 Wiley-Liss, Inc. Key words: Rab23; GTPase; dorsoventral patterning; neural tube; chick Accepted 14 August 2007 INTRODUCTION During early development of the neural tube, signaling along the dorsoventral (DV) axis plays a prominent role in establishing cell type diversity. Morphogens like sonic hedgehog (Shh) and members of the family of transforming growth factors (TGF) and Wnts (wingless related mouse mammary tumor virus integration site proteins) have emerged as the inductive signals involved in DV patterning of the neural tube. In chick, Shh signals from the notochord induce formation of the floor plate (Yamada et al., 1991; Chiang et al., 1996). Subsequent Shh expression in the floor plate generates a ventral-dorsal activity gradient of Shh that promotes the specification of a series of ventral cell types (Marti et al., 1995; Ericson et al., 1997b; Briscoe and Ericson, 2001). Dorsal neural tube patterning might proceed analogously, but it is not as well understood as ventral patterning. It is known that signals from the surface ectoderm 1 specify the roof plate cells (Dickinson et al., 1995; Liem et al., 1995), and by analogy to the floor plate the roof plate provides the signals to specify the dorsal cell types of the neural tube in chick and mouse (Liem et al., 1997; Lee et al., 2000; Millonig et al., 2000; Chizhikov and Millen, 2004; Millen et al., 2004). Different members of the TGF and Wnt family are expressed in the roof plate and have been suggested to induce different dorsal interneurons (for review, see: Lee and Jes- University of Würzburg, JRG Developmental Neurobiology, Würzburg, Germany Department of Physiological Chemistry I, Biocenter, University of Würzburg, Würzburg, Germany 3 Ecole Normale Supérieure de Lyon, Institute of Functional Genomics, Lyon, France 4 GSF National Research Center for Environment and Health, Institute for Stem Cell Research, Neuherberg, Germany Grant sponsor: Volkswagenstiftung; Grant sponsor: SFB 465 (DFG). † Naixin Li’s present address is Department of Neurosurgery,Tianjin Medical University General Hospital, Tianjin, P.R. China. ‡ Andrea Wizenmann’s present address is Institute of Anatomy, University of Tübingen, Germany. *Correspondence to: Andrea Wizenmann, Institute of Anatomy, University of Tübingen, Österbergstrasse 3, 72074 Tübingen, Germany. E-mail: awizenmann@anatom.uni-tuebingen.de 2 DOI 10.1002/dvdy.21331 Published online 5 October 2007 in Wiley InterScience (www.interscience.wiley.com). © 2007 Wiley-Liss, Inc. 2994 LI ET AL. sell, 1999; Caspary and Anderson, 2003; Chizhikov and Millen, 2005; Wilson and Maden, 2005; Zhuang and Sockanathan, 2006). The balance between differentiation and proliferation seems to be regulated by a crosstalk between Wnt and Bmp signaling (Chesnutt et al., 2004; Ille et al., 2007). However, the precise roles and interactions of the members of these two signaling families are still not very well understood. Obviously, a morphogen model for the dorsal neural tube might not be as simple as in the ventral neural tube since the roof plate produces more than one patterning molecule. Ventral and dorsal signals have been suggested to be antagonistic and, thus, the interplay between the two types of signals is likely required for the final dorsoventral pattern. Ventral specific genes are repressed by Bmp signaling (Barth et al., 1999; Nguyen et al., 2000; Timmer et al., 2002) and Shh signaling represses the expression of several genes that are required for dorsal neural development (Goulding et al., 1993b; Liem et al., 1995; Chiang et al., 1996; Ericson et al., 1996; Tremblay et al., 1996; Briscoe et al., 2000; Aruga et al., 2002). The range of action of both Shh and Bmp signaling seems to extend throughout the neural tube (McMahon et al., 1998; Towers et al., 1999; Liem et al., 2000; Briscoe et al., 2001; Patten and Placzek, 2002). However, the activity of Bmps and Shh is actively antagonized in the ventral or dorsal neural tube, respectively. Ventrally, notochord-derived Bmp antagonists generate a permissive environment for the Shh-mediated induction of ventral spinal cord cell types (McMahon et al., 1998; Towers et al., 1999; Liem et al., 2000; Patten and Placzek, 2002). In the dorsal neural tube, it is the transcription factor Gli3 that acts primarily to repress hedgehog signaling (Ruiz i Altaba, 1998). There is also growing evidence that complex intracellular trafficking might play a role in morphogen distribution in a number of tissues (Piddini and Vincent, 2003; Wang et al., 2006) and specifically in regulating Shh signaling in the dorsal neural tube. Rab23, a member of the Rab family of GTPase proteins that are involved in vesicular transport, has been shown to negatively regulate the Shh pathway in dorsal neural cell types at a point downstream of Ptc1 and smoothened (Eggenschwiler et al., 2001). A spontaneous and an ENU-induced mutation (open brain, Opb) in the Rab23 gene (Gunther et al., 1994; Sporle et al., 1996; Sporle and Schughart, 1997) cause defects in brain, spinal cord and spinal ganglia, epaxial muscle, eyes, and limbs. The opb mutant shows exencephaly in all brain regions due to a failure of neural tube closure. However, only in the spinal cord roof plate, dorsal cell types are absent and ventral cell markers, including Shh, expand into dorsal regions (Gunther et al., 1994; Sporle et al., 1996; Eggenschwiler and Anderson, 2000). Such defects are characteristics of overactive Shh signaling like in Gli3 mutants (Litingtung and Chiang, 2000; Persson et al., 2002; Wijgerde et al., 2002). Double mutant mice for opb and Shh not only rescue the reduced size of the single Shh mutant embryos, but also all ventral cell types, while dorsal cell types are still missing as in the single opb mutant (Eggenschwiler et al., 2001). Taken together, Rab23 inhibits signaling of Shh intracellularly and establishes the basis for the development of dorsal cell types in the mouse embryo, perhaps in concert with Gli3. In this study, we describe and compare the expression of chick Rab23 during development with the pattern in mouse embryos. As in mouse, Rab23 is initially expressed throughout the neural tube and retracts later to the dorsal half of the neural tube. Interestingly, we found Rab23 asymmetrically expressed on the right side of the primitive streak and Hensen’s node at stage 4 of development opposite to the Shh expression. Overexpression of Rab23 in ventral midbrain resulted in the expression of the dorsal genes Pax3 and Pax7 in these areas. Rab23 overexpression in the dorsal midbrain did not affect the rate of proliferation of neuronal precursors or the differentiation of the first neurons. These results support a role of Rab23 as negative regulator of the Shh pathway in the dorsal neural tube of chick embryos to enable the expression of dorsal specific genes, similar to mouse development. RESULTS Isolation and Analysis of the Chick Rab23 Using the mouse Rab23 cDNA sequence (NM 008999) as a query, eleven clones were found in the BBSRC Chick EST Database Bank (http://www.chick. umist.ac.uk). Alignment of four of these clones (ChEST75d14, ChEST545g23, ChEST885j22, ChEST925k6) provided the cDNA sequence of Rab23 with 1,706 nucleotides including 5 prime and 3 prime untranslated regions (Fig. 1). The deduced chicken 237 aa Rab23 GTPase sequence is encoded by a 711-bp open reading frame with a start codon at position 151 and a stop codon at position 864. In the 3 prime UTR, two AT-rich elements (ATTTA) were identified, which might be involved in mRNA degradation (Chen and Shyu, 1995). BLAST analysis of the draft of the chicken genome (http://www.ncbi.nlm.nih.gov/genome/ seq/GgaBlast.html) using the cDNA sequence as a query revealed that the Rab23 consists of seven exons (six coding exons) and is located on chromosome 3. The amino acid sequence of Rab23 reveals characteristic features of small G proteins. It contains four conserved regions involved in GTP binding and hydrolysis (Fig. 1; designated in yellow), the conformational switch between a GTP- and GDP-bound state, a Cys-containing C-terminal motif (boxed in Fig. 1), membrane association sequences and an unusually long carboxyterminal tail (underlined in Fig.1; Olkkonen et al., 1994; Paduch et al., 2001; Pereira-Leal and Seabra, 2001). The four highly conserved domains (Fig. 1, marked in yellow) and the effector domain (Fig. 1; marked in blue) locate to the five polypeptide loops (G1 to G5). The domain in the G2 loop (the effector loop or switch I region) is the interacting site for effectors and GTPase-activating protein (GAP). The G1 loop (also called P-loop, aa 16-23, yellow in Fig. 1) is responsible for the binding of alpha or beta-phosphate groups of nucleotides. The G3 loop or Switch II region (aa 63– 69; yellow in Fig. 1) provides residues for the binding of Mg2⫹ and for gamma-phosphate. The consensus region is DXXG (Amor et al., RAB23 IN CHICK NEURAL TUBE 2995 Fig. 1. cDNA and deduced amino acid sequence of chick Rab23 (GenBank accession number EU176872). Start and stop codons are indicated by double-underlining. The AU-rich elements and the carboxyterminal tail are underlined. The four highly conserved domains are marked in yellow. The sequence corresponding to the effector domain is marked in blue and the post-translational modification domain is boxed. The amino acid sequence is shown in single code letters beneath the cDNA sequence. 2996 LI ET AL. 1994). The guanine base is recognized by the G4 and G5 loops. The G4 loop (VQNKID) locates at position 119 –124. The consensus sequence NKXD of G4 loop contains lysine (K) and aspartic acid (D) residues directly interacting with the nucleotides and is also called the recognition loop (Zhong et al., 1995; Sprang, 1997). The fourth conserved domain (RASVKE; aa 149 –154) lies in the G5 loop, which is a recognition site for guanine bases. The consensus sequence is (RE) –x-S-V (Sprang, 1997). Switch I and Switch II regions surround the gamma-phosphate group of the nucleotide (Paduch et al., 2001). Switch I and Switch II stretches undergo structural changes upon GTP binding and hydrolysis. The Switch III region is absent in this small G-protein (Gilman, 1987). A Cys-containing motif (CSIP) locates in the C-terminus. The sequence pattern is generally known as the CAAX box (A-aliphatic aa) in Raslike proteins, which is conserved and provides a prenyl-group binding site for the posttranslational prenylation modifications by the attachment of either a farnesyl or a geranyl group to a cysteine residue when Ras-like proteins are required for the membrane association (Newman and Magee, 1993; Leung et al., 2007). A striking feature of the Rab23 sequence is the exceptional length of the C-terminal tail, which is significantly longer than that of other Rab members. This hypervariable C-terminal domain of Rab proteins is thought to be a targeting signal crucial for specific membrane association (Chavrier et al., 1991). Sequence comparison of the chick Rab23 sequence with Rab23 proteins from other animals revealed a very high homology (Fig. 2). All five polypeptide loops (G1–G5) containing the different binding site regions are highly conserved between the different vertebrate groups and even in Drosophila. The phylogenetic analysis (Fig. 3) confirmed the identity of the chick sequence as a bona fide Rab23 protein with orthologues in mammals, fish, amphibians, and insects. Rab23 Expression During Early Chick Embryogenesis Expression of the Rab23 gene was initially detected at stage 4 in chick embryos, when the primitive streak is at its full posterior to anterior extension during the process of gastrulation (Fig. 4). At stage 4, Rab23 mRNA was found in Hensen’s node and primitive streak along the primitive groove (Fig. 4A). This expression was sustained until stage 7 when node and primitive streak begin to regress posteriorly (Fig. 4B–D). Initially, epiblast (epidermis) and the newly forming mesoderm expressed Rab23 (Fig. 4E–G), whereby Rab23-positive cells were located basally in the epidermis (Fig. 4H,L). At stage 7, Rab23 was expressed in the caudal mesoderm underlying the neural plate (Fig. 4S,T). In the forming brain region, mesoderm and the entire neural tube expressed Rab23 (Fig. 4D,R,U,V). Interestingly, between stage 4 and 7, Rab23 was asymmetrically expressed in Hensen’s node and the anterior primitive streak with a stronger bias to the right lip (Fig. 4A–C,F,G,J, K,N,O). At these stages, Hensen’s node shows an asymmetric morphology with a steep right boundary at stage 4 and a significant bulge of the right side at stage 7 (Fig. 4F,J,N,S; Viebahn, 2001; Dathe et al., 2002). Rab23 expression in Hensen’s node and primitive streak weakened from stage 4 to 6 and was almost absent at stage 7 (Hensen’s node: Fig. 4A– D,F,J,N,S; primitive streak: Fig. 4A– D,G,K,O,T), while neural plate expression increased (Figs. 4D, 5) and expression in the mesenchyme was sustained. Somites exhibited Rab23 expression from stage 15 onwards (Fig. 5M–P), where the expression became more and more restricted to the dermamyotome. Rab23 expression was also detected in the head process (Fig. 4B,C,I). These mesodermal (chordamesoderm) cells rostral to Hensen’s node were shown to form an anterior notochord and prechordal instead to form notochord and prechordal plate (Fig. 4Q,V; Psychoyos and Stern, 1996). Rab23 expression in the notochord was visible up to stage 13 (Fig. 5E,M). Rab23 mRNA Expression in the Neural Tube In the forming neural plate, Rab23 expression was first detected at stage 6 (Fig. 4C,Q), anterior to Hensen’s node. Anterior to the head fold, the epidermis also expressed Rab23 (Fig. 4M), whereas posterior to Hensen’s node it mainly located to the underlying mesoderm (Fig. 4O). Rab23 neural plate expression became strong in the rostral neural fold at stage 7 (Fig. 4D,R,U,V), but not in neural crest and epidermis cells (Fig. 4M,R,V). During the formation of brain vesicles (stages 9 –12), the entire neural tube expressed diffusely Rab23 (Fig. 5A,E, I,M,Q,R). Open book preparations of midbrain and spinal cord at stage 11 showed Rab23 expression along the entire dorso-ventral axis with a weaker expression in the floor plate and the roof plate (Fig. 5A,I). Rab23 expression retreated gradually from the ventral neural tube over the next five stages (Fig. 5B–D,F,J–L,S). From stage 18 onwards, the entire neural tube displayed Rab23 expression in the alar plate sparing the narrow stripe of the roof plate as seen in the example of midbrain and spinal cord (Fig. 5D,F,L,N). This pattern was still observed up to embryonic day 6 (Fig. Fig. 2. Sequence comparison of Rab23 proteins. Identical residues are white on black, conservative substitutions are black on grey. Accession numbers are given in the legend of Figure 3. The highly conserved domains are marked in yellow, the effector domains in blue, and the post-translational modification domain is boxed. Fig. 4. Expression pattern of Rab23 in chick embryos from stage 4 to 7. A–D: The dorsal view of chick embryos shows that initially, Rab23 was strongly expressed in Hensen’s node and primitive streak (A–C) but weakened towards stage 7 (D). At stage 5 (B), Rab23 became evident in the head process and was still present in the neural fold at stage 7 (D). The border between area opaca and pellucida is indicated as dashed line (A,B). E–V: Transverse sections (20 m) through embryos in A–D. Black arrows and the letters indicate the level of the sections in the corresponding figures. The strong asymmetric expression of Rab23 in the right lip of Hensen’s node in ectoderm and mesoderm at stage 4 (F,H) and 5 (J) weakened at stage 6 (N) and disappeared completely in ectoderm at stage 7 (S). In the head process, Rab23 was evident in mesoderm and ectoderm (E,I,M,R). Higher magnification images (H,L,P,Q,U,V) of Hensen’s node (F), head process (M), and neural plate (R) show Rab23 expression in ectoderm and underlying mesoderm (separated by a line in H,L), the forming chordamesoderm (Q,V), but not in neural crest cells and epidermis (R,V). Scale bars ⫽ (A–D), 500 m; (E–G, I–K, M–O, R–T) 100 m; (H, L, P, Q, U, V) 25 m. Fig. 2. Fig. 3. Phylogenetic analysis of Rab23 proteins. Analysis was performed on an alignment of 192 amino acids using the neighbour-joining method (Saitou and Nei, 1987; 1,000 pseudosamples; bootstrap values are given). This topology was also supported by other methods of analysis (data not shown). Branches with less than 50% support have been collapsed. Accession numbers: Rab23: Anopheles gambiae (African malaria mosquito) XP_309942; Canis familiaris (dog) XP_538975; Drosophila melanogaster (fruit fly) NP_649574; Gallus gallus (chicken) XP_419896; Homo sapiens (human) NP_899050; Mus musculus (house mouse) AAH25578; Pan troglodytes (chimpanzee) XP_527422; Rattus norvegicus (Norway rat) XP_346034; Tetraodon nigroviridis CAG09432; Xenopus laevis (African clawed frog) AAH75188; Trypanosoma cruzi (trypanosome) AAC32778. Rab7: Caenorhabditis elegans (nematode) NP_496549; Drosophila melanogaster (fruit fly) NP_524472; Homo sapiens (human) AAA86640. Rab3: Caenorhabditis elegans (nematode) AAK68195; Drosophila melanogaster (fruit fly) BAD07037; Homo sapiens (human) NP_002857 (a), D34323 (b), AAK08968 (c). Fig. 4. 2998 LI ET AL. Fig. 5. Rab23 mRNA expression pattern in chick neural tube. A–P: Rab 23 expression in chick midbrain (A–D), and spinal cord (I–L) in “open-book” preparations (anterior up) and transverse sections (E–H,M–P; dorsal up). Rab23 was strongly expressed in entire midbrain and spinal cord at stage 11 (A,I) and 13 (B,E,J,M). The expression gradually retreated from ventral neuroepithelium in both regions (C, D,F–H,K,L,N–P). From stage 18 onwards, Rab23 was exclusively expressed in the alar plate except for the roof plate (D,G,H,L,O,P,S). Rab23 was also expressed in notochord (E,M) and somites (N–P) but disappeared later in the notochord (F,N). Black dashed lines indicate positions of floor plate and roof plate. Arrows in C,D indicate mesencephalon-diencephalon and midbrain-hindbrain boundaries. Q–S: Rab23 expression in whole embryos at stage 8, 12, and 21. T: Parasagittal section through the eye at stage 23 showed Rab23 expression in the ventricular layer of the retina. Di, diencephalon; FP, floor plate; ME, mesencephalon; MHB, midbrain-hindbrain boundary; MDB, mesencephalon-diencephalon boundary, N, notochord; PE, prosencephalon; RE, rhombencephalon; RP, roof plate; S, somite; SC, spinal cord; TE, telencephalon. Scale bar ⫽ 100 m (A–P, R). RAB23 IN CHICK NEURAL TUBE 2999 5G,H,O,P,S and data not shown). The ventricular site of the retinal neuroepithelium also expressed Rab23. Since this area gives rise to retinal ganglion cells, Rab23 might label the layer of the retinal ganglion cells (Fig. 5T). Misexpression of Rab23 in the Midbrain To investigate the role that Rab23 plays in dorsoventral patterning of the neural tube, we misexpressed Rab23 in the lateral and ventral neural tube of the midbrain. Chick embryos were electroporated with a plasmid containing chick Rab23 and IRES-GFP or one containing GFP as control (pMES and pCAX) (Swartz et al., 2001) at stage 9 –14 and incubated for 20 or 36 hr (e.g., Fig. 6A). The efficiency of electroporation was monitored by GFPimmunostaining. In situ hybridization for Rab23 mRNA confirmed the colocalisation of Rab23 and GFP (Fig. 6A– C). Pax7, Pax3, Nkx6.1, and Nkx2.2 were used as marker genes for dorsal and ventral midbrain regions, respectively. Ventral midbrain cells, which ectopically expressed Rab23, also expressed the normally dorsally located Pax3 mRNA or Pax7 protein when the neural tube was transfected at stage 9 or 10 (Pax3: Fig. 6D–E’, n ⫽ 6/8; Pax7: Fig: 6F–H, n ⫽ 11/11). Electroporation with Rab23-pMES-GFP at stage 12 or later never resulted in an ectopic Pax7 or Pax3 expression in the ventral midbrains (n ⫽ 4/4, and n ⫽ 6/6, respectively; Fig. 6I–K). Transfection of GFP alone in ventral or dorsal midbrain also never induced Pax3 or Pax7 ectopically (n ⫽ 6/6 and n ⫽ 8/8, respectively). However, single cells normally expressing Nkx2.2 or Nkx6.1 in the midbrain were affected upon ectopic expression of Rab23 at stage 9 and 10 (Fig. 7A–G). Nkx2.2 protein and Nkx6.1 mRNA expression were downregulated in many cells co-expressing Rab23-GFP (arrowheads in Fig. 7A–D n ⫽ 9/10; and 7E,F, n ⫽ 8/8; respectively). Electroporation with Rab23pMES-GFP at stage 11 or later (Nkx2.2: n ⫽ 5/5, Nkx6.1 n ⫽ 6/6) or with GFP alone (Nkx2.2: n ⫽ 4/4; Nkx6.1: n ⫽ 3/3) never resulted in a loss of Nkx2.2 and Nkx6.1 expression in any ventral cells ectopically expressing Rab23 (Fig. 7H–J). Thus, electroporation of Rab23-pMES-GFP but not of pMES-GFP resulted in ectopic Pax3 and Pax7 expression and a reduction of Nkx2.2 and Nkx6.1 in ventral midbrain cells but only when the embryos were electroporated before stage 12 or stage 11, respectively. These results suggest that during a particular time window, ectopic Rab23 in ventral midbrain induced or facilitated the expression of specific dorsal genes and reduced the expression of specific ventral genes. Since in opb mutants, dorsal cell types are never specified and cells expressing ventral markers occupy expanded domains (Gunther et al., 1994; Sporle et al., 1996; Kasarskis et al., 1998), we investigated whether Rab23 is involved in proliferation or has a direct effect on neurogenesis in the dorsal neural midbrain. We compared the amount of proliferating cells per area in ventral and dorsal midbrain transfected either with Rab23-GFP or with GFP alone. Proliferating cells were labelled with an antibody against phosphorylated Histone 3 (pH 3; Fig. 8A,B). Misexpression of Rab23pMES-GFP or pMES-GFP in ventral and dorsal midbrain showed GFP expression in single proliferating cells. However, the vast majority of proliferating cells was GFP-negative (Fig. 8A,B). The analysis of the proliferation rate per area did not show any significant increase in the region of strong Rab23- pMES-GFP expression compared to pMES-GFP-transfected midbrains (Fig. 8C). Ectopic pMESGFP in ventral midbrain resulted on average in 0.43% less proliferating cells compared to uninjected brains (n ⫽ 3). Ectopic Rab23-pMES-GFP in ventral midbrain showed an average of 0.82% more proliferating cells (n ⫽ 4). In dorsal midbrain, ectopic pMES-GFP produced around 1% more proliferating cells (0.98%, n ⫽ 4), and misexpressed Rab23-pMESGFP around 2% (2.27%; n ⫽ 4) more proliferating cells compared to uninjected regions. None of these values indicated a significant alteration (compare standard deviations of the means in Fig. 8C). This result suggests that Rab23 does not influence the cell cycle in the midbrain and very likely also not in the rest of the neural tube. The first neurons generated in the dorsal midbrain later form the mesen- cephalic trigeminal nucleus (MTN) (Chedotal et al., 1995; Hunter et al., 2001). These neurons express the Lim transcription factor Islet 1/2 and can be stained with an antibody against medium weight neurofilament (RMO270). Comparing the development of MTN neurons stained with either RMO-270 or Islet 1/2 did not reveal any obvious rise in neurons in the Rab 23–injected dorsal midbrains compared to the control side (Fig. 9; RMO270 n ⫽ 10, Islet 1/2 n ⫽ 4). Although Islet 1/2 is expressed in the ventral midbrain by neurons of the nucleus oculomotorius, we never observed ectopic Islet1/2-positive cells in ventral midbrain upon ectopic Rab23-pMESGFP expression (data not shown). These data propose that Rab23 does not exert any influence on the rate of proliferation or neurogenesis in the dorsal midbrain but rather has an influence on the regionalisation of the DV axis of the midbrain and very likely also on the remaining neural tube. Induction of Rab23 by Bmp4 To investigate a regulation of Rab23 by the dorsally expressed morphogen Bmp4, we overexpressed Bmp4 in the dorsal midbrain (Fig. 10A). Misexpression of Bmp4 at late stage 8 and stage 9 resulted in a strong expression of Rab23 in the dorsal midbrain and an ectopic expression in the ventral midbrain (Fig. 10B, n ⫽ 6/7). Misexpression of GFP alone or of Bmp4 after stage 10 showed no induction of Rab23 in any part of the midbrain (n⫽4/4 and n ⫽ 5/5). These results suggest that BMP4 is involved in the induction of Rab23 in the dorsal midbrain early in development. DISCUSSION In this study, we present evidence that the chicken Rab23 gene, encoding a member of the large family of GTPhydrolysing enzymes (GTPases), is highly conserved during evolution and includes all the canonical motifs required for guanine nucleotide binding, GTP hydrolysis, membrane association, and the conformational switch between the GTP- and GDP bound state (Olkkonen et al., 1994; Ostermeier and Brunger, 1999; Pereira- Leal and Seabra, 2001). Rab23 is a relatively divergent Rab protein with an unusually long carboxy-terminal tail (Olkkonen et al., 1994). We also document the expression of Rab23 in the early chick embryo. Ectopic misexpression of Rab23 proposes an important role for Rab23 in dorsoventral patterning of the entire neural tube. The asymmetric expression of Rab23 in Hensen’s node and primitive streak suggests that Rab23 might be involved in the establishment of leftright asymmetry during chick gastrulation. Fig. 6. Fig. 7. Fig. 6. Ectopic Rab23 in the midbrain induces Pax3 and Pax7. Embryos were electroporated with Rab23-pMES-GFP at stage 10 (A–H) or stage 12 (I–K) and fixed at stages 17/18. A–C: Midbrain open book preparation stained for GFP protein (brown) and Rab23 mRNA (blue). Many cells expressing GFP (A, B; indicated by arrows) were labelled with Rab23 mRNA (A,C). GFP staining (B) was separated from Rab23 labelling by colour deconvolution using ImageJ (C). Arrowheads delineate an axons that originated from a double-labelled cell (grey outlined arrow). D,E: Midbrain open book preparations that ectopically expressed Rab23GFP (D, green cells to the right) and was stained for Pax3 (D’, blue) and Nkx6.1 mRNA (D’, red). Higher magnification of the boxed areas in D’ at the left (E) and the right (E’) indicated cells in the ventral midbrain ectopically expressing Pax3 upon Rab23 misexpression (arrowheads). F–H: Ventral midbrain cells ectopically expressing Rab23 pMES-GFP in a transverse section (F, green cells) also expressed Pax7 ectopically (G, red cells). H shows an overlay of F and G. Arrowheads indicate the DV boundary of Pax7. I–K: Midbrain open book preparation that showed no ectopic Pax7 in the ventral midbrain (J) upon Rab23-pMES-GFP electroporation at stage 12 (I). Arrows indicate the area of the GFP positive cells in (I). I and J are overlaid in K. FP, floor plate; MHB, midbrain-hindbrain boundary; RP, roof plate. Scale bars ⫽ 100 m. Fig. 7. Effect of Rab23 on Nkx gene expression. Embryos were electroporated with Rab23pMES-GFP (A–G) or pCAX (H–J) at stage 9 and fixed at stage 15 (A–D) or 17 (E–J). All pictures are open book preparations with anterior up. A–D: The amount of Nkx2.2-positive cells (A,C; red cells) was reduced upon ectopic Rab23GFP misexpression (B,D; green cells). Higher magnification and an overlay of A and B of the boxed area in A are shown in C and D. E–G: Arrows in E and F indicate the ectopic expression of Rab23-GFP (F, green cells) in ventral midbrain that reduced Nkx6.1 expression (E, blue). G is an overlay of the pictures in E and F. H–J: The amount of Nkx2.2 expressing cells (I) was not reduced upon ectopic GFP expression in the ventral midbrain (H,J). FP, floor plate; MHB, midbrain-hindbrain boundary. Scale bars ⫽ 100 m. The Tissue- and RegionSpecific Expression Pattern of Rab23 Our expression analysis of Rab23 mRNA showed a very early expression during gastrulation in the epidermis and mesoderm layers in the region of the primitive streak and Hensen’s node (stage 4 and 5). At stage 6, Rab23 mRNA can be seen in the neural ectoderm but not in the non-neuronal ectoderm. At stage 7, its expression in the neural plate is confined to the anterior portion but it rapidly spreads posteriorly in later stages. Rab23 is initially expressed throughout the neural tube, but its expression be- Fig. 8 Fig. 9. Fig. 8. Rate of proliferation in the midbrain upon Rab23 overexpression. A,B: Open book preparations of ventral (A) and dorsal (B) midbrain electroporated with Rab23-pMES-GFP (green) at stage 9, fixed at stage 17 followed by immunohistochemical detection of mitotic cells with pH3 (red). Arrows point to cells labelled with both, Rab-GFP and pH3. C: The percentage of mitotic cells of the GFP-positive cells (see Experimental Procedures section) upon electroporation with pMES-GFP or Rab23-pMESGFP. No significant change in the average number of mitotic cells in ventral in dorsal midbrain upon ectopic Rab23 expression was discovered. Scale bar ⫽ 100 m. Fig. 9. Rab23 overexpression has no influence on the development of mesencephalic trigeminal neurons (MTN). All embryos were electroporated at stage 10 and fixed at stage 17 (A,B) or stage 15 (C–F). GFP was visualized with green fluorescence, Islet1/2 and RMO-270 (neurofilament) with red. A,B: Midbrain open book preparation revealed no obvious difference in the pattern of the neurofilament labelling of MTN neurons (A) between control side (left) and Rab23-GFP injected side (right). B: Overlay of Rab23-GFP expressing cells and the RMO-270 stained neurons in A. Anterior is up. C–E: A transverse section showed that Islet 1/2 positive cells (E) emerged on both sides of the midbrain lateral to the roof plate (arrowheads) without any obvious difference between control side (left) and Rab23-GFP overexpressing side (right, C). F shows an overlay of C and E. Dorsal is up. FP, floor plate; ICN, interstitial nucleus of Cajal, RP, roof plate; LLF. lateral longitudinal fascicle; MLF, medial longitudinal fascicle; MTN, mesencephalic trigeminal nucleus. Scale bars ⫽ 100 m. Fig. 10. Ectopic Bmp4 induces Rab23. A,B: Ectopic expression of Bmp4 (green cells to the right in A) at stage 9 resulted in an induction of ectopic Rab23 in ventral and dorsal midbrain (B) at stage 15. The dorso-ventral boundary is indicated with a dotted line. FP, floor plate; RP, roof plate. Scale bars ⫽ 100 m. Fig. 10. 3002 LI ET AL. comes confined to the dorsal half of the neural tube at around stage 18 excluding the roof plate. At around the same time, Rab23 can be seen in somites. This expression pattern correlates with the expression of mouse Rab23 mRNA, which is present at low levels in most tissues and at high levels in the spinal cord, somites, limb buds, and cranial mesenchyme (Eggenschwiler et al., 2001). Mouse Rab23 is also initially expressed in the entire neural tube but localizes to the dorsal half of the neural tube excluding the roof plate at embryonic day 10 (E10) (Caspary and Anderson, 2003). We did not observe any expression of Rab23 in the cranial mesenchyme or limb buds at the stages we analysed. Mouse E10 correlates roughly with stage 18 to 23 in chick. Thus, Rab23 might appear later in the limb buds and the cranial mesenchyme or there might be another member of Rab23 in chick embryos, which is expressed in these structures. In contrast to chick, mouse Rab23 seems not to be expressed during gastrulation, which is also mirrored by the mutant phenotype of Rab23 (Gunther et al., 1994). This might indicate a difference in early development between mammals and birds. It will be interesting to know where Rab23 is expressed in other vertebrates to see if this early expression of Rab23 is specific for birds. As in mouse, chick Rab23 mRNA expression is similar to that of Gli3 (Schweitzer et al., 2000). Gli3 in chick embryos is initially restricted to the anterior portion of the neural plate similar to Rab23. However, Gli3 is already strongly expressed in the neural plate at stage 5, which is one stage before Rab23 becomes expressed (Schweitzer et al., 2000). Like Rab23 in the mouse and chick embryos, Gli3 is initially expressed throughout the neural plate and subsequently becomes restricted to the dorsal neural tube, where it negatively regulates the Shh signaling pathway (Buscher et al., 1997; Ruiz i Altaba, 1998; Persson et al., 2002; Meyer and Roelink, 2003). Both genes are necessary for the specification of dorsal neuronal cell types by suppressing Shh in the dorsal neural tube (Gunther et al., 1994; Eggenschwiler and Anderson, 2000; Litingtung and Chiang, 2000; Eggenschwiler et al., 2001; Persson et al., 2002). The expression of Rab23 in the retina and somites correlates with a failure of the development of neural retina layers (Gunther et al., 1994) and malformations of axial skeleton in opb mutant mice (Sporle et al., 1996; Sporle and Schughart, 1998). Thus, the expression pattern of Rab23 in the chick neural tube and eye suggests a similar role for Rab23 in the chick embryo. Asymmetric Expression of Rab23 and Left-right Determination of Hensen’s Node in Chick Embryos Recent studies demonstrate that signals that specify left-right (LR) difference in the lateral plate mesoderm (LPM) originate in and around the node in developing chick and mouse embryos. Shh is thought to be the key signal conveying the left-right information from the node to lateral plate mesoderm (LPM). At stage 4 in chick embryos, Shh and Fgf8 are symmetrically expressed in Hensen’s node, whereby Fgf8 shows only a weak expression in Hensen’s node compared to a strong expression in the primitive streak. Both genes begin to show an asymmetric pattern in Hensen’s node at stage 5. Shh is found on the left side and Fgf8 on the right side (Levin et al., 1995, 1997; Pagan-Westphal and Tabin, 1998; Dathe et al., 2002). The right-sided expression of FGF8 is induced by Bmp4 via chick Mid1 (Levin et al., 1995, 1997; Monsoro-Burq and Le Douarin, 2001; Granata and Quaderi, 2003, 2005). Asymmetrically expressed Bmp4 inhibits Shh expression in the right side of Hensen’s node via the Polycomblike 2 gene product (Pcl2), thereby restricting Shh expression to the left side of Hensen’s node (Wang et al., 2004). Our results show that Rab23 is asymmetrically expressed in Hensen’s node and the primitive streak. The expression in Hensen’s node is persistent between stages 4 –7 and especially prominent at stage 4 prior to the asymmetric onset of Shh and Fgf8. Thus, when Rab23 expression becomes weak in the node at stage 5, the asymmetric Shh expression becomes obvious (stage 5 to 6; Levin et al., 1995). Asymmetric Rab23 expression in Hensen’s node appears and disappears one stage earlier than Pcl2 expression but together with Gli3, another suppressor of Shh signaling (Levin et al., 1995., 1997; Monsoro-Burq and Le Douarin, 2001; Granata and Quaderi, 2003, 2005). Pcl2 has been shown to be a direct downstream target of the Bmp4 pathway, which suppresses Shh through direct transcriptional effects in the right side of Hensen’s node (Wang et al., 2004). Rab23 has been suggested to be a negative regulator of Shh, and it might be activated by Bmps in the dorsal neural tube (Eggenschwiler et al., 2001, 2006; and our results). It is tempting to assume that during gastrulation, Rab23 induced by Bmp4 together with Gli3 negatively regulates the Shh pathway perhaps by supporting Pcl2 suppression of Shh transcription. Thus, Rab23 might be involved in specifying the LR axis by helping to establish the leftright asymmetry of Hensen’s node. Rab23 Misexpression Dorsalizes Ventral Midbrain But Has No Apparent Influence on Cell Proliferation and Neurogenesis We investigated if overexpression of Rab23 leads to an ectopic expression of the dorsal genes Pax3 and Pax7 in ventral midbrain and a reduction in ventral gene expression. Opb mutants lack dorsal cell types specifically in the caudal neural tube and ventral specific genes extent dorsally (Gunther et al., 1994; Eggenschwiler and Anderson, 2000). Hence, overexpression should result in downregulation of ventral genes and upregulation of dorsal genes in the ventral neural tube. Ectopic expression of Rab23 did indeed produce an ectopic Pax3 and Pax7 expression in ventral midbrain. Although, ectopic Pax3 mRNA was never as strongly induced as Pax7 protein, Pax7 can induce the expression of Pax3 in the ventral midbrain (Matsunaga et al., 2001). Thus, the weak ectopic expression of Pax3 upon Rab23 overexpression might reflect a necessity of Pax7 for the induction of Pax3. These results are in agreement with the phenotype of the opb mutant, where the dorsal marker Pax7 is not expressed (Gunther et al., 1994). In RAB23 IN CHICK NEURAL TUBE 3003 addition, in the area of Nkx2.2 and Nkx6.1 expression, we observed both cells that expressed Rab23 and Nkx genes and cells that expressed only Rab23. The downregulation of Nkx2.2 or Nkx6.1 in not all cells might be explained by non-sufficient amounts of ectopic Rab23 protein to affect highly abundant Shh signaling required for Nkx2.2 and Nkx6.1 induction (Roelink et al., 1995; Ericson et al., 1997a). Thus, our data suggest that ectopic expression of Rab23 is sufficient to reduce ventral neural tube markers like Nkx2.2 and Nkx6.1 that need Shh for their expression and allows for dorsal genes like Pax7 and Pax3 to be expressed. We only observed a change in cell specification of ventral cells when embryos were electroporated prior to stage 11 (Nkx genes) or stage 12 (Pax genes). After stage 11 or stage 12, respectively, ectopic Rab23 did not result in reduction of Nkx2.2 or Nkx6.1 or in ectopic Pax3 or Pax7 gene expression or in ventral midbrain. Both Pax3 and Pax7 genes need dorsal Bmp signals from the roof plate to be induced (Goulding et al., 1993a; Liem et al., 1997; Mansouri and Gruss, 1998). In the ventral neural tube, Bmp antagonists suppress these roof plate signals (Patten and Placzek, 2002). We showed recently that at stage 12, ventral midbrain cells are still able to adopt a dorsal fate (Li et al., 2005). However, although ectopic ventral Rab23 blocks the Shh signaling pathway, dorsal genes were not expressed after stage 12. This might suggest that, after stage 12, the amount of Bmp proteins that reach and/or persist in ventral regions might be too low to induce dorsal genes (Furuta et al., 1997; Smith, 1999; Liem et al., 2000; Patten and Placzek, 2002). The Rab23 mouse mutant created by Kasarskis et al. (1998) shows an open neural tube along the entire anterio-posterior axis but lacks Rab23 expression only in the posterior neural tube and does not affect the general DV patterning in the anterior neural tube (Eggenschwiler et al., 2001). This suggested that signals from the roof plate, which are still present in the anterior neural tube of the open brain mutant, activate the expression of Rab23 (Eggenschwiler et al., 2000, 2001). Here, we show that Bmp 4 is able to induce ectopic Rab23 in the ventral midbrain at early stages in development. Thus, our results support the assumption that the presence of Bmp in the anterior neural tube of the open brain mutant induces Rab23, which then promotes dorsal neural cell fates by silencing the Shh pathway. Rab 23 localizes to the plasma membrane and the endocytic pathway (Evans et al., 2003) and is known to inhibit Shh signaling intracellularly (Eggenschwiler et al., 2001). Rab23 could regulate the cellular dynamics of different components of the Shh pathway that undergo dynamic movements between plasma membrane and endosomal compartments (Incardona et al., 2000). However, the subcellular distribution pattern of neither Ptc nor Smo was altered by overexpression of wild type or Rab23 mutant protein (Evans et al., 2003). Similarly, Rab23/Smo double mutants exhibit the same external morphology and spinal cord cell type patterning as the Rab23 single mutant (Eggenschwiler et al., 2006). These results indicate that Rab23 does not directly regulate cellular dynamics of proteins, which lie upstream in the Shh signaling pathway. Rab23 rather influence Gli transcription factors in more direct ways than anticipated. Thus, the phenotype of a double mutant of Rab23 and Gli2 indicates that Rab23 functions upstream of Gli2, as loss of Gli2 could mostly suppress the Rab23 phenotype, in a dose-dependent manner (Eggenschwiler et al., 2006). Rab23 also has a role in the production of the Gli3 repressor, as proteolytically processed Gli3 decreases by fivefold in Rab23 mutant embryos extracts compared with wild type. Rab might affect the nucleoplasmic trafficking of Gli proteins or that of relevant components of Shh signaling such as Iguana or Tectronic (Sekimizu et al., 2004; Wolff et al., 2004; Reiter and Skarnes, 2006). Nevertheless, our results provide evidence that the ectopic expression of Rab23 in ventral midbrain cells facilitates the expression of dorsal genes and reduces ventral genes that are induced by Shh early in development, confirming a role of Rab23 as repressor of Shh signaling in chick embryos. Does Rab23 only act as a repressor of Shh or does it also influence proliferation and neurogenesis? Rab23 overexpression in the midbrain did not reveal any significant change in the rate of cell proliferation in dorsal and ventral midbrain or in neurogenesis in dorsal midbrain, at least not one day after overexpression. Taken together, our results suggest a similar role for Rab23 in mouse and chick neural tube, namely as a negative regulator of Shh. Our results in the chick midbrain also suggest that Rab23 acts not only in spinal cord as known from mouse mutants but also in the brain. EXPERIMENTAL PROCEDURES Isolation of Chick Rab23 Using the coding region of the mouse Rab23 cDNA (Olkkonen et al., 1994) as a query, we searched for sequence similarities in the chick database (http://www.chick.unist.ac.uk). This revealed 4 chick EST clones (ChEST75d14, ChEST545g23, ChEST885j22, ChEST925k6) (Boardman et al., 2002; Hubbard et al., 2005). After sequence analysis, the 3 clones (chEST 545h23, 885j22, and 925k6) with the highest homologies were used as templates to prepare RNA probes for in situ hybridization. The full-length chicken Rab23 was isolated by linker PCR. Specific primers including start and stop codons were combined with XbaI and BamH1 (forward primer: CGCTCTAGATGAGCTGCAGAG ATGTTGG; reverse primer: CGCGGATCCCATAGGCACAA GATT) and subcloned into the expression vector pMES (Swartz et al., 2001; kind gift of Dr. C. Krull). Phylogenetic Analysis Multiple sequence alignments were generated using PileUp from the GCG Wisconsin package (Version 10.3, Accelrys Inc., San Diego, CA) and ClustalX (Thompson et al., 1997). Phylogenetic analyses were performed on an alignment of 192 amino-acids using the neighbour-joining method (Saitou and Nei, 1987; 1,000 pseudosamples) as implemented in PAUP* (Rogers and Swofford, 1998). Rab sequences were retrieved using the NCBI BLAST server (http://www.ncbi.nlm. nih.gov/BLAST/). 3004 LI ET AL. In Situ Hybridization and Immunohistochemistry and Visualisation Fertile hens’ eggs were incubated in a humidified atmosphere at 37°C to the required stage. Embryos were staged according to Hamburger and Hamilton (1951). In situ hybridization was performed as described (Henrique et al., 1995). The RNA antisense transcripts from clones 885j22 and 925k6 produced a much stronger signal and less background than clone 545h23 (both covered most of the coding region including the 5⬘ end), while sense transcripts of all 3 clones did not show any significant staining. For double in situ hybridizations, the protocol was modified as described by Li et al. (2005). The Pax3 and Nkx6.1 probe have been described previously (Goulding et al., 1993b). Pax7 was obtained from the BBSRC chickenEST Databank (ChEST329n14) (Boardman et al., 2002; Hubbard et al., 2005). Patched 2 (Ptc2) was a kind gift of Dr. Farshid Seif. Embryos were further stained using antibodies against Islet 1/2 (39.4D5) and Pax7 and Nkx2.2 (Developmental Studies Hybridoma Bank (DSHB) under the auspices of the NICHD, and maintained by the University of Iowa, Department of Biological Sciences, Iowa City, IA 52242 (Ericson et al., 1996; Kawakami et al., 1997), against neurofilament (RMO-270, Zymed), and against the phosphorylated form of Histon H3 (PH3, Biomol) and GFP (Polysciences). Appropriate Cy2 and Cy3 secondary antibodies (4 g/ml; Jackson ImmunoResearch) or peroxidase coupled antibodies (Amersham) were applied to detect primary antibody binding. All antibodies were applied as previously described (Li et al., 2005). Embryonic brains were flatmounted or transversely sectioned at 50 m on a vibratome, mounted on slides in glycerol/PBS (9:1), and analysed and photographed using a Leica microscope (Leica D-RM) or a confocal microscope (Leica TCS Sp). The separation of dyes used in bright field histology was achieved with a plugin of ImageJ that generates images by colour subtraction. The colour deconvolution plugin implements stain separation using a method described by Ruifrok and Johnston (2001). The code is based on an NIH Image macro kindly provided by A.C. Ruifrok. Electroporation The chicken Rab23 coding region was cloned into the pMES vector (Rab23pMES-GFP; Swartz et al., 2001). pCAX vector, which expresses an EGFGP (Swartz et al., 2001) and contains the same promoter and enhancer as pMES, was used as control. Bmp4 (a kind gift of E. Aguis) cloned into pCDNA II was mixed with pCAX to visualise it. Fertilized chicken eggs were incubated at 37°C in a humidified incubator until stage 9 –13 (Hamburger and Hamilton,1951) and windowed. Rab23-pMES-GFP, Bmp4 plus pCAX, or pCAX alone were electroporated into the neural tube at midbrain level (2–5 pulses, 50 ms/20 –25V; pMES, pCAX, Bmp4 each 3 g/l plus 1.5 g/l pCAX in the case of Bmp4). The electrodes were placed parallel to the neural tube at different dorso-ventral levels, depending on which region was to be transfected (Muramatsu et al., 1998). After electroporation, embryos were reincubated to stages 15–23 of development. Successful neural tube transfection was verified in ovo using a Leica (Germany) fluorescence dissecting microscope equipped with EGFP optics. Embryos were then collected and fixed for 2 hr to overnight in 4% paraformaldehyde. ACKNOWLEDGMENTS We thank C. Winkler, J. Clarke, and R. Klafke for a critical reading of the manuscript and stimulating discussions, C. Krull for kindly providing us with the pMES- and pCAX plasmids, E. Aguis for kindly providing the fulllength Bmp4, Barbara Katzenberger, Marcel Zahn for excellent technical assistance, and Christian Böhringer for his help with ImageJ. A.W. was supported by a Junior Research Group grant of the Volkswagenstiftung. N.L. was supported by a fellowship from the SFB 465 (DFG) and the Volkswagenstiftung. REFERENCES Amor JC, Harrison DH, Kahn RA, Ringe D. 1994. Structure of the human ADP-ribosylation factor 1 complexed with GDP. Nature 372:704 –708. Aruga J, Tohmonda T, Homma S, Mikoshiba K. 2002. Zic1 promotes the expansion of dorsal neural progenitors in spinal cord by inhibiting neuronal differentiation. Dev Biol 244:329 –341. Barth KA, Kishimoto Y, Rohr KB, Seydler C, Schulte-Merker S, Wilson SW. 1999. Bmp activity establishes a gradient of positional information throughout the entire neural plate. Development 126: 4977–4987. Boardman PE, Sanz-Ezquerro J, Overton IM, Burt DW, Bosch E, Fong WT, Tickle C, Brown WR, Wilson SA, Hubbard SJ. 2002. A comprehensive collection of chicken cDNAs. Curr Biol 12:1965–1969. Briscoe J, Ericson J. 2001. Specification of neuronal fates in the ventral neural tube. Curr Opin Neurobiol 11:43–49. Briscoe J, Pierani A, Jessell TM, Ericson J. 2000. A homeodomain protein code specifies progenitor cell identity and neuronal fate in the ventral neural tube. Cell 101:435–445. Briscoe J, Chen Y, Jessell TM, Struhl G. 2001. A hedgehog-insensitive form of patched provides evidence for direct long-range morphogen activity of sonic hedgehog in the neural tube. Mol Cell 7:1279 –1291. Buscher D, Bosse B, Heymer J, Ruther U. 1997. Evidence for genetic control of Sonic hedgehog by Gli3 in mouse limb development. Mech Dev 62:175–182. Caspary T, Anderson KV. 2003. Patterning cell types in the dorsal spinal cord: what the mouse mutants say. Nat Rev Neurosci 4:289 –297. Chavrier P, Gorvel JP, Stelzer E, Simons K, Gruenberg J, Zerial M. 1991. Hypervariable C-terminal domain of rab proteins acts as a targeting signal. Nature 353:769 –772. Chedotal A, Pourquie O, Sotelo C. 1995. Initial tract formation in the brain of the chick embryo: selective expression of the BEN/SC1/DM-GRASP cell adhesion molecule. Eur J Neurosci 7:198 –212. Chen CY, Shyu AB. 1995. AU-rich elements: characterization and importance in mRNA degradation. Trends Biochem Sci 20:465–470. Chesnutt C, Burrus LW, Brown AM, Niswander L. 2004. Coordinate regulation of neural tube patterning and proliferation by TGFbeta and WNT activity. Dev Biol 274:334 –347. Chiang C, Litingtung Y, Lee E, Young KE, Corden JL, Westphal H, Beachy PA. 1996. Cyclopia and defective axial patterning in mice lacking Sonic hedgehog gene function. Nature 382:407–413. Chizhikov VV, Millen KJ. 2004. Control of roof plate development and signaling by Lmx1b in the caudal vertebrate CNS. J Neurosci 24:5694 –5703. Chizhikov VV, Millen KJ. 2005. Roof platedependent patterning of the vertebrate dorsal central nervous system. Dev Biol 277:287–295. Dathe V, Gamel A, Manner J, Brand-Saberi B, Christ B. 2002. Morphological left-right asymmetry of Hensen’s node precedes the asymmetric expression of RAB23 IN CHICK NEURAL TUBE 3005 Shh and Fgf8 in the chick embryo. Anat Embryol (Berl) 205:343–354. Dickinson ME, Selleck MA, McMahon AP, Bronner-Fraser M. 1995. Dorsalization of the neural tube by the non-neural ectoderm. Development 121:2099 –2106. Eggenschwiler JT, Anderson KV. 2000. Dorsal and lateral fates in the mouse neural tube require the cell-autonomous activity of the open brain gene. Dev Biol 227:648 –660. Eggenschwiler JT, Espinoza E, Anderson KV. 2001. Rab23 is an essential negative regulator of the mouse Sonic hedgehog signalling pathway. Nature 412:194 – 198. Eggenschwiler JT, Bulgakov OV, Qin J, Li T, Anderson KV. 2006. Mouse Rab23 regulates hedgehog signaling from smoothened to Gli proteins. Dev Biol 290:1–12. Ericson J, Morton S, Kawakami A, Roelink H, Jessell TM. 1996. Two critical periods of Sonic Hedgehog signaling required for the specification of motor neuron identity. Cell 87:661–673. Ericson J, Briscoe J, Rashbass P, van Heyningen V, Jessell TM. 1997a. Graded sonic hedgehog signaling and the specification of cell fate in the ventral neural tube. Cold Spring Harb Symp Quant Biol 62:451–466. Ericson J, Rashbass P, Schedl A, BrennerMorton S, Kawakami A, van Heyningen V, Jessell TM, Briscoe J. 1997b. Pax6 controls progenitor cell identity and neuronal fate in response to graded Shh signaling. Cell 90:169 –180. Evans TM, Ferguson C, Wainwright BJ, Parton RG, Wicking C. 2003. Rab23, a negative regulator of hedgehog signaling, localizes to the plasma membrane and the endocytic pathway. Traffic 4:869 – 884. Furuta Y, Piston DW, Hogan BL. 1997. Bone morphogenetic proteins (BMPs) as regulators of dorsal forebrain development. Development 124:2203–2212. Gilman AG. 1987. G proteins: transducers of receptor-generated signals. Annu Rev Biochem 56:615–649. Goulding M, Sterrer S, Fleming J, Balling R, Nadeau J, Moore KJ, Brown SD, Steel KP, Gruss P. 1993a. Analysis of the Pax-3 gene in the mouse mutant splotch. Genomics 17:355–363. Goulding MD, Lumsden A, Gruss P. 1993b. Signals from the notochord and floor plate regulate the region-specific expression of two Pax genes in the developing spinal cord. Development 117:1001– 1016. Granata A, Quaderi NA. 2003. The Opitz syndrome gene MID1 is essential for establishing asymmetric gene expression in Hensen’s node. Dev Biol 258:397–405. Granata A, Quaderi NA. 2005. Asymmetric expression of Gli transcription factors in Hensen’s node. Gene Expr Patterns 5: 529 –531. Gunther T, Struwe M, Aguzzi A, Schughart K. 1994. Open brain, a new mouse mutant with severe neural tube defects, shows altered gene expression patterns in the developing spinal cord. Development 120:3119 –3130. Hamburger V, Hamilton HL. 1951. A series of of normal stages in the development of the chick embryo. J Morphol 68: 49 –95. Henrique D, Adam J, Myat A, Chitnis A, Lewis J, Ish-Horowicz D. 1995. Expression of a Delta homologue in prospective neurons in the chick. Nature 375:787– 790. Hubbard SJ, Grafham DV, Beattie KJ, Overton IM, McLaren SR, Croning MD, Boardman PE, Bonfield JK, Burnside J, Davies RM, Farrell ER, Francis MD, Griffiths-Jones S, Humphray SJ, Hyland C, Scott CE, Tang H, Taylor RG, Tickle C, Brown WR, Birney E, Rogers J, Wilson SA. 2005. Transcriptome analysis for the chicken based on 19,626 finished cDNA sequences and 485,337 expressed sequence tags. Genome Res 15:174 –183. Hunter E, Begbie J, Mason I, Graham A. 2001. Early development of the mesencephalic trigeminal nucleus. Dev Dyn 222: 484 –493. Ille F, Atanasoski S, Falk S, Ittner LM, Marki D, Buchmann-Moller S, Wurdak H, Suter U, Taketo MM, Sommer L. 2007. Wnt/BMP signal integration regulates the balance between proliferation and differentiation of neuroepithelial cells in the dorsal spinal cord. Dev Biol 304:394 –408. Incardona JP, Lee JH, Robertson CP, Enga K, Kapur RP, Roelink H. 2000. Receptormediated endocytosis of soluble and membrane-tethered Sonic hedgehog by Patched-1. Proc Natl Acad Sci USA 97: 12044 –12049. Kasarskis A, Manova K, Anderson KV. 1998. A phenotype-based screen for embryonic lethal mutations in the mouse. Proc Natl Acad Sci USA 95:7485–7490. Kawakami A, Kimura-Kawakami M, Nomura T, Fujisawa H. 1997. Distributions of PAX6 and PAX7 proteins suggest their involvement in both early and late phases of chick brain development. Mech Dev 66:119 –130. Lee KJ, Jessell TM. 1999. The specification of dorsal cell fates in the vertebrate central nervous system. Annu Rev Neurosci 22:261–294. Lee KJ, Dietrich P, Jessell TM. 2000. Genetic ablation reveals that the roof plate is essential for dorsal interneuron specification. Nature 403:734 –740. Leung KF, Baron R, Ali BR, Magee AI, Seabra MC. 2006. Rab GTPases containing a CAAX motif are processed post-geranylgeranylation by proteolysis and methylation. J Biol Chem 282: 1487–1497. Levin M, Johnson RL, Stern CD, Kuehn M, Tabin C. 1995. A molecular pathway determining left-right asymmetry in chick embryogenesis. Cell 82:803–814. Levin M, Pagan S, Roberts DJ, Cooke J, Kuehn MR, Tabin CJ. 1997. Left/right patterning signals and the independent regulation of different aspects of situs in the chick embryo. Dev Biol 189:57–67. Li N, Hornbruch A, Klafke R, Katzenberger B, Wizenmann A. 2005. Specification of dorsoventral polarity in the embryonic chick mesencephalon and its presumptive role in midbrain morphogenesis. Dev Dyn 233:907–920. Liem KF, Tremml G, Roelink H, Jessell TM. 1995. Dorsal differentiation of neural plate cells induced by BMP-mediated signals from epidermal ectoderm. Cell 82: 969 –979. Liem KF Jr, Tremml G, Jessell TM. 1997. A role for the roof plate and its resident TGFbeta-related proteins in neuronal patterning in the dorsal spinal cord. Cell 91:127–138. Liem KF Jr, Jessell TM, Briscoe J. 2000. Regulation of the neural patterning activity of sonic hedgehog by secreted BMP inhibitors expressed by notochord and somites. Development 127:4855–4866. Litingtung Y, Chiang C. 2000. Specification of ventral neuron types is mediated by an antagonistic interaction between Shh and Gli3. Nat Neurosci 3:979 –985. Mansouri A, Gruss P. 1998. Pax3 and Pax7 are expressed in commissural neurons and restrict ventral neuronal identity in the spinal cord. Mech Dev 78:171–178. Marti E, Bumcrot DA, Takada R, McMahon AP. 1995. Requirement of 19K form of sonic hedgehog for induction of distinct ventral cell types in CNS explants. Nature 375:322–325. Matsunaga E, Araki I, Nakamura H. 2001. Role of Pax3/7 in the tectum regionalization. Development 128:4069 –4077. McMahon JA, Takada S, Zimmerman LB, Fan CM, Harland RM, McMahon AP. 1998. Noggin-mediated antagonism of BMP signaling is required for growth and patterning of the neural tube and somite. Genes Dev 12:1438 –1452. Meyer NP, Roelink H. 2003. The aminoterminal region of Gli3 antagonizes the Shh response and acts in dorsoventral fate specification in the developing spinal cord. Dev Biol 257:343–355. Millen KJ, Millonig JH, Hatten ME. 2004. Roof plate and dorsal spinal cord dl1 interneuron development in the dreher mutant mouse. Dev Biol 270:382–392. Millonig JH, Millen KJ, Hatten ME. 2000. The mouse Dreher gene Lmx1a controls formation of the roof plate in the vertebrate CNS. Nature 403:764 –769. Monsoro-Burq A, Le Douarin NM. 2001. BMP4 plays a key role in left-right patterning in chick embryos by maintaining Sonic Hedgehog asymmetry. Mol Cell 7: 789 –799. Muramatsu T, Nakamura A, Park H. 1998. In vivo electroporation: a powerful and convenient means of nonviral gene transfer to tissues of living animals. Int J Mol Med 1:55–62. Newman CM, Magee AI. 1993. Posttranslational processing of the ras superfamily of small GTP-binding proteins. Biochim Biophys Acta 1155:79 –96. Nguyen VH, Trout J, Connors SA, Andermann P, Weinberg E, Mullins MC. 2000. Dorsal and intermediate neuronal cell types of the spinal cord are established 3006 LI ET AL. by a BMP signaling pathway. Development 127:1209 –1220. Olkkonen VM, Peterson JR, Dupree P, Lutcke A, Zerial M, Simons K. 1994. Isolation of a mouse cDNA encoding Rab23, a small novel GTPase expressed predominantly in the brain. Gene 138:207–211. Ostermeier C, Brunger AT. 1999. Structural basis of Rab effector specificity: crystal structure of the small G protein Rab3A complexed with the effector domain of rabphilin-3A. Cell 96:363–374. Paduch M, Jelen F, Otlewski J. 2001. Structure of small G proteins and their regulators. Acta Biochim Pol 48:829 – 850. Pagan-Westphal SM, Tabin CJ. 1998. The transfer of left-right positional information during chick embryogenesis. Cell 93: 25–35. Patten I, Placzek M. 2002. Opponent activities of Shh and BMP signaling during floor plate induction in vivo. Curr Biol 12:47–52. Pereira-Leal JB, Seabra MC. 2001. Evolution of the Rab family of small GTP-binding proteins. J Mol Biol 313:889 –901. Persson M, Stamataki D, te Welscher P, Andersson E, Bose J, Ruther U, Ericson J, Briscoe J. 2002. Dorsal-ventral patterning of the spinal cord requires Gli3 transcriptional repressor activity. Genes Dev 16:2865–2878. Piddini E, Vincent JP. 2003. Modulation of developmental signals by endocytosis: different means and many ends. Curr Opin Cell Biol 15:474 –481. Psychoyos D, Stern CD. 1996. Fates and migratory routes of primitive streak cells in the chick embryo. Development 122: 1523–1534. Reiter JF, Skarnes WC. 2006. Tectonic, a novel regulator of the Hedgehog pathway required for both activation and inhibition. Genes Dev 20:22–27. Roelink H, Porter JA, CHiang C, Tanabe T, Chang DT, Beachy PA, Jessell TM. 1995. Floor plate and motor neuron induction by different concentrations of the aminoterminal cleavage product of sonic hedgehog autoproteolysis. Cell 81:445– 455. Rogers JS, Swofford DL. 1998. A fast method for approximating maximum likelihoods of phylogenetic trees from nucleotide sequences. Syst Biol 47:77– 89. Ruifrok AC, Johnston DA. 2001. Quantification of histochemical staining by color deconvolution. Anal Quant Cytol Histol 23:291–299. Ruiz i Altaba A. 1998. Combinatorial Gli gene function in floor plate and neuronal inductions by Sonic hedgehog. Development 125:2203–2212. Saitou N, Nei M. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4:406 –425. Schweitzer R, Vogan KJ, Tabin CJ. 2000. Similar expression and regulation of Gli2 and Gli3 in the chick limb bud. Mech Dev 98:171–174. Sekimizu K, Nishioka N, Sasaki H, Takeda H, Karlstrom RO, Kawakami A. 2004. The zebrafish iguana locus encodes Dzip1, a novel zinc-finger protein required for proper regulation of Hedgehog signaling. Development 131:2521–2532. Smith WC. 1999. TGF beta inhibitors. New and unexpected requirements in vertebrate development. Trends Genet 15:3– 5. Sporle R, Schughart K. 1997. Neural tube morphogenesis. Curr Opin Genet Dev 7: 507–512. Sporle R, Schughart K. 1998. Paradox segmentation along inter- and intrasomitic borderlines is followed by dysmorphology of the axial skeleton in the open brain (opb) mouse mutant. Dev Genet 22:359 –373. Sporle R, Gunther T, Struwe M, Schughart K. 1996. Severe defects in the formation of epaxial musculature in open brain (opb) mutant mouse embryos. Development 122:79 –86. Sprang SR. 1997. G protein mechanisms: insights from structural analysis. Annu Rev Biochem 66:639 –678. Swartz M, Eberhart J, Mastick GS, Krull CE. 2001. Sparking new frontiers: using in vivo electroporation for genetic manipulations. Dev Biol 233:13–21. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25:4876 –4882. Timmer JR, Wang C, Niswander L. 2002. BMP signaling patterns the dorsal and intermediate neural tube via regulation of homeobox and helix-loop-helix tran- scription factors. Development 129:2459 – 2472. Towers P, Patel K, Withington S, Isaac A, Cooke J. 1999. Flik, a chick follistatinrelated gene, functions in gastrular dorsalisation/neural induction and in subsequent maintenance of midline Sonic hedgehog signalling. Dev Biol 214:298 – 317. Tremblay P, Pituello F, Gruss P. 1996. Inhibition of floor plate differentiation by Pax3: evidence from ectopic expression in transgenic mice. Development 122: 2555–2567. Viebahn C. 2001. Hensen’s node. Genesis 29:96 –103. Wang S, Yu X, Zhang T, Zhang X, Zhang Z, Chen Y. 2004. Chick Pcl2 regulates the left-right asymmetry by repressing Shh expression in Hensen’s node. Development 131:4381–4391. Wang Y, Ng EL, Tang BL. 2006. Rab23: what exactly does it traffic? Traffic 7:746 – 750. Wijgerde M, McMahon JA, Rule M, McMahon AP. 2002. A direct requirement for Hedgehog signaling for normal specification of all ventral progenitor domains in the presumptive mammalian spinal cord. Genes Dev 16:2849 –2864. Wilson L, Maden M. 2005. The mechanisms of dorsoventral patterning in the vertebrate neural tube. Dev Biol 282:1– 13. Wolff C, Roy S, Lewis KE, Schauerte H, Joerg-Rauch G, Kirn A, Weiler C, Geisler R, Haffter P, Ingham PW. 2004. iguana encodes a novel zinc-finger protein with coiled-coil domains essential for Hedgehog signal transduction in the zebrafish embryo. Genes Dev 18:1565–1576. Yamada T, Placzek M, Tanaka H, Dodd J, Jessell TM. 1991. Control of cell pattern in the developing nervous system: polarizing activity of the floor plate and the notochard. Cell 64:635–647. Zhong JM, Chen-Hwang MC, Hwang YW. 1995. Switching nucleotide specificity of Ha-Ras p21 by a single amino acid substitution at aspartate 119. J Biol Chem 270:10002–10007. Zhuang B, Sockanathan S. 2006. Dorsalventral patterning: a view from the top. Curr Opin Neurobiol 16:20 –24.