* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download RNA
Molecular cloning wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
List of types of proteins wikipedia , lookup
Bottromycin wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Biochemistry wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Molecular evolution wikipedia , lookup
RNA interference wikipedia , lookup
Expanded genetic code wikipedia , lookup
Non-coding DNA wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Polyadenylation wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Messenger RNA wikipedia , lookup
RNA silencing wikipedia , lookup
Genetic code wikipedia , lookup
Biosynthesis wikipedia , lookup
Gene expression wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Deoxyribozyme wikipedia , lookup
RNA and Protein Synthesis 12-3 RNA and Protein Synthesis 12–3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by copying part of the nucleotide sequence from DNA into RNA. RNA contains coded information for making proteins. The Structure of RNA The Structure of RNA There are four main differences between RNA and DNA: • The sugar in RNA is ribose instead of deoxyribose. • RNA is single-stranded. DNA is double-stranded. • RNA contains uracil in place of thymine. • DNA stays in the nucleus, but RNA can leave the nucleus and go into the cytoplasm. Types of RNA Types of RNA There are three main types of RNA: • Messenger RNA (mRNA) • Ribosomal RNA (rRNA) • Transfer RNA (tRNA) Copyright Pearson Prentice Hall Types of RNA Messenger RNA (mRNA) carries copies of instructions for assembling amino acids into proteins. Ribosome Types of RNA Ribosomal RNA Ribosomes are made up of proteins and ribosomal RNA (rRNA). Amino acid Types of RNA Transfer RNA During protein construction, transfer RNA (tRNA) transfers each amino acid to the ribosome. Transcription Transcription (in nucleus) Protein synthesis begins in the nucleus with a process called transcription. DNA is copied in the form of a single strand of RNA The process begins at a section of DNA called a promoter. Benefits of Transcription • Transcribed copies of the DNA (in the form of RNA) are used instead of the original DNA. • In eukaryotes, DNA is broken down in the cytoplasm, but RNA is not. RNA remains intact. How does Transcription Work? 1. DNA double helix must be separated by breaking the hydrogen bonds between nitrogen bases. 2. Only one DNA strand is “read” by the enzyme RNA polymerase. 3. RNA polymerase constructs an RNA polymer. • An enzyme, RNA Polymerase, unzips DNA molecule. • It chemically tells RNA nucleotides to come and base pair with the open DNA molecule according to the base-pairing rules: • Adenine-Uracil (A-U) Always Up • Guanine-Cytosine (G-C) Going Camping In Nucleus Copyright Pearson Prentice Hall Building an RNA Polymer DNA (codes for) RNA A ------- U T ------- A C ------- G G ------- C Transcription RNA RNA polymerase DNA What happens to RNA once it is created? • In prokaryotes, the RNA is immediately translated. • In eukaryotes, the RNA is processed. – Introns removed – Exons joined together RNA Processing • Introns - segments of useless genes. They are removed. • Exons – are the expressed genes that remain. RNA Editing Some DNA within a gene is not needed to produce a protein. Remember, DNA stays in the nucleus, but the edited mRNA leaves the nucleus and goes into the cytoplasm to the ribosome The Genetic Code The Genetic Code The genetic code is the “language” of mRNA instructions. The code is written using four “letters” (the bases: A, U, C, and G). Adenine, Uracil, Cytosine, Guanine These letters are arranged into “words” consisting of 3 letters codon The Genetic Code A codon consists of three consecutive nucleotides on mRNA that specify a particular amino acid. Protein Synthesis DNA molecule DNA strand (template) 5 3 TRANSCRIPTION mRNA 5 3 Codon TRANSLATION Protein Amino acid The Genetic Code Ribosomes use this decoding system to determine how to build the appropriate protein. “The dictionary” Copyright Pearson Prentice Hall Copyright Pearson Prentice Hall Translation Translation Translation is the decoding of a mRNA message into a polypeptide chain (protein). Translation takes place on ribosomes. During translation, the cell uses information from messenger RNA to produce proteins. Nucleus mRNA How Does the Decoding Work? RNA: AUGCGAGGGAGAUUAUAGGAC Ribosomes read: AUG – CGA – GGG – AGA – UUA – UAG – GAC Each 3 nucleotide “word” is called a codon. Decoding the Genetic Code Let’s try it! Try to decode: AUG CGA GGG AGA UUA UAG GAC Met – Arg – Gly – Arg – Leu - stop tRNA anticodons to mRNA codons ( which codes for specific amino acid) according to base pairing rules: A-U C-G Phenylalanine Methionine Ribosome mRNA Start codon Lysine tRNA As the amino acids are brought close together, they are joined by peptide bonds to make a protein. mRNA Ribosome Copyright Pearson Prentice Hall The process continues until the ribosome reaches a stop codon. Polypeptide Ribosome tRNA mRNA Codon Genes and Proteins Codon Codon DNA Single strand of DNA Codon Codon Codon mRNA mRNA Protein Alanine Arginine Leucine Amino acids within a polypeptide Protein Synthesis DNA molecule DNA strand (template) 5 3 TRANSCRIPTION mRNA 5 3 Codon TRANSLATION Protein Amino acid The role of a master plan in a building is similar to the role of which molecule? • • • • messenger RNA DNA transfer RNA ribosomal RNA A base that is present in RNA but NOT in DNA is • • • • thymine. uracil. cytosine. adenine. The nucleic acid responsible for bringing individual amino acids to the ribosome is • • • • transfer RNA. DNA. messenger RNA. ribosomal RNA. A codon typically carries sufficient information to specify a(an) • • • • single base pair in RNA. single amino acid. entire protein. single base pair in DNA.