* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download DNA DRY LAB
Zinc finger nuclease wikipedia , lookup
DNA profiling wikipedia , lookup
DNA sequencing wikipedia , lookup
DNA repair protein XRCC4 wikipedia , lookup
Homologous recombination wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
DNA replication wikipedia , lookup
DNA polymerase wikipedia , lookup
Microsatellite wikipedia , lookup
DNA nanotechnology wikipedia , lookup
Name: __________________________ Period: _______ Date: __________ DNA DRY LAB The following is the base sequence on one strand of a DNA molecule: AATGCCAGTGGTTGCACTATGA 1. Give the base sequence of the complementary DNA strand. 2. Give the base sequence of the strand of mRNA read from the original DNA strand. 3. Give the base sequence of the strand of tRNA read from the mRNA strand. 4. Use your amino acid code wheel to list the amino acids in this protein fragment. 5. If the sixth nucleotide in the original DNA strand were changed from C to G, what would the resulting mRNA base sequence be? Mutated Original AATGCGAGTGGTTGCACTATGA Complementary Mutated DNA mRNA tRNA 6 Use your amino acid code wheel and list amino acids in the mutated strand from 4. 7. If a G were added to the original DNA strand after the 3rd nucleotide, what would the resulting mRNA look like? Mutated Original AATGGCCAGTGGTTGCACTTGA Complementary Mutated DNA mRNA tRNA 8. Use your amino acid code wheel and list amino acids in the mutated strand from 6. 9. If the 8th nucleotide in the original DNA strand was removed, what would the resulting mRNA sequence be? Mutated Original AATGCCATGGTTGCACTGA Complementary Mutated DNA mRNA tRNA 10. Use your amino acid code wheel and list amino acids in the mutated strand from 8. 11. Compare the results of the three types of mutation. Which had the biggest effect and why?