Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Journal of Cell Science 108, 3419-3425 (1995) Printed in Great Britain © The Company of Biologists Limited 1995 JCS8915 3419 In vivo expression of alternatively spliced forms of integrin-associated protein (CD47) Martina I. Reinhold1, Frederik P. Lindberg1,2,4, David Plas1, Stacy Reynolds1, Marion G. Peters1 and Eric J. Brown1,2,3,* Departments of 1Medicine, 2Molecular Microbiology, 3Cell Biology and Physiology, and 4Division of Infectious Diseases, Washington University School of Medicine, 660 S. Euclid Ave., St Louis, MO 63110, USA *Author for correspondence SUMMARY Integrin-associated protein (IAP) is a 50 kDa plasma membrane protein physically and functionally associated with β3 integrins in a variety of cells. IAP has an extracellular immunoglobulin domain, five transmembrane domains and a short intracytoplasmic tail. IAP is recognized by anti-CD47 antibodies and is expressed on cells, such as erythrocytes and lymphocytes, which do not express β3 integrins. To learn more about potential functions of IAP we examined its expression in vivo. Using the polymerase chain reaction, we detected 4 alternatively spliced forms of IAP which differ from each other only at their intracytoplasmic carboxy termini. These alternatively spliced forms are generated by inclusion or exclusion of three short exons within 5 kb in the genome and are highly conserved between mouse and man. There is tissue speci- ficity of expression of the alternatively spliced forms of IAP mRNA, with bone marrow-derived cells expressing predominantly one form and neural tissue another. Using polyclonal antibodies which recognize the alternatively spliced bone marrow (form 2) and neural (form 4) forms of IAP, we found that in accord with the mRNA, form 2 protein was expressed in all tissues primarily on bone marrow-derived cells and endothelia, while form 4 was highly expressed in the brain and peripheral nervous system. The evolutionary conservation of IAP isoforms and their tissue-specific expression suggest an important role for these intracytoplasmic domains in IAP function. INTRODUCTION for ovarian carcinoma cells (Campbell et al., 1992; Lindberg et al., 1994). IAP is expressed at higher levels than β3 on many cells. For example, IAP is present on lymphocytes, which express little αvβ3, and on erythrocytes, which express no known integrins (Brown et al., 1990). Thus, it is possible that the functions of IAP extend beyond integrin signal transduction. Alternatively spliced forms of IAP mRNA have been found in a human cell line (Campbell et al., 1992), but whether alternative splicing occurs in vivo and if the alternatively spliced mRNAs are translated into different protein products are unknown. To determine the tissue distribution of IAP and its alternatively spliced isoforms, we have cloned the alternatively spliced forms of murine and human IAP and we have made antibodies which specifically recognize two of the four alternatively spliced IAP protein products. Using RT-PCR and these antibodies, we have evaluated the expression of IAP in murine tissues. IAP is expressed in essentially all tissues, but the four alternatively spliced forms of IAP mRNA have distinct tissue distribution. This differential expression of alternatively spliced IAP mRNAs is paralleled by the tissue distribution of the distinct protein isoforms. While the functions of IAP apart from its role in integrin β3 signal transduction remain unknown, these data suggest that there may be tissue-specific functions of different IAP isoforms. Integrin-associated protein (IAP) was first identified as a membrane protein involved in signal transduction from β3 integrins on polymorphonuclear leukocytes (PMN) (Brown et al., 1990). Antibodies to IAP blocked activation of PMN phagocytosis, respiratory burst, and chemotaxis induced by Arg-Gly-Asp-containing proteins and synthetic peptides. Subsequently, antibodies to IAP have been shown to inhibit ligand binding to αvβ3 on several cell lines and to block the increase in [Ca2+]i which occurs upon endothelial cell adhesion to fibronectin- or vitronectin-coated surfaces, without disturbing cell adhesion to these surfaces (Schwartz et al., 1993). These data suggest that IAP is an important component of the mechanism by which ligation of β3 integrins transmits information to the cell. We have speculated that IAP plays a role in β3 integrin function analagous to the nonligand binding chains of cytokine receptors, affecting both ligand affinity and signal transduction (Lindberg et al., 1993). Molecular cloning of IAP cDNA revealed that it is a multiply membrane-spanning protein with an amino-terminal extracellular sequence consisting of a single IgV-like domain. CD47 antibodies recognize human IAP, which also is identical to the OV-3 antigen, initially thought to be specific Key words: integrin, alternative splicing, immunoglobulin superfamily, protein expression 3420 M. I. Reinhold and others MATERIALS AND METHODS of adult mice. PCR products were sequenced directly or cloned, sequencing several clones derived from each PCR product. Cloning of murine and human IAP cDNAs Standard techniques were used for cloning and other nucleic acid manipulations. Two potential alternatively spliced forms of human IAP cDNAs were obtained from screening cDNA libraries from U937 cells and differentiated HL60 cells (Lindberg et al., 1993). To identify additional cytoplasmic variants of human IAP, PCR primers were synthesized which span the putative splice site. The sense oligonucleotide (5′GTTGGACTGAGTCTCTGTATTGCGGCGTGT3′) is located 5′ of the splice site, and the antisense oligonucleotide (5′CCCAAGCTTACACTTTCACGTCTTACTACTG3′) is located within the 3′ untranslated region (3′UT). These primers were used to screen clones from the HL60 library. Among 27 clones, 25 (92%) gave fragments of a size consistent with form 2 and 2 (8%) with form 4. No clones corresponding to form 3 were detected. PCR reactions were done in a final volume of 20 µl containing 50 mM Tris-HCl, pH 9.0, 50 mM KCl, 0.1% Triton X-100, 0.2 mM each of dATP, dCTP, dGTP and dTTP, 0.75 µM oligonucleotide primer and 1 U of Taq DNA polymerase (Promega); 1 µl of cDNA was subjected to 30 amplification cycles under these conditions. Each cycle consisted of 30 seconds at 90°C, 30 seconds at 53°C and 30 seconds at 72°C. PCR products were run on a 1.5% agarose gel and stained with 1 µg/ml ethidium bromide. The human form 3 specific expression construct was generated by PCR using site directed deletion with human form 4 as template. The carboxy-terminal sequence was shown to be identical to the form 3 sequence previously published (Campbell et al., 1992). Human form 1 corresponds to one of the initially cloned splice variants of IAP (Lindberg et al., 1993). Cytoplasmic variants of murine IAP clones from a murine 70Z/3 B cell line were similarly screened by PCR using the following primers: sense (5′ of splice site) 5′TCCTTGCTTTGGTCGGGCTGTGT3′; antisense (3′ UT region) 5′CTGACTTCCAAGTTACAGTCCGTCAC3′; 1 µl of cDNA was subjected to 30 amplification cycles under above described conditions. Each cycle consisted of 30 seconds at 90°C, 30 seconds at 65°C and 30 seconds at 72°C. Of 14 clones, 2 (14%) were of form 1, 8 (57%) were of form 2, and 4 (29%) were of form 3. Form 4 was cloned from brain tissue A Intron definition Genomic mouse liver DNA was prepared from a SV129 mouse: 1 µl of genomic DNA was subjected to 30 amplification cycles under conditions described above. Each cycle consisted of 30 seconds at 90°C, 30 seconds at 60°C and 4 minutes at 72°C. Introns were detected using the following primer pairs. Intron between form 1 and form 2: 5′GCTCTAGCAGAACTACTTGGA3′; 5′CTAGGAGGTTGGATAGT3′; Intron between form 2 and form 3: 5′CAACCAGAGGACTATCCAACCTC3′; 5′TCGTTAAGGGGTTCCTCTACAGC 3′; Intron between form 3 and form 4: 5′GCTGTAGAGGAACCCCTTAACG3′; 5′CGTCATTCATCATTCCTTTTGAC 3′; Intron between form 4 and the 3′UT: 5′GTCAAAAGGAATGATGAATGACG 3′; CTGACTTCCAAGTTACAGTCCGTCAC 3′. PCR products were run on a 1.5% agarose gel and stained with 1 µg/µl ethidium bromide. Detection of mRNA mRNA was prepared from adult mouse tissue and indicated cell lines using a kit (Micro-Fast Track, Invitrogen). For PCR detection of mRNA, cDNA was synthesized from poly(A) RNA using a kit (cDNA Cycle Kit, Invitrogen) according to the instructions of the manufacturer. PCR reactions were done in a final volume of 20 µl containing 50 mM Tris-HCl, pH 9.0, 50 mM KCl, 0.1% Triton X-100, 0.2 mM each of dATP, dCTP, dGTP and dTTP, 0.375 µM IAP oligonucleotide primer (of which 12.5 nM labeled with [γ-32P]ATP), 0.2 µM Gαs (GTP binding protein) oligonucleotide primer (of which 12.5 nM labeled with [γ-32P] ATP), and 2.5 U of Taq DNA polymerase (Promega). Reverse transcription reactions (2 µl) were subjected to 20 amplification cycles under these conditions. Control experiments showed that the dose-response of the PCR assay is linear over a range of 1 to 0.02 µl of cDNA used (Fig. 1). Each cycle consisted of 30 seconds at 90°C, 30 seconds at 60°C, and 1 minute at 72°C. Alternative splice forms of IAP were detected using the following primers: B Fig. 1. Quantitative PCR assay for alternatively spliced IAP mRNAs. (A) PCR assays for IAP and for the αs subunit of the heterotrimeric G protein Gs were performed on reverse transcribed cDNA from J774 cells, using different quantities of starting mRNA (lanes a-f: 1µl, 0.5 µl, 0.2 µl, 0.1 µl, 0.05 µl, 0.02 µl, respectively). The PCR assay, using 32P-labelled oligonucleotide primers, was performed as described in Materials and Methods. The amplified DNA was quantitated using a Phosphorimager. (B) Under the conditions of the assay, both Gsα and IAP PCR products increase as a function of input mRNA, and the ratio between the two PCR products is unaffected by the quantity of starting mRNA. In vivo expression of IAP 3421 5′ of splice site, 5′CATCGTGGTTGTTGGAGCCATC3′; 3′UT region, 5′ACAGTCCGTCACTTCCCTTCAC3′. This primer pair was chosen since it eliminated non-specific priming when used with the Gαs specific primers in the same reaction. The ubiquitous Gαs message served as an internal control for the efficiency of cDNA synthesis and PCR amplification and was detected using the following primers: sense, 5′ATTGAAACCATTGTGGCCGCCATGAGC3′; antisense, 5′GAAGACACGGCGGATGTTCTCAGTGTC 3′ (Russell et al., 1991). No product was seen when genomic DNA without reverse transcription was used. PCR products were run on 4% polyacrylamide gels and then exposed to X ray film. Preparation of anti-cytoplasmic tail antibodies To distinguish between different cytoplasmic tail splice variants, we raised polyclonal rabbit antisera against peptides mimicking the unique portions of the four cytoplasmic tails. An acetyl-cysteine (Acc) residue was added at the amino terminus of the peptides for coupling to carrier proteins. Rabbit antisera were generated as previously described (Lindberg et al., 1993). Antisera against peptides derived from the form 1 and form 3 peptides (Ac-C-QLLGLVYMKFVE and Ac-C-KAVEEPLNE, respectively) failed to recognize IAP from cells transfected with constructs encoding the different forms of IAP. The sera were not further characterized. Serum against the form 4 peptide (Ac-C-AFKESKGMMNDE) showed good reactivity against human recombinant form 4 IAP. The antiserum agaist the murine form 2 peptide (Ac-C-ASNQRTIQPPRNR) showed weaker reactivity with both murine and human form 2 recombinant IAPs than the previously described (Lindberg et al., 1993) serum raised against the human equivalent peptide (Ac-C-ASNQKTIQPPRNN). Thus, the sera raised against the form 4 and the human form 2 sequences were used for further experiments. In western blots of cells transfected with IAP cDNAs, both the form 2 and form 4 peptide antisera recognized a single band comigrating with IAP (data not shown). Using 125I-labelled baculovirus produced recombinant human IAP of forms 1, 2, and 4, the antisera specifically immunoprecipitated the appropriate form of IAP (Fig. 2) from solutions in PBS/1% Triton X-100. The antisera precipitated less IAP than the control mAb 2D3. Presumably, this was due to losses during 200000 Activity Precipitated (cpm) Antigen 150000 100000 50000 0 AA IAP-1 IAP-2 IAP-4 A AA A AA A AA A AA AA AA A AA AA AA A Preimmune anti-2 anti-4 anti-IgV Antiserum Fig. 2. Specificity of anti-peptide antibodies. Antibodies against the IAP form 2 cytoplasmic peptide and the IAP form 4 extension, prepared as described in Materials and Methods, were used to immunoprecipitate IAP form 1, form 2, and form 4 proteins made in Sf9 cells from recombinant baculovirus. The IAP form 2 antibody immunoprecipitates form 2 IAP but not form 1 or 4; the IAP form 4 antibody immunoprecipitates only form 4. washing of IAP bound to peptide antibodies of relatively low affinity. The results show that the antisera were form-specific for immunoprecipitation, even though 11 of the 13 amino acids of the form 2 peptide used are contained within both the form 3 and 4 cytoplasmic tails (see Fig. 3). Immunohistochemistry of murine tissue Immunohistochemical analyses were performed using the ABC method for staining of cryostat sections. Briefly, cryostat sections of frozen tissues were fixed in ethanol at 4°C. Sections were preincubated for 30 minutes in PBS (pH 7.2) containing 1% hydrogen peroxide, then for 15 minutes in PBS containing 0.2% nonfat powdered milk, 2% BSA and 0.3% Triton X-100. Sections were incubated with antibodies overnight at 4°C, washed in PBS and then incubated with 1:100 dilution of biotinylated goat anti-rabbit IgG (Vector, Burlingame, CA) for 30 minutes. After washing in PBS, the slides were incubated with streptavidin-peroxidase (Zymed, South San Francisco, CA) for 10 minutes. After washing in PBS again, the peroxidase activity was visualized with naphthol (Sigma, St Louis) or aminoethyl carbazole substrate (AEC kit, Zymed). Binding of the form-specific peptide antibodies was blocked completely by coincubation of the tissue sections with 50 µg/ml of peptide (not shown). RESULTS Alternatively spliced forms of human and murine IAP mRNA We found 4 distinct cDNAs for IAP from both human and murine cDNA libraries (Fig. 3A). The four cDNAs for human IAP are identical to those reported for the OV-3 antigen (Campbell et al., 1992). The cDNAs differ from each other by increasingly long extensions at the 3′ end of the coding region. Since the carboxy terminus of the protein is intracytoplasmic (Lindberg et al., 1993), each of these cDNAs would code for protein with a different length intracytoplasmic tail, which we have for convenience termed forms 1-4 based on increasing length (Fig. 3C). Each longer cytoplasmic tail came from the addition of a short peptide sequence to the extreme carboxy terminus of the protein. We found that each of these additional peptide sequences was encoded by a short exon. The three exons encoding the additional extensions of forms 2-4 were 32 bp, 25 bp, and 36 bp, respectively (Fig. 3A). Each of these exons and the one encoding the form 1 cytoplasmic tail ended in a G in both the mouse and human IAP gene. The common exon encoding the 3′ UT, which is identical for each form, began AATAAC in the human gene and AATAGG in the mouse. For forms 1, 3, and 4, the splice with the 3′ G of the preceding exon led to a glutamate as the carboxy-terminal amino acid of the predicted protein, followed by a stop (TAA or TAG) codon. For form 2, the frame was shifted and the final amino acids, NN in the human and NR in the mouse, were encoded in the same exon as the 3′UT sequences prior to a new stop codon. Because the cDNAs all contained identical 3′UT, we hypothesized that the different coding regions represented alternative splicing of the IAP gene. This was proven because these small exons encoding the cytoplasmic tail peptide sequences were linked to each other and to the 3′UT exon by PCR on genomic DNA (Fig. 3B). The intron between the exon encoding the final transmembrane domain and the 32 bp exon encoding the form 2 cytoplasmic tail is larger than 2.5 kb, so the exact distance was not mapped by PCR. The distance between the form 2 3422 M. I. Reinhold and others Fig. 3. Alternatively spliced forms of IAP. (A) The sequences of the human and murine exons encoding IAP form 1; the form 2, form 3 and form 4 cytoplasmic tail extensions; and the exon common to all four forms which contains the stop codons and the 3′UT region are shown. (B) PCR was used as described in Materials and Methods to determine intron size between the exons shown in A. Lane a, intron between form 1 and 2; lane b, intron between form 2 and 3; lane c, intron between form 3 and 4; lane d, intron between form 4 and 3′ UT. The intron between the common exon encoding form 1 and the exon encoding the form 2 peptide was not amplified by PCR and thus is likely >2.5 kb. (C) A scheme illustrating the alternative splice possibilities for generation of the known forms of IAP. A common splice donor from the 3′UT exon can join any of four potential splice acceptor sites. exon and the next, encoding the form 3 extension is 1.5 kb; between this exon and that encoding the form 4 extension, 0.5 kb; and between this last coding exon and the 3′UT region 2.5 kb. Thus, the different mRNAs arise from alternative splicing of mRNA transcribed from a single IAP gene, leading to 4 distinct cytoplasmic tails arising from the sequential addition of peptide extensions each encoded by short exons (Fig. 3C). If the lysine in form 1 is assumed to be the stop transfer sequence beginning the carboxy-terminal cytoplasmic tail, IAP form 1 has a 4 amino acid intracytoplasmic extension, encoded on the same exon as the final transmembrane domain; form 2 a 16 amino acid extension; form 3 a 23 amino acid extension; and form 4 a 34 amino acid extension. The 4 intracytoplasmic extensions are highly conserved between mouse and human. A conservative K to R change in the form 2 exon peptide between mouse and human is the only difference besides the N to R change at the very carboxy terminus of form 2 which is encoded in the 3′UT exon and not reflected in the other forms. This is more highly conserved than the extracellular IgV-like domain of IAP (Lindberg et al., 1993). No consensus motifs for kinase substrates or for protein-protein interactions were found in any of the forms. No sequence variations were found in other regions of IAP for either human or murine cDNAs. Expression of IAP mRNA To determine the tissue expression of IAP and its alternatively spliced forms, we performed RT-PCR on murine tissue using oligonucleotides which were present in all 4 forms of IAP and which bracketed the region of the mRNA encoding the alternatively spliced cytoplasmic tails. Using this PCR strategy, the 4 forms could be distinguished on the basis of the size of the PCR product (Fig. 4). PCR conditions were established which allowed approximate quantitation of the mRNA for the different IAP isoforms. All tissues tested expressed IAP mRNA. However, the different forms were expressed at varying levels in different tissues (Fig. 4). For example, thymus and spleen expressed predominantly form 2 mRNA, while brain expressed form 4 to a much greater degree than any other form. Primary murine cells, including myoblasts, macrophages, embryonic stem cells, and microvascular endothelial cells cultured in vitro expressed predominantly form 2 mRNA (Table 1). When the endothelial cells were transformed with In vivo expression of IAP 3423 Fig. 4. Tissue distribution of alternatively spliced forms of IAP mRNA. mRNA was isolated from various murine tissues and used for the quantitative RT-PCR assay, as described in Materials and Methods, with Gsα as a control in each assay. The sizes of the four alternatively spliced forms, as determined by identical PCR reactions on plasmids encoding each of the four forms, is indicated. middle T antigen (Dubois et al., 1991), IAP mRNA increased in abundance and forms 1, 3, and 4 were found in addition to form 2. Several human primary cell types were examined for expression of mRNA isoforms. Like murine thymus and spleen, human monocytes, monocyte-derived macrophages, and lymphocytes expressed predominantly form 2 mRNA (Table 1). Activation of lymphocytes in an autologous mixed lymphocyte reaction did not alter isoform expression (not shown). However, in vitro culture of human monocytes for 7 days to allow maturation into macrophages (Bohnsack et al., 1985) did alter IAP mRNA expression. Not only did mRNA abundance increase, but all four forms could be found. However, form 2 remained the predominant mRNA made in these cells. Human keratinocytes expressed mRNA for IAP forms 1 and 2. Keratinocytes were the only cell in which significant amounts of form 1 were found. Only form 2 mRNA was detected in human umbilicial vein endothelial cells. We also examined several continuous cell lines. The myelomonocytic leukemia cell line HL60 expressed form 2 mRNA, as did the transitional cell carcinoma T24 and two hepatoma cell lines. Interestingly, a nasal epithelial carcinoma cell line (2650) expressed predominantly IAP form 4 mRNA (Table 1). Immunolocalization of IAP protein To determine whether the differential expression of IAP mRNA was found as well in protein, we stained brain and spleen with IAP form-specific antibodies. Spleen, in which form 2 mRNA was the most abundant, stained strongly with the form 2-specific antibody, but did not react with the form 4 antibody (Fig. 5). In contrast, while the anti-form 4 peptide antibody stained brain cortex strongly, the form 2 antibody showed minimal staining, consistent with the PCR data on mRNA expression. The form 2 antibody stained endothelium in a variety of tissues as well as bone marrow derived cells; the form 4 antibody showed extensive staining in spinal cord and peripheral nerves as well as throughout the brain (not shown). Thus, the staining patterns demonstrate that the tissuespecific expression of alternatively spliced mRNA is reflected in IAP protein. Table 1. Expression of alternatively spliced forms of IAP mRNA IAP form Cells/tissue Form 1 Form 2 Form 3 Form 4 Human 1o keratinocytes HUVEC Monocytes Macrophages HepG2 Hep3B HL60 HL60 + retinoic acid T24 bladder carcinoma 2650 nasal carcinoma ++ + + - ++ ++ + ++ (+) + + + ++ + + + - + + ++ Murine Myoblasts Macrophages ES cells 1o endothelial cells Transformed endothelial cells Bladder Salivary gland Testis Brain Ovary Intestine Liver Thymus Spleen + ++ - ++ + + ++ +++ +++ + +++ +++ + ++++ ++++ +++ + + ++ + ++ + + ++++ ++ + + + ++ +++ +++ - mRNA level was determined by semi-quantitative PCR, as described in Materials and Methods. The +-++++ scale covers a range of about 10-fold difference in mRNA expression, as determined by quantitation of radioactive bands by Phosphorimager analysis or by densitometry of autoradiograms. (+) means mRNA detectable only after reamplification of original PCR product. DISCUSSION IAP is a plasma membrane molecule involved in β3 integrindependent signal transduction and ligand binding. However, its precise function, especially on cells such as erythrocytes, lymphocytes and neurons, which do not express β3 integrins, remains unknown. Although the existence of alternatively 3424 M. I. Reinhold and others Fig. 5. Staining of cortex and spleen with form-specific antibodies. Sections of mouse brain cortex and spleen were stained with anti-form 2 (A and D); anti-form 4 (B and E); and preimmune rabbit serum (C and F). Many of the cells in the cortex are stained with the anti-form 4 antibody, but there is very little staining with the form 2 antibody. In contrast, spleen stains strongly with the form 2-specific antibody, but very poorly with the anti-form 4 antibody. ×200. spliced mRNAs for IAP has been reported, they had been found only in a single carcinoma cell line (Campbell et al., 1992) in which any role for IAP was unknown. It was unclear whether untransformed cells made these various isoforms of IAP mRNA, whether there were proteins made from these variant mRNAs, or how their expression might be regulated. Previously it has been shown that the tissue distribution of IAP is wide, both by examining RNA from a variety of tissues (Campbell et al., 1992) and by staining cells with anti-IAP mAb (Brown et al., 1990). Recently, a systematic examination of IAP expression in human tissue revealed staining in multiple tissues including brain (Mawby et al., 1994). The current work reports a systematic examination of the expression of IAP and its isoforms in tissue. We have shown that all 4 forms of IAP mRNA are found in both murine and human cells, with a very high interspecies conservation with respect to both peptide sequence of the alternatively spliced regions and gene structure. All 4 forms are made by untransformed cells. As shown both by RT-PCR and immunohistochemistry, there is cell-type specificity of expression of the different IAP isoforms. Form 2 and form 4 are the most abundant IAP splice variants made in vivo. Form 2 is made by all bone marrow-derived cells, by endothelial cells, and by fibroblasts. Immunoprecipitation of a variety of bone-marrow derived cells including erythrocytes, platelets, and lymphocytes with form-specific antibodies followed by extracellular domain antibodies showed that essentially all the expressed IAP is form 2 (data not shown). Much of the form 2 message found in many tissues arises from endothelium, interstitial fibroblasts, or resident lymphocytes and macrophages. Form 4 is expressed predominantly by neural tissue. Peripheral nerves, spinal cord, and brain cells including retina all expressed form 4 IAP, the form with the longest cytoplasmic tail. Form 1, which encodes an IAP without a significant cytoplasmic tail, is the least abundant message in vivo. Unfortunately, since there are no unique sequences within form 1, we were unable to make an antibody specific for this form. Thus, we are unsure whether the corresponding protein can be found in vivo. In general, form 3 mRNA is made by many of the tissues which make form 2, but is much less abundant. Exceptions to this rule include the liver and the salivary gland. Because we have not successfully made a form 3-specific antibody, we are unsure of the cells expressing form 3 in each of these tissues. However, studies with purified lymphocytes and macrophages suggest that they can make form 3 IAP mRNA and that these may well be among the cells which are responsible for the synthesis of form 3 in tissue. The preservation of sequence within the four cytoplasmic tails between mouse and man and the tissue-restricted distribution of the various isoforms suggests that these cytoplasmic tails play an essential role in IAP function. It is interesting to speculate that each of the different extensions of the IAP cytoplasmic tail represents a modular unit designed to interact with unidentified cytoplasmic or membrane proteins. Thus, IAP might have different functions in different tissues, depending on the nature of its cytoplasmic tail. It is possible to imagine that the different tails could interact differently with cytoskeletal elements, integrins, or signal transduction cascades to mediate different cell-specific functions. As yet, we have no data as to the function of the IAP cytoplasmic tails. Interaction of IAP with β3 receptors appears to require only the extracellular Ig domain of IAP (F.P.L. and E.J.B., unpublished). Thus, it is more likely that the increase in [Ca2+]i which is dependent on IAP (Schwartz et al., 1993), cell motility dependent on IAP (Senior et al., 1992; Cooper et al., 1995) or other, as yet unknown functions of IAP require its cytoplasmic domains. In vivo expression of IAP 3425 REFERENCES Bohnsack, J. F., O’Shea, J. J., Takahashi, T. and Brown, E. J. (1985). Fibronectin-enhanced phagocytosis of an alternative pathway activator by human culture-derived macrophages is mediated by the C4b/C3b complement receptor (CR1). J. Immunol. 135, 2680-2686. Brown, E. J., Hooper, L., Ho, T. and Gresham, H. D. (1990). Integrinassociated protein: a 50-kD plasma membrane antigen physically and functionally associated with integrins. J. Cell Biol. 111, 2785-2794. Campbell, I. G., Freemont, P. S., Foulkes, W. and Trowsdale, J. (1992). An ovarian tumor marker with homology to vaccinia virus contains an IgV-like region and multiple transmembrane domains. Cancer Res. 52, 5416-5420. Cooper, D., Lindberg, F. P., Gamble, J. R., Brown, E. J. and Vadas, M. A. (1995). The transendothelial migration of neutrophils involves integrin associated protein (CD47). Proc. Nat. Acad. Sci. USA (in press). Dubois, N. A., Kolpack, L. C., Wang, R., Azizkhan, R. G. and Bautch, V. L. (1991). Isolation and characterization of an established endothelial cell line from transgenic mouse hemangiomas. Exp. Cell Res. 196, 302-313. Lindberg, F. P., Gresham, H. D., Schwarz, E. and Brown, E. J. (1993). Molecular cloning of integrin-associated protein: an immunoglobulin family member with multiple membrane spanning domains implicated in alpha-v, beta-3-dependent ligand binding. J. Cell Biol. 123, 485-496. Lindberg, F. P., Lublin, D. M., Telen, M. J., Veile, R. A., Miller, Y. E., Donis-Keller, H. and Brown, E. J. (1994). Rh-related antigen CD47 is the signal-transducer integrin associated protein. J. Biol. Chem. 269, 1567-1570. Mawby, W. J., Holmes, C. H., Anstee, D. J., Spring, F. A., Tanner, M. J. A. (1994). Isolation and characterization of CD47 glycoprotein: a multispanning membrane protein which is the same as integrin-associated protein (IAP) and the ovarian tumor marker OA3. Biochem. J. 304, 525-530. Russell, D. M., Dembic, Z., Morahan, G., Miller, J. F., Burki, K. and Nemazee, D. (1991). Peripheral deletion of self-reactive B cells. Nature 354, 308-311. Schwartz, M. A., Brown, E. J. and Fazeli, B. (1993). A 50 kDa integrinassociated protein is required for integrin-regulated calcium entry in endothelial cells. J. Biol. Chem. 268, 19931-19934. Senior, R. M., Gresham, H. D., Griffin, G. L., Brown, E. J. and Chung, A. E. (1992). Entactin stimulates neutrophil adhesion and chemotaxis through interactions between its Arg-Gly-Asp (RGD) domain and the leukocyte response integrin (LRI). J. Clin. Invest. 90, 2251-2257. (Received 14 March 1995 - Accepted 7 August 1995)