Download Assignment 2

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

DNA damage theory of aging wikipedia , lookup

Mitochondrial DNA wikipedia , lookup

RNA-Seq wikipedia , lookup

Mutagen wikipedia , lookup

Genome (book) wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Oncogenomics wikipedia , lookup

Human genome wikipedia , lookup

Nucleic acid double helix wikipedia , lookup

Neuronal ceroid lipofuscinosis wikipedia , lookup

SNP genotyping wikipedia , lookup

DNA supercoil wikipedia , lookup

Epitranscriptome wikipedia , lookup

Epigenetics of neurodegenerative diseases wikipedia , lookup

History of genetic engineering wikipedia , lookup

No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup

Extrachromosomal DNA wikipedia , lookup

Genomics wikipedia , lookup

Therapeutic gene modulation wikipedia , lookup

Designer baby wikipedia , lookup

Mutation wikipedia , lookup

Non-coding DNA wikipedia , lookup

Microevolution wikipedia , lookup

Genetic code wikipedia , lookup

Gene wikipedia , lookup

Deoxyribozyme wikipedia , lookup

Frameshift mutation wikipedia , lookup

Helitron (biology) wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Genealogical DNA test wikipedia , lookup

Primary transcript wikipedia , lookup

Dominance (genetics) wikipedia , lookup

Hardy–Weinberg principle wikipedia , lookup

Point mutation wikipedia , lookup

Quantitative trait locus wikipedia , lookup

Cell-free fetal DNA wikipedia , lookup

Transcript
Anthro 260
Name:_________________
Assignment 2
Date: __________________
Due: 9/21/2010
Solve the following problems
Show detailed solutions; attach additional paper if necessary
1. Below are a fragment of a DNA sequence and the primary structure of a polypeptide that somehow
relates to this sequence:
DNA:
TTCTGCTGAACTTTATTTTTGAAACACTGGAGACTGCACACTTCATG
polypeptide:
methionine – lysine – cysteine – phenylalanine –glutamine – lysine
Based on the table of mRNA codons (see p33 in Relethford) answer the following questions:
1. Determine the direction of transcription
2. Locate the initiation and termination codons
3. Circle coding codons; cross-out non-coding areas
4. Draw a diagram showing the sequence of mRNA before and after splicing as well as
complementary tRNA in a proper order carrying proper aminoacids.
5. Suggest 3 different point mutations in the DNA sequence that could happen inside the coding
areas but would have no effect on the primary structure of the polypeptide.
6. Suggest 2 different point mutations that each will change one of the amino-acids to leucine.
2. Benign neonatal epilepsy is inherited as an autosomal recessive trait [e-allele].
Margaret was diagnosed with the neonatal epilepsy. None of her parents show any symptoms of this
condition. What are the genotypes of Margaret’s parents?
mother___________________ father___________________
3. Sick Sinus Syndrom (SSS) is inherited as an autosomal dominant trait [S-allele].
Neither Mr. Bidders nor Mrs. Bidders have SSS.
What are their chances of having a child with SSS? _____________________________
4. Celiac disease (an inability to digest wheat) and lactose intolerance (an inability to digest milk), are
both autosomal recessive conditions [c-allele and l-allele respectively]. Mr. and Mrs. Peters are
heterozygous for both, the lactose intolerance and celiac disease.
What are the possible genotypes of Mr. and Mrs. Peters? ____________
What are the possible genotypes of their children? ___________________
What are their chances of having a child with both disorders? ______________
5. Baldness is inherited as an autosomal dominant trait in males and as an autosomal recessive trait in
females. A heterozygous man marries a heterozygous woman.
What are their chances of having a bald daughter?__________________
What are their chances of having a bald son?__________________
6. Mr. Evers is a dominant homozygote for genes A, B, and C, recessive homozygote for gene D, and
heterozygote for genes E, F, and G.
What is the genotype of Mr. Evers?: ________________________________
How many unique gamete types can be produced by Mr. Evers? ____________________
His wife, Mrs. Evers has the following genotype: aa bb CC Dd EE Ff gg
How many unique gamete types can be produced by Mrs. Evers? ___________________
What are the chances of Mr. and Mrs. Evers having a child
with Aa Bb genotype?: _________________
with Aa Bb CC DD genotype?: _________________
with aa Bb Cc dd genotype?: _________________
with Aa Bb CC dd Ee ff gg genotype? _______________________
7. Maximilian and Nicolas are brothers. Maximilian has blood group O, while Nicolas has blood group
AB. Is it possible to determine the blood groups of their parents? If yes, what are they?
_____________________________________________
8. Wolfram Syndrome is linked to a mutation in mitochondrial DNA. Jennifer is suffering from
Wolfram syndrome. She has two daughters and one son. Which of her children are expected to suffer
from Wolfram syndrome? Explain your answer:
9. Hemophilia is the oldest known hereditary bleeding disorder. This disease is caused by a recessive
allele located on X chromosome. Mr. Nodes has hemophilia. His wife does not have hemophilia, but it is
known that her mother had hemophilia.
What are the chances that the son of Mr. and Mrs. Nodes will have hemophilia? ____________
What are the chances that the daughter of Mr. and Mrs. Nodes will have hemophilia? _________