* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download DNA! - Chapter 10
Homologous recombination wikipedia , lookup
DNA repair protein XRCC4 wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
DNA nanotechnology wikipedia , lookup
Microsatellite wikipedia , lookup
DNA replication wikipedia , lookup
DNA polymerase wikipedia , lookup
DNA! - Chapter 10 Let’s review where we find our genetic coding …… What holds our genetic coding? • Chromosomes ✓ Strands of DNA that contain all of the genes an organism needs to survive and reproduce • Genes ✓ Segments of DNA that specify how to build a protein • There can be multiple genes for a trait/protein ✓ Chromosome maps are used to show the locus (location) of genes on a chromosome The E. Coli genome includes approximately 4,000 genes Genetic Variation ✓ Phenotypic variation among organisms is due to genotypic variation (differences in the sequence of their DNA bases) ✓ Differences exist between species and within a species • Different genes (genomes) → different proteins • Different versions of the same gene (alleles) • Differences in gene expression (epigenetics) DO NOW: What are the 3 components that make up a nucleotide structure? Structure of DNA DNA stands for: Deoxyribonucleic acid DNA is located in the nucleus of eukaryotic cells and cytoplasm in prokaryotic cells DNA and RNA are polymers composed of nucleotides ▪ Polymers = DNA and RNA ▪ Monomer = nucleotide Each nucleotide contains a: – Nitrogenous base – 5-carbon sugar – Phosphate group Nitrogenous base (A, G, C, or T) Phosphate group Thymine (T) Sugar (deoxyribose) The 4 Nitrogenous bases of DNA: Thymine (T) Cytosine (C) Pyrimidines Adenine (A) Guanine (G) Purines What is the difference between pyrimidines and purines? Nitrogenous bases bond together to make a BASE PAIR Adenine → Thymine How are they bonded Cytosine → Guanine together? How many bonds does each pair have? A sugar-phosphate backbone is formed by covalent bonding between the phosphate of one nucleotide and the sugar of the next nucleotide Nitrogenous bases extend from the sugar-phosphate backbone What does Antiparallel mean? ● Two DNA strands run parallel but in the opposite alignment ● Allows nucleotides to make the needed hydrogen bonds 5’ - 3’ ● These numbers identify the carbons on the sugar backbone ● Start to the right of the “o” ● Asymmetry gives a DNA strand “direction” Count the carbons Sugar-phosphate backbone Phosphate group Nitrogenous base Sugar DNA nucleotide Phosphate group Nitrogenous base (A, G, C, or T) Thymine (T) Sugar (deoxyribose) DNA nucleotide DNA polynucleotide Notice the → ● Different bonds ● Different bases ● 5’ - 3’ & 3’-5’ Sugar → Deoxyribose or Ribose What is RNA? ● ● ● ● Ribonucleic Acid, present in all living cells Single Stranded Helps with the creation of proteins! Has 3 of the same nitrogenous bases DNA has except uracil takes the place of thymine DNA Replication DNA Replication • Cell Division (mitosis) ✓ Cells must copy their chromosomes (S phase) before they divide so that each daughter cell will have a copy Questions before we start… 1. How does that DNA actually replicated? 2. What form is the DNA in during this? AT GC CG TA GC DNA Synthesis ✓ The DNA bases on each strand act as a template to synthesize a complementary strand ✓ The process is semiconservative because each new double-stranded DNA contains one old strand (template) and one newly-synthesized complementary strand AT GC CG ATTA GGCC CG TA GC A G C T G AT GC CG TA GC T C G A C Enzymes involved: • Topoisomerase ✓ Unwinds (uncoils) the DNA • Helicase ✓ An enzyme that separates strands of nucleic acids “Replication Fork” • Single Stranded Binding Proteins ✓ Prevent DNA that has been opened at the replication fork during DNA replication from immediately reestablishing double helix conformation • RNA Primase ✓ an enzyme that creates a short RNA sequence, called a primer, tells the DNA polymerase where to start replication • DNA Polymerase (I and III) ✓ Enzyme that catalyzes the covalent bond between the phosphate of one nucleotide and the deoxyribose (sugar) of the next nucleotide Polymerase I: replaces segments of primer with DNA nucleotides Polymerase III: binds at the end of the primer and adds new DNA nucleotides • Ligase ✓ Joins DNA strands back together (acts as a glue) 3’ end has a free deoxyribose 5’ end has a free phosphate DNA polymerase: ✓ can only build the new strand in the 5’ to 3’ direction ✓ Thus scans the template strand in 3’ to 5’ direction DNA Replication Steps… 1. Initiation 2. Elongation 3. Termination Initiation • Primase (a type of RNA polymerase) builds an RNA primer (5-10 ribonucleotides long) • DNA polymerase attaches onto the 3’ end of the RNA primer DNA polymerase Elongation • DNA polymerase uses each strand as a template in the 3’ to 5’ direction to build a complementary strand in the 5’ to 3’ direction • results in a leading strand and a lagging strand DNA polymerase Lagging Strand Creates Okazaki Fragments • Newly synthesized DNA fragments that are formed on the lagging template strand during DNA replication Last step... Termination Primers are removed and replaced with new DNA nucleotides and the backbone is sealed by DNA ligase 2 new daughter strands of DNA! Eukaryotic vs. Prokaryotic DNA replication Review of Enzymes involved and DNA replication: – DNA polymerase adds nucleotides to a growing chain – DNA ligase joins small fragments into a continuous chain – Helicase unwinds the DNA strand – RNA Primase tells DNA polymerase where to start; “primer” – Single Stranded Binding Proteins prevent DNA from coiling back into a double helix during synthesis Review... Leading Strand 1. Topisomerase unwinds DNA and then Helicase breaks H-bonds 2. Primase creates a single RNA primer to start the replication 3. Polymerase slides along the leading strand in the 3’ to 5’ direction synthesizing the matching strand in the 5’ to 3’ direction 4. The RNA primer is degraded by RNase H and replaced with DNA nucleotides by DNA polymerase, and then DNA ligase connects the fragment at the start of the new strand to the end of the new strand (in circular chromosomes) Review... Lagging Strand 1. Topisomerase unwinds DNA and then Helicase breaks H-bonds 2. Primase creates RNA primers in spaced intervals 3. Polymerase slides along the leading strand in the 3’ to 5’ direction synthesizing the matching Okazaki fragments in the 5’ to 3’ direction 4. The RNA primers are degraded by RNase H and replaced with DNA nucleotides by DNA polymerase 5. DNA ligase connects the Okazaki fragments to one another (covalently bonds the phosphate in one nucleotide to the deoxyribose of the adjacent nucleotide) Protein Synthesis Protein Synthesis • DNA provides the instructions for how to build proteins • Each gene dictates how to build a single protein in prokaryotes • The sequence of nucleotides (AGCT) in DNA dictate the order of amino acids that make up a protein Nucleotide sequence of His gene Protein Synthesis • Protein synthesis occurs in two primary steps 1 mRNA (messenger RNA) copy of a gene is synthesized ✓Cytoplasm of prokaryotes ✓Nucleus of eukaryotes 2 mRNA is used by ribosome to build protein (Ribosomes attach to the mRNA and use its sequence of nucleotides to determine the order of amino acids in the protein) ✓Cytoplasm of prokaryotes and eukaryotes ✓Some proteins feed directly into rough ER in eukaryotes Protein Synthesis • Transcription Initiation 1) INITIATION ✓ RNA polymerase binds to a region on DNA known as the promoter, which signals the start of a gene ✓ Promoters are specific to genes ✓ RNA polymerase does not need a primer ✓ Transcription factors assemble at the promoter forming a transcription initiation complex – activator proteins help stabilize the complex ✓ Gene expression can be regulated (turned on/off or up/down) by controlling the amount of each transcription factor (eukaryotes) Protein Synthesis 1) INITIATION • Transcription Elongation ✓ RNA polymerase unwinds the DNA and breaks the H-bonds between the bases of the two strands, separating them from one another ✓ Base pairing occurs between incoming RNA nucleotides and the DNA nucleotides of the gene (template) • recall RNA uses uracil instead of thymine AGTCAT UCAGUA Protein Synthesis • Transcription Elongation ✓ RNA polymerase unwinds the DNA and breaks the H-bonds between the bases of the two strands, separating them from one another. ✓ Base pairing occurs between incoming RNA nucleotides and the DNA nucleotides of the gene (template) • recall RNA uses uracil instead of thymine 5’ 3’ + ATP 5’ ✓ RNA polymerase catalyzes bond to form between ribose of 3’ nucleotide of mRNA and phosphate of incoming RNA nucleotide 3’ + ADP Protein Synthesis • Transcription Elongation The gene occurs on only one of the DNA strands; each strand possesses a separate set of genes Protein Synthesis 1) INITIATION • Transcription Termination ✓ A region on DNA known as the terminator signals the stop of a gene ✓ RNA polymerase disengages the mRNA and the DNA Protein Synthesis • Alternative Splicing (eukaryotes only) ✓ Exons are “coding” regions ✓ Introns are removed ✓ different combinations of exons form different mRNA resulting in multiple proteins from the same gene ✓ Humans have 30,000 genes but are capable of producing 100,000 proteins Protein Synthesis Transcription tRNA synthesis 1 2 mRNA mRNAmRNA copy of a gene is synthesized ✓Cytoplasm of prokaryotes ✓Nucleus of eukaryotes mRNA is used by ribosome to build protein (Ribosomes attach to the mRNA and use its sequence of nucleotides to determine the order of amino acids in the protein) ✓Cytoplasm of prokaryotes and eukaryotes ✓Some proteins feed directly into rough ER in eukaryotes Translation Protein Synthesis Transcription • Translation tRNA synthesis ✓ Every three mRNA nucleotides (codon) specify an amino acid mRNA Translation Protein Synthesis • Translation ✓ tRNA have an anticodon region that specifically binds to its codon Protein Synthesis Transcription • Translation ✓ Each tRNA carries specific amino acid tRNA asynthesis mRNA Translation Protein Synthesis Transcription tRNA synthesis mRNA Translation Aminoacyl tRNA synthetases attach amino acids to their specific tRNA Protein Synthesis mRNA • Translation Initiation ✓ Start codon signals where the gene begins (at 5’ end of mRNA) Translation 5’ 3’ AUGGACAUUGAACCG… start codon Protein Synthesis Small ribosomal subunit • Translation Initiation ✓ Start codon signals where the gene begins (at 5’ end of mRNA) ✓ Ribosome binding site (Shine Dalgarno sequence) upstream from the start codon binds to small ribosomal subunit – then this complex recruits the large ribosomal subunit Small ribosomal subunit Large ribosomal subunit Ribosome Protein Synthesis • Translation Scanning ✓ The ribosome moves in 5’ to 3’ direction “reading” the mRNA and assembling amino acids into the correct protein large ribosome subunit small ribosome subunit Protein Synthesis • Translation Scanning ✓ The ribosome moves in 5’ to 3’ direction “reading” the mRNA and assembling amino acids into the correct protein Protein Synthesis • Translation Termination ✓ Ribosome disengages from the mRNA when it encounters a stop codon Practice Question Translate the following mRNA sequence AGCUACCAUACGCACCCGAGUUCUUCAAGC Practice Question Translate the following mRNA sequence AGCUACCAUACGCACCCGAGUUCUUCAAGC Serine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine Practice Question Translate the following mRNA sequence AGCUACCAUACGCACCCGAGUUCUUCAAGC Serine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine Ser – Tyr – His – Thr – His – Pro – Ser – Ser – Ser - Ser Practice Question Translate the following mRNA sequence AGCUACCAUACGCACCCGAGUUCUUCAAGC Serine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine Ser – Tyr – His – Thr – His – Pro – Ser – Ser – Ser - Ser S – Y –H– T – H – P – S – S – S - S Protein Synthesis • Multiple RNA polymerases can engage a gene at one time • Multiple ribosomes can engage a single mRNA at one time Transcription DNA mRNAs Translation Protein Synthesis • Eukaryotes: transcription occurs in the nucleus and translation occurs in the cytoplasm • Prokaryotes: Transcription and translation occur simultaneously in the cytoplasm RNA • There are four main types of RNA: 1. mRNA - RNA copy of a gene used as a template for protein synthesis 2. rRNA - part of structure of ribosomes 3. tRNA - amino acid carrier that matches to mRNA codon 4. snRNA - found in nucleus where they have several important jobs Practice Questions 1. Why is DNA synthesis said to be “semiconservative”? 2. What role do DNA polymerase, DNA primase (a type of RNA polymerase), helicase, topoisomerase, RNase H, and ligase play in DNA replication? 3. What is the difference between how the leading strand and lagging strand are copied during DNA replication? Why do they have to be synthesized differently in this fashion? 4. What would happen if insufficient RNase H were produced by a cell? What if insufficient ligase were produced by a cell? 5. What are four key differences between DNA polymerase and RNA polymerase? (“they are difference molecules” doesn’t count as one!) 6. Compare and contrast codons and anticodons? 7. What is alternative splicing? Why is it necessary in eukaryotes? 8. During translation, what amino acid sequence would the following mRNA segment be converted into: AUGGACAUUGAACCG? 9. How come there are only 20 amino acids when there are 64 different codons? 10. How come prokaryotes can both transcribe and translate a gene at the same time, but eukaryotes cannot?