Download DNA Structure and DNA Replication What is the function of DNA in

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

page
1
page
2
Document related concepts
no text concepts found
Transcript 
DNA Structure and DNA Replication
1. What is the function of DNA in cells?
2. Describe the components and structure of a DNA nucleotide.
3. List the names and abbreviations of the 4 nitrogen bases.
4. Why is DNA called a double helix?
5. Draw and label what forms of the sides of the DNA ladder?
6. Draw and label what forms the rungs (steps) of the DNA ladder?
7. What is meant by the term base-pairing? How is base-pairing involved in DNA replication?
8. Explain how DNA is replicated. In your explanation state the role of DNA polymerase.
9. A cell containing a single chromosome undergoes two replications. Starting with the original
DNA molecule as one color and the newly synthesized DNA as another color. Sketch the DNA
molecules after one replication followed by a second replication. How does your sketch show
the synthesis of DNA as being semi-conservative?
1st replication:
2nd replication:
10. The base sequence of the template strand of DNA is
CTACGCTAGGCGATTGAACT
What is the new synthesized complementary strand?
Related documents