* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Unit 6 Notes
DNA profiling wikipedia , lookup
Homologous recombination wikipedia , lookup
Eukaryotic DNA replication wikipedia , lookup
DNA nanotechnology wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Microsatellite wikipedia , lookup
DNA polymerase wikipedia , lookup
DNA replication wikipedia , lookup
DNA Replication and Protein Synthesis Fall 2015 Section 1: Meiosis production/formation of sex cells • Meiosis: __________________________________ (eggs and sperm) – Characteristics similar to __________ Mitosis •Includes the following structures: –___________________ Spindle Fibers –________________ Centrioles –____________________ Sister Chromatids –____________________ Chromosomes –__________________ Centromere –_________________ Kinetochore – ______________________ 8 Steps or phases Storm Tracker (6.1) Instructions: Label the following structures below by using the word bank provided. Word Bank: Centromere, Spindle Fibers, Kinetochore, Chromosomes, Chromatid, Centrioles Chromatid Centriole Centromer e Spindle Fibers Kinetochore Section 1: Meiosis Drawing Phase Prophase 1 Description What’s Happening: nucleus disappears spindle fibers form connecting to centromeres Genetic Information: chromatin changes to chromosomes ***crossing over occurs Section 1: Meiosis • Crossing Over: _____________________________ chromosomal segments exchanging genetic material _________________________________________ Genetic diversity – allows for_________ __________ ! Synapse two homologous chromosomes (one – _________chromatid from each parent) coming together Non-sister chromatids • ______________ – _______________________________________ Exchanging genetic material Crossing Over Synapse Section 1: Meiosis Drawing Phase Metaphase 1 Description What’s Happening: 2 full chromosomes (homologous pair) line up along metaphase plate Lining up @ equator is random—allows for Independent assortment Section 1: Meiosis Drawing Phase Anaphase 1 Description What’s Happening: chromosome pair splits - 1 chromosome (2 chromatids) goes to each pole Section 1: Meiosis Drawing Phase Description Telophase 1 What’s Happening: nucleus reappears spindle fibers disappear Genetic Material: chromosomes turn into chromatin - each cell = 46 chromesomes - each cell = NON-identical Section 1: Meiosis similar to interphase… a SHORT resting • Interkinesis: ______________________________ phase NO REPLICATION OF DNA!!!! – ___________________________________ Section 1: Meiosis Drawing Phase Description Prophase 2 What’s Happening: spindle fibers form reattach to centromere nucleus breaks up Genetic Material: Chromatin change into chromatids into chromosomes -no replication Section 1: Meiosis Drawing Phase Metaphase 2 Description What’s Happening: chromosome lines up on equator Section 1: Meiosis Drawing Phase Anaphase 2 Description What’s Happening: chromosome (and centromere) split and one chromatid goes to each pole Section 1: Meiosis Drawing Phase Telophase 2 Description What’s Happening: nucleus reappears spindle fibers disappear Genetic Material: chromosomes change into chromatin In the end: -each cell = 23 chromesomes = sex cells (male–sperm; female–eggs) - haploid cells - non-identical to parent/each other Section 2: DNA Replication Name Double Helix DNA Ladder Diagram Description Normal form of Deoxyribonucleic acid Untwisted form of DNA Section 2: DNA Replication Name Diagram Description Sugar D= Dexyribo sugar P= Phosphate B= Nitrogen Base Nucleotide Base P Nitrogenous Base A= Adenine T= Thymine G= Guanine C= Cytosine Section 2: DNA Replication Name DNA Ladder Color Code= Red= Dexyribo sugar Yellow/ orange= phosphate Green= Base Diagram Description Keeps bases together, before replication, during replication must break Section 2: DNA Replication Name Nitrogenous Bases Description Diagram A→T A G T C T→A G→C C→G Section 2:DNA Replication • What is DNA Replication? Making second identical copy • When does it happen? Interphase • Where does it happen? Nucleus Section 2: DNA Replication Step 1. Diagram Description Untwisting Section 2: DNA Replication Step 2. Diagram Description Unzipping, breaking hydrogen bonds Section 2: DNA Replication Step 3. Diagram Description Bases match to find complementary base Section 2: DNA Replication Step 4. Diagram Description Rezip/ Retwist to form two identical copies Storm Tracker (6.2) Base Base Deoxyribo sugar (DS) DS P G P C A T G G C C A G T A 4 3 2 1 G A A G C T G A T G C C DNA Replication unzipping Pairing B, A, D, C Interphase Adenine Thymine Cytosine Guanine Section 3: Protein Synthesis Name Single Helix Diagram Description ½ of Double ½ of DNA Ladder Section 3: Protein Synthesis Name Description Diagram Nucleotide Ribo sugar P Base R= Ribo Sugar P= Phosphate B= Base Section 3: Protein Synthesis Name Nitrogenous Bases Description Diagram A G U A= Adenine U= Uracil G= Guanine C= Cytosine C A→U U→A G→C C→G Section 3: Protein Synthesis Name RNA Diagram Description Ribonucleic Acid Single helix Types of RNA: mRNA (messenger) Carries, messages from nucleus to ribosome to make protein Section 3: Protein Synthesis Types of RNA: rRNA (ribosomyl) tRNA (transfer) Diagram Description Chemical make up of a ribosome Transfers amino acids from cytoplasm to ribosome Section 3: Protein Synthesis Types of RNA: Description Diagram Codon Anticodon Set of 3 bases, located on mRNA, codes for protein G Cysteine Located on tRNA Section 3: Protein Synthesis • Protein: Large complex molecules made of oxygen, hydrogen, carbon, and nitrogen • Protein Synthesis: Making of proteins • • • • Transcription: What: Changing DNA to RNA Where: Nucleus When: All the time Section 3: Protein Synthesis Step 1. Diagram Description DNA untwists and unravels Section 3: Protein Synthesis Step 2. Diagram Description RNA strand is started, complementary bases find their match Section 3: Protein Synthesis Step 3. Diagram Description RNA is complete, breaks away from DNA Section 3: Protein Synthesis • Translation – What: RNA to protein – Where: Ribosome – When: As needed Section 3: Protein Synthesis Step 1. Diagram Description RNA moves to ribosome (mRNA) Anticodon finds amino acid Section 3: Protein Synthesis Step 2. Diagram Description Anticodon matches up with codon Section 3: Protein Synthesis Step 3. Diagram Description RNA is translated to protein Section 3: Protein Synthesis • Mutations: Segments of DNA that have not been copied or are miscopied Start Codon= AUG Stop Codon= UGA, UAA, UAG The code of life START= UAC STOP= AUC • Turn each code of DNA into RNA DNA Sequence Code #1 Code #2 A T G C C C C C G A G A T C C T C G T T T T A G UA C GG GG G C U C U A GG AG C A A A AUC A T G A T T C A A C A C A T C C A G C C A C A T T A G UACUAAGUUGUGUAGGUCGGUGUAAUC Code #3 Code #4 A T G G C T C C G A G A G G A G G C A G A G G G T A G UACCGAGGCUCUCCUCCGUCUCCCAUC A T G C C C C C G G A A T G A T G C T A G UACGGGGGCCUUACUACGAUC Code #5 A T G T T A C C G A G A T T C T T G T T T T A G UACAAUGGCUCUAAGAACAAAAUC The Code of life 1st- Find your codons within sets of 3 UACGGGGGCUCUAGGAGCAAAAUC Start biology Stop is the study of life The Code of life 1st- Find your codons within sets of 3 UACUAAGUUGUGUAGGUCGGUGUAAUC Start An Stop old rubber band breaks when pulled The code of life UACCGAGGCUCUCCUCCGUCUCCCAUC Education is the door to the future UACGGGGGCCUUACUACGAUC Biology is all around you UACAAUGGCUCUAAGAACAAAAUC DNA is the code for life Transcribe: TACCGTATT Transcribe: TACGTGACT AUGGCAUAA Start AUGCACUGA Start Histidine Stop Alanine Stop Study for DNA replication Quiz! • How is a DNA Ladder formed? Study for DNA Replication Quiz! • What is the normal form of DNA? Double Helix • What is the untwisted form of DNA? DNA Ladder • What is a nucleotide made up of? Base Sugar P • What are the four types of nitrogenous bases? A= Adenine T= Thymine G= Guanine C= Cytosine Study for DNA replication Quiz! • Where does DNA replication occur? Nucleus • What is the order of DNA Replication? – – – – Untwisting Unzips Finds matching bases Rezips/ retwist Double Helix- In textbook page 294 top of first paragraph Deoxyribose sugar: monosaccharide which contains five carbon atoms, helps construct a nucleotide Adenine: purine base that codes hereditary information in the genetic code, always pairs with thymine, in DNA and RNA Guanine: purine base that codes hereditary information in the genetic code, always pairs with cytosine, in DNA and RNA Thymine: pyrimidine base that codes hereditary information in the genetic code, always pairs with Adenine, is only in DNA Cytosine: pyrimidine base that codes hereditary information in the genetic code, always pairs with Guanine, in DNA and RNA Nitrogenous Base: a nitrogen containing molecule that has the same chemical properties as a base, building blocks of DNA and RNA: adenine, guanine, cytosine, thymine and uracil Phosphate group: structural component of nucleotide, which is the basic structural unit of DNA and RNA