* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Genes
Protein moonlighting wikipedia , lookup
History of RNA biology wikipedia , lookup
Genomic imprinting wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Epigenomics wikipedia , lookup
Transposable element wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Genetic engineering wikipedia , lookup
Cancer epigenetics wikipedia , lookup
Ridge (biology) wikipedia , lookup
Gene nomenclature wikipedia , lookup
Short interspersed nuclear elements (SINEs) wikipedia , lookup
Human genome wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Gene expression programming wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Epigenetics of diabetes Type 2 wikipedia , lookup
Minimal genome wikipedia , lookup
Gene desert wikipedia , lookup
Genome (book) wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Epigenetics in learning and memory wikipedia , lookup
Non-coding RNA wikipedia , lookup
Long non-coding RNA wikipedia , lookup
Transcription factor wikipedia , lookup
Genome evolution wikipedia , lookup
Messenger RNA wikipedia , lookup
History of genetic engineering wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Non-coding DNA wikipedia , lookup
Point mutation wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Gene expression profiling wikipedia , lookup
Epitranscriptome wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Microevolution wikipedia , lookup
Designer baby wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Helitron (biology) wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Gene Circuits -2 Shu-Ping Lin, Ph.D. Institute of Biomedical Engineering E-mail: splin@dragon.nchu.edu.tw Website: http://web.nchu.edu.tw/pweb/users/splin/ Date: 10.20.2010 Genes Flow of information in gene expression from genes in the form of DNA to mRNA by transcription and from mRNA to proteins in the form of translation. TRANSCRIPTION TRANSLATION DNA mRNA Ribosome (a) Prokaryotic cell. In a cell lacking a nucleus, mRNA produced by transcription is immediately translated into proteins without additional processing. Polypeptide Nuclear envelope TRANSCRIPTION DNA RNA PROCESSING Pre-mRNA mRNA Ribosome TRANSLATION Polypeptide (b) Eukaryotic cell. The nucleus provides a separate compartment for transcription. The original RNA transcript, called pre-mRNA, is processed in various ways before leaving the nucleus as mRNA. Genes Are Found on Both Strands In eukaryotes, coding regions (exons) are separated noncoding sequences (introns). Exons, introns and regulatory sequences of a gene all lie on the same strand and the start and stop codons are at the 5’ and 3’-end of the strand respectively. TRANSCRIPTION RNA PROCESSING DNA Pre-mRNA 5 Exon Intron 5 Cap 30 31 1 Intron Exon Exon 3 Poly-A tail 104 105 146 Pre-mRNA Coding segment mRNA Ribosome Introns cut out and exons spliced together TRANSLATION Polypeptide mRNA 5 Cap 1 5 UTR Poly-A tail 146 3 UTR Gene Anatomy Regulation of gene expression is mostly controlled at transcription. But some level of regulation also occurs post transcription and translation. Prokaryotic Genes: Bacterial DNA contains mostly uninterrupted protein-coding regions in which genes clustered on DNA subunits called Operons. Cluster of Genes lie on the same DNA strand that encode proteins with related functions all controlled by a single Regulatory circuit. Operon consists of promoter (P) and operator (O), regulatory sequences, coding regions of each gene and small spacers between genes. * Lac Operon: (Digestion of the milk sugar lactose, such as gene lacZ, lacY, lacA) Lac Operon Digestion of milk sugar lactose: lac Z, lac Y, and lac A Lac Z: contains 3075 bases and encodes β-galactosidase, which splits the disaccharide lactose into monosaccharides glucose and galactose Lac Y: 1254 bases and called lactose permease to encode transmembrane protein by using energy of electrochemical gradient across membrane to pump lactose into cell Lac A: 612 b (shortest) and encodes thiogalactoside transacetylase, which degraded small carbon compounds RNA polymerase (RNAp): protein complex, low affinity for DNA but in promoter regions, binds to promoter for initiating transcription Lac I: lac repressor (repressor protein), binds to operator region and then blocks interaction of RNAp with gene-regulatory segment and prevents gene transcription Catabolic gene activating protein (CAP): activator protein (DNA binding protein), binds to promoter to attract/stimulate RNAp to the lac operon and enhance transcription rate Eukaryotic Genes Distribution of eukaryotic genes differs from prokaryotic genes Transcription factor (TF): conserved, regulate transcription by binding regulatory sites Only a fraction of eukaryotic DNA codes for proteins or RNA molecules: 1.1% of human genome represents protein-coding genes Coding regions are not continuous ( Split genes), contains exons and introns. Introns often account for most of the gene size.: BRCA-1 (Chr 17) 100,000 bp. Codes for a protein of 1863 aa rest is introns (~98%). BRCA-2 (Chr 13) 200,000 bp. Codes for a protein of 3418 aa. Eukaryotic genes may have multiple sequences regulating the same gene. Promoter is the regulatory element closest to the first exon. Regulator sites distant from the first exon are called enhancers. Some of these sequences may be as far as 50,000 bp upstream. General TF: many are not specific to a given gene, but function as regulatory proteins for multiple genes Specific TF: regulate cell-signaling pathways, exposing cell to external stimulus can increase synthesis or activation of these TF TFIID binding to TATA box at promoter and concluding with activation of RNA polymerase II (RNApII) Initiate transcription Start codon: placed a few base pairs after transcription initiation site Stop codon (poly A sequence): in last exon DNA Looping Both exons and introns are transcribed into premature mRNA. Introns are excised and exons are brought together before mRNA leaves nucleus and enters cytoplasm for translation. Activator proteins bound to enhancer transiently bind to RNApII by looping out intervening DNA. Folding DNA enables proteins bound to distant regulatory sites to physically interact with proteins bond to proximal sites. DNA looping might enable transcription factors bound to enhancers to physically interact with the components of the transcription initiation complex assembled at the promoter. Activators: TFs bind to enhancers, opening up DNA at transcription-initiation sites Human Chromosomes Protein-coding genes: linearly arranged on the chromosomes of multicellular organisms Approximate locations of thousands of genes on human chromosomes have been identified. Light (genes are distributed, high GC concentrations ) and dark bands Provide significant information about the function of genes and progression of certain diseases such as cancer Gene mutations cause cancer occur in celldivision-cycle-regulating genes Gene mapping: closely related organisms Gene Circuits Gene expression can be explained through mathematical models based on Boolean networks Regulation of Gene Expression in Prokaryotes E.coli genome decoded 101 - 105 copies of proteins depending on the need Transcription rate can vary 1000 fold Regulation of (milk sugar) lactose catabolism: Glucose No lactose b-gal No allolactose Glucose Lactose b -gal Allolactose binds LacR Allolactose High Affinity Regulation of Lac Operon Multiple logic network Involves Catabolic gene activating Protein (CAP): stimulate transcription only when form complex with cAMP cAMP signaling molecule (hunger signal): indicate absence of glucose and lead to synthesis of enzymes CAP + cAMP RNAp Lac Operon also involves feedback control Regulation of Lac Operon Prokaryotic cell structure is simple allowing for rapid movement of ligands affecting gene expression. Lac repressor (R) bound to the operator unless it forms a complex with allolactose (A) in a glucose-poor and lactose-rich environment Blocks transcription Lac Z: contains 3075 bases and encodes β-galactosidase, which splits the disaccharide lactose into monosaccharides glucose and galactose RNAp binds to operator sites and initiates transcription only when CAP protein (form a complex with second messanger cAMP) binds to promoter Regulatory Logic of Eukaryotic Genes Multiple regulatory switches encode gene-specific transcription factors Include regulatory sites: (A) proximal; (B) distal enhancer and (C) distal repressor Module A, 3 regulatory sites, 2 of which, when occupied with TAs, amplify and relay signals arriving from distal modules to basal promoter (BP) of gene Transcription is represses when both C and A1 are occupied with their specific TFs. A2 occupied Acts as a switch to B Amply signal coming from B and relay to BP A3 dominates signal for transcription. Time Course of Transcription/Regulation Prokaryotic cell structure is simple allowing for rapid movement of ligands affecting gene expression. Within seconds Eukaryotic gene transcription depends on the concentrations of TFs in the nucleus. H form complex with Rab at promoter Pab 1. Polymerase transcribes gene “a” Produce protein A 2. Enough A binds to Rc Produces C 3. Sufficient C binds to Rb Produces B Bionetworks Proteins and gene regulatory elements that also include metabolic pathways Synthesis of aromatic amino acids - Phe, Tyr, Trp By plants and bacteria (not in humans) A B, B C, C D, D F B E, E E’, E’ F, F G DNA molecule Gene 2 Gene 1 Gene 3 DNA strand 3 A C C A A A C C G A G T (template) 5 TRANSCRIPTION mRNA 5 U G G U U U G G C U C A 3 Codon TRANSLATION Protein Trp Amino acid DNA: Phe 3’ Gly Ser , , , , , , , , , , , | | | | | | | | | | | | accgtgattcatcccgccaacaaccgctattatac , , , , , , , , , , , , 5’ 1. mRNA 5’ UGG,CAC,UAA,GUA,GGG,CGG,UUG,UUG,GCG,AUA,AUA,UG 3’ Amino-acid sequence WH*VGRLLAII 2. mRNA 5’ U,GGC,ACU,AAG,UAG,GGC,GGU,UGU,UGG,CGA,UAA,UAU,G 3’ Amino-acid sequence GTK*GGCWR*Y 3. mRNA 5’ UG,GCA,CUA,AGU,AGG,GCG,GUU,GUU,GGC,GAU,AAU,AUG 3’ Amino-acid sequence ALSRAVVGDNM